MiRNA imaging analysis method based on strand displacement mediated isothermal amplification

Abstract

The invention discloses a miRNA imaging analysis method based on strand displacement mediated isothermal amplification, which comprises the following steps: designing a closed strand according to the sequence of target miRNA, and synthesizing a DNAzyme strand, the closed strand having a complementary sequence capable of hybridizing with the DNAzyme strand; a substrate chain is designed, two ends of the substrate chain are modified with fluorescence quenching groups, the substrate chain can be hybridized with a DNAzyme chain, and the DNAzyme chain can specifically recognize and cut an rAG site in the substrate chain; the 5'end of a DNAzyme chain is modified on the surface of the gold nanoparticle, the gold nanoparticle modified by the DNAzyme chain, a closed chain, a substrate chain and a sample to be detected are prepared into a reaction system, and a fluorescence signal value is recorded after the reaction. The miRNA detection strategy which is efficient, sensitive, good in specificity and low in cost is built, and imaging analysis of miRNA in cells is achieved through the gold nanoparticle.

Description

Technical Field

[0001] The invention relates to the technical field of biological imaging analysis, and in particular to a miRNA imaging analysis method based on strand displacement-mediated isothermal amplification. Background Art

[0002] MicroRNA (miRNA) is a class of endogenous single-stranded small RNA with gene regulatory function, generally composed of 18 to 22 bases. In 1993, Lee et al. first discovered miRNA Lin-4 from nematodes. There are many types of miRNA families. The second miRNA family is let-7 discovered from Caenorhabditis elegans, which is 21 bases long. This family contains four members, namely let-7, mir-48, mir-84 and mir-241. They jointly participate in the gene regulation of nematodes from larvae to adults, and their existence range is wider than miRNA Lin-4. Studies have found that the gene regulation of mammals is inseparable from the combination of miRNA and gene silencing complex (RISC). The specific site nucleotides on the 5′ end sequence of miRNA can specifically recognize the regulatory element of the 3′-UTR of mRNA and bind to RISC to achieve gene regulation. [3] Studies have shown that miRNAs are widely present in animals and plants. About 30% of human genes are regulated by miRNAs and participate in the growth, development, aging, death and other processes in the life activities of the body.

[0003] In recent years, it has been found that miRNAs are widely present in lung cancer, breast cancer, pancreatic cancer, thyroid cancer, and colon cancer cells, and the expression levels in different cancer cells are significantly different. Therefore, tumor-related miRNA research has become the current research frontier and hotspot in the fields of molecular biology and medicine. In 2019, Karimi et al. found that miRNA-301a and miRNA-23a were highly expressed in colorectal cancer; in 2021, Wu et al. detected that the expression level of miRNA-21 in human breast cancer cells (MCF-7) and human cervical cancer cells (HeLa) was significantly higher than that in normal cells through DNA nanomachines. The abnormal expression and tissue specificity of miRNA in major diseases such as tumors make it an important biomarker for cancer detection. Therefore, accurately quantifying the expression level of miRNA in cells can help assist in the diagnosis, metastasis, chemotherapy resistance and prognosis of cancer in clinical practice, and provide theoretical and technical support for achieving better therapeutic effects.

[0004] miRNA plays an important role in the early screening and diagnosis of major diseases such as cancer. In recent years, researchers have developed a variety of miRNA detection technologies and analysis methods. Common detection methods mainly include Northern blotting, microarray technology, and real-time quantitative PCR (qRT-PCR). Although these technologies have made great progress in nucleic acid detection, gene regulation, clinical diagnosis, etc., they still have inevitable limitations. For example, the Northern blotting method is complicated and time-consuming, and has low sensitivity. It cannot accurately detect low-molecular-weight miRNA, so there are great challenges. Microarray technology is easy to operate and has a fast detection speed, but its detection limit, sensitivity and specificity are low. qRT-PCR has the advantages of rapidity, high sensitivity and specificity, but this technology is susceptible to the risk of sample contamination during operation, which affects the sensitivity and specificity of the detection. At the same time, this method requires sophisticated instruments and equipment for precise cycle temperature control, which is more stringent in operation; in addition, this method requires expensive proteases for catalysis, and can only be detected in vitro, and cannot provide information on the distribution and real-time changes of miRNA in vivo.

[0005] Therefore, it is necessary to develop an efficient, sensitive, specific and low-cost miRNA detection method. Summary of the invention

[0006] In order to solve the above technical problems, the purpose of the present invention is to provide a miRNA imaging analysis method based on strand displacement-mediated isothermal amplification. The present invention does not require protease catalysis, but utilizes the catalytic cleavage of nuclease (DNAzyme) and the toehold strand displacement reaction to construct an efficient, sensitive, specific, and low-cost miRNA detection strategy, and realizes intracellular miRNA imaging analysis through gold nanoparticles with good biocompatibility and delivery ability.

[0007] In order to achieve the above technical objectives and the above technical effects, the present invention is implemented through the following technical solutions:

[0008] A miRNA imaging analysis method based on strand displacement-mediated isothermal amplification comprises the following steps:

[0009] According to the sequence of the target miRNA, a closed chain is designed and a DNAzyme chain is synthesized, wherein the closed chain has a complementary sequence capable of hybridizing with a partial region of the DNAzyme chain;

[0010] Designing a substrate chain containing rAG sites, both ends of which are modified with fluorescent quenching groups and can hybridize with the DNAzyme chain, and the DNAzyme can specifically recognize and cut the rAG sites in the substrate chain;

[0011] The 5' end of the DNAzyme chain was modified on the surface of gold nanoparticles;

[0012] The gold nanoparticles modified with the DNAzyme chain, the closed chain, the substrate chain and the sample to be tested are prepared into a reaction system, and imaging analysis is performed after the reaction.

[0013] Furthermore, the reaction system is in Mg 2+ The reaction is carried out under the presence of

[0014] Furthermore, the 5' end of the DNAzyme chain was modified on the surface of gold nanoparticles using a salt aging method.

[0015] Furthermore, the number of hybridized bases between the blocking strand and the DNAzyme strand is greater than the number of hybridized bases between the DNAzyme strand and the substrate strand.

[0016] Furthermore, the fluorescence quenching groups are BHQ-1 and FAM.

[0017] Furthermore, gold nanoparticles can deliver the reaction system into cells for imaging analysis of intracellular miRNA.

[0018] The beneficial effects of the present invention are:

[0019] The present invention uses gold nanoparticles as delivery carriers, and based on the recognition of target miRNA, DNAzyme cleavage of substrate chains combined with the Toehold chain displacement principle, develops a fluorescence signal amplification method based on DNAzyme-mediated combination with the Toehold chain displacement principle to achieve detection imaging analysis of target miRNA.

[0020] The method of the present invention has the following characteristics:

[0021] 1. The activity of DNA nucleosidase does not require strict temperature and pH control and can react at room temperature;

[0022] 2. Short detection time. The time for the target enzyme cleavage reaction is as low as 10 minutes. The actual sample processing time to detect the target miRNA is about 3 hours, which can achieve rapid enzyme cleavage;

[0023] 3. No need to rely on large instruments, common heating devices can complete the reaction, which has the advantages of simplicity and economy;

[0024] 4. The present invention modifies DNAzymes on nanoparticles, which can achieve simultaneous enzyme cleavage of multiple DNAzymes at different sites on the carrier, and quickly achieve signal amplification, without being limited by the length of the DNAzyme and the influence of steric hindrance during enzyme cleavage;

[0025] 5. The present invention can realize the integration of DNAzyme blocking and enzyme cleavage, and it is not necessary to lock the DNAzyme with a blocking chain before adding the enzyme cleavage substrate chain. Instead, the DNAzyme, the blocking chain and the enzyme cleavage substrate chain can be added to the reaction system at the same time without affecting the reaction mechanism, so the operation is more convenient and faster;

[0026] 6. The present invention can realize imaging analysis of intracellular miRNA, thereby achieving semi-quantitative detection of miRNA in actual samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a schematic diagram of the miRNA detection principle of the present invention;

[0028] Figure 2 The gold nanoparticles in the embodiments of the present invention are characterized by (A), (B), (C), and (D) are UV-Vis, DLS, TEM, and Zeta potential characterization diagrams, respectively;

[0029] Figure 3 This is a graph for investigating the stability of gold nanoparticles;

[0030] Figure 4 Characterization diagram of DNA functionalized gold nanoparticles. (A), (B), (C), and (D) are UV-Vis, DLS, agarose electrophoresis, and colorimetric characterization diagrams, respectively.

[0031] Figure 5 This is the electrophoresis diagram of DNAzyme cleaving the substrate chain;

[0032] Figure 6 This is the electropherogram of miRNA displacement ability;

[0033] Figure 7 This is the electrophoresis diagram of miRNA triggering DNAzyme to cleave the substrate chain;

[0034] Figure 8 This is an optimization analysis diagram for system detection time;

[0035] Fig. 9 This is an optimization analysis diagram for the system detection temperature;

[0036] Fig.10 To detect Mg in the system 2+ Optimization analysis diagram of concentration;

[0037] Fig.11 Electrophoretic diagram for metal ion selectivity investigation;

[0038] Fig.12 This is a specific analysis diagram for detecting miRNA let-7a;

[0039] Fig.13This is an analysis chart of the anti-interference ability of the detection system in serum;

[0040] Fig.14 It is a fluorescence quantitative imaging analysis diagram of the detection example. DETAILED DESCRIPTION

[0041] The technical solutions in the present invention will be described clearly and completely below in conjunction with specific embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0042] like Figure 1 As shown, the present invention constructs a nanoprobe based on the combination of gold nanoparticles (AuNPs) and DNAzyme for quantitative detection of miRNA, in order to achieve early diagnosis and treatment of related diseases. The design mainly combines the advantages of AuNPs' good biocompatibility, low toxicity, easy modification, and delivery of nucleic acid probes with the advantages of DNAzyme's specific recognition of substrate chain bases and cutting, economical and stable conditions, to construct a miRNA detection strategy based on the nucleic acid toehold chain displacement principle and nanomaterials, and achieves quantitative detection of related miRNAs through amplification of fluorescent signals.

[0043] The present invention designs a series of nucleotide sequences, wherein the DNAzyme chain (T1) and the closed chain (T2) achieve strong hybridization through the principle of base complementary pairing to close the catalytic structure of the DNAzyme in the DNAzyme chain sequence. When the target miRNA is present, it can hybridize with the closed chain based on the toehold chain displacement effect, triggering the exposure of the DNAzyme sequence in the DNAzyme chain, and further hybridizing with the substrate chain (Substrate); at this time, in the Mg 2+ Under the catalytic action of , DNAzyme can specifically recognize and cut the rAG site in the substrate chain, so that the fluorescence quenching pair BHQ-1 and FAM modified at both ends of the substrate chain are away, releasing the fluorescence signal. Subsequently, DNAzyme continues to recognize and cut new substrate chains. This process is repeated continuously to achieve fluorescence signal amplification, and the miRNA content is analyzed by fluorescence intensity imaging in the detection system. In addition, by modifying the DNAzyme chain on the surface of gold nanoparticles, the detection system can be delivered into cells to achieve imaging analysis of intracellular miRNA.

[0044] Based on the above theory, the present invention provides a miRNA imaging analysis method based on strand displacement-mediated isothermal amplification, comprising the following steps:

[0045] According to the sequence of the target miRNA, a closed chain is designed and a DNAzyme chain is synthesized, wherein the closed chain has a complementary sequence capable of hybridizing with a partial region of the DNAzyme chain;

[0046] Designing a substrate chain containing rAG sites, both ends of which are modified with fluorescent quenching groups and can hybridize with the DNAzyme chain, and the DNAzyme can specifically recognize and cut the rAG sites in the substrate chain;

[0047] The 5' end of the DNAzyme chain was modified on the surface of gold nanoparticles using the salt aging method;

[0048] The gold nanoparticles modified with DNAzyme chains, the blocking chains, the substrate chains and the samples to be tested were prepared into a reaction system. 2+ The reaction was carried out under the presence of , and imaging analysis was performed after the reaction.

[0049] In the above method, the number of hybridized bases between the blocking strand and the DNAzyme strand is greater than the number of hybridized bases between the DNAzyme strand and the substrate strand.

[0050] For the substrate chain, the fluorescence quenching groups are BHQ-1 and FAM.

[0051] During detection, gold nanoparticles can deliver the reaction system into cells for imaging analysis of intracellular miRNA.

[0052] The present invention is further described in detail below through specific examples. This example takes the detection of miRNA let-7a as an example.

[0053] The nucleotide sequences involved in the following examples are as follows:

[0054] Sequence of miRNA let-7a (SEQ ID NO: 1): TTCACAGTGGCTAAGTTCCGC;

[0055] The sequence of the DNAzyme chain (-SH is a thiol group modified at the 5' end) (SEQ ID NO: 2): HS-TTTTTTCTAGGTCTCGTCCGAGCCGGACGAAATGAGGATTATTCACA;

[0056] The sequence of the closed strand (SEQ ID NO: 3):

[0057] GTGGCTAAGTCATTCCTAACAGTGCGGAACTTAGCCACTGTGAATAATC C

[0058] Sequence of substrate strand (SEQ ID NO:4):

[0059] FAM-TCCTCATAGCGAGACCTAGC-BHQ-1, in which the 8th base A is modified to rA.

[0060] 1. Establishment of analytical method (taking miRNA let-7a as an example)

[0061] (1) Preparation and characterization of AuNPs and DNA-functionalized AuNPs

[0062] (a) Preparation and characterization of AuNPs

[0063] AuNPs with ideal particle size were prepared by reducing chloroauric acid with sodium citrate; AuNPs were characterized by particle size analyzer, UV-visible spectrophotometer, TEM and SEM to verify that the preparation was successful and the particle size met the requirements; the stability of AuNPs was investigated by measuring the changes in particle size and Zeta potential of AuNPs at 1, 3, 7, 10, 15, 20 and 30 days. The specific process is as follows:

[0064] Soak a dry beaker, a 100mL three-necked flask, a magnet and a brown bottle containing gold nanoparticles in aqua regia for more than 1 hour, rinse with deionized water in small amounts for multiple times, and dry or naturally dry all spare instruments; take 20mL of chloroauric acid (1mM) and add it to the three-necked flask, set the reaction temperature to 120°C, and react at a speed of 20rpm until the system boils, keep boiling for 25 minutes, quickly add 2mL of preheated sodium citrate solution (38.8mM) to continue the reaction, and maintain the solution for 15 minutes after it turns wine red, stop heating, take out the flask, and keep the solution speed to slowly cool it to room temperature (>0.5h); the product after the reaction is filtered through a 0.22μm microporous filter membrane (water system), and the filtrate is transferred to a brown bottle and stored at 4°C in the dark for later use.

[0065] To verify whether AuNPs were successfully prepared, UV, DLS, Zeta potential and TEM were used to characterize them. Figure 2 As shown in (A), the AuNPs prepared by the present invention have a characteristic absorption peak at 520nm, indicating that the size of the prepared AuNPs is at the nanometer level. Figure 2 (B) The experimental results show that the particle size of the synthesized AuNPs is mainly around 30nm, with uniform particle size and good dispersion. Figure 2(C) The TEM test results show that the gold nanoparticles prepared in this experiment are spherical and have a particle size of about 13nm; since the principle of DLS measurement of nanoparticle size is based on the Brownian motion of nanoparticles in the colloidal system to establish a correlation function model to calculate the diffusion coefficient DI of its motion, and then calculate the equivalent particle size (fluid dynamics particle size or hydration particle size) Dh of the particles through the Einstein-Stokes equation, the particle size measured by this method is the average value of all nanoparticles in the system. Therefore, there is a certain difference between the particle size measured by DLS and the particle size measured by TEM. In addition, Figure 2 The Zeta potential results of (D) show that the synthesized gold nanoparticles are electronegative, with a potential of about -38mV, and have good stability. The above results all show that the gold nanoparticles prepared by this method have the characteristics of small size, good dispersibility and high stability.

[0066] The changes in particle size and Zeta potential of the prepared gold nanoparticles were investigated after being stored at 4°C for 1, 3, 7, 10, 15, 20, and 30 days. Figure 3 (A) and 3(B), it can be seen that the particle size and potential of the gold nanoparticles prepared in the experiment did not change much within 30 days, indicating that the prepared gold nanoparticles have good stability.

[0067] (b) Preparation and characterization of DNA-functionalized AuNPs (gold nanoparticles modified with DNAzyme chains)

[0068] In this method, the 5' end of the DNAzyme chain (specifically 8-17 DNAzyme chain) is modified on the surface of gold nanoparticles by salt aging method; the DNA functionalized AuNPs are characterized by particle size analyzer, Zeta potential, UV-visible spectrophotometer, agarose gel electrophoresis, colorimetry, TEM and SEM to verify the successful modification. The specific process is as follows:

[0069] The present invention adopts a salt aging method, takes 15 μL DNAzyme chain (10 μM) and 0.3 μL TCEP (50 mM) and mixes them evenly, and incubates them at room temperature for 2 hours (simultaneously ultrasonicates gold nanoparticles for 30 minutes); adds 171.8 μL AuNPs (8.73 nM), mixes them evenly, and incubates them at 300 rpm and room temperature for 16 hours; adds 18.7 μL NaCl (2M) in portions every 40 minutes (no vortex mixing is required, and it is injected into the solution), and incubates them at room temperature (25°C) for 24 hours; then, centrifuges at 12500 rpm for 30 minutes, and sets the centrifugal temperature to 4°C (pay attention to balancing); takes out the clear solution, and uses pH 8.0 1*Tris-HCl (10mM) was used to wash the precipitate three times (1 mL was added each time for washing, and the centrifugation conditions were the same as above); after centrifugation, the precipitate was dispersed in 100 μL, pH 8.3 Tris-HCl (10mM), and ultrasonicated for 5 min; UV, particle size, Zeta potential and agarose electrophoresis were performed for characterization, and the samples were stored at 4°C in the dark. Figure 4 As shown in (A), the maximum ultraviolet absorption wavelength of the modified gold nanoparticles has a certain red shift, and there is a characteristic absorption peak of nucleotides at 260nm; Figure 4 (B) The results show that the size of gold nanoparticles increased to about 70 nm after modification, indicating that the nucleotide chain was modified on the surface of gold nanoparticles; Figure 4 The electrophoresis results of (C) also verified that the functionalized gold nanoparticles were successfully modified. From the bands in lanes 2, 3, and 4, it can be seen that the black bands (purple bands under naked eye observation) shown in the lanes are gold nanoparticles modified with DNA. Because they are negatively charged, they move a certain distance in the gel lane. In addition, there is no DNAzyme nucleic acid chain band in lane 4, indicating that there is no free DNAzyme chain in the DNA-functionalized gold nanoparticle solution, and the modification is sufficient. Figure 4 (D) shows that the color of the gold nanoparticle system did not change much after modification, indicating that the gold nanoparticles modified with DNAzyme chains did not produce an aggregation effect and the system had good dispersion. The above experimental results show that this study has successfully prepared DNA-functionalized gold nanoparticles.

[0070] (2) Feasibility of the method

[0071] (a) 8-17 DNAzyme recognizes and cuts rAG site

[0072] Non-denaturing polyacrylamide gel electrophoresis (PAGE) was used to verify the feasibility of 8-17 DNAzyme cleavage of the substrate chain rAG. 2+ The catalytic cleavage reaction is carried out and the cleavage product bands are observed by PAGE electrophoresis. The specific process is as follows:

[0073] Two groups of experiments were set up respectively. The experimental group added Mg 2+(1mM), the control group did not add Mg 2+ . First, add 8-17DNAzyme chain (1μM), substrate chain (1μM), Tris-HCl (5mM, pH=7.5), and NaCl (5mM) to the reaction system, and add DEPC water to make up to 20μL; denature the mixture at 95℃ for 6min, cool naturally, and then incubate at 37℃ for 1h to complete the reaction; take 12μL of the reaction, add 4μL of electrophoresis loading buffer, mix, add to the gel electrophoresis channel for electrophoresis, the electrophoresis conditions are: voltage 80V, running time about 2.5h; finally, stain for 50min, and analyze by imaging with a gel imaging system. Figure 5 As shown in lanes 5 and 6, the substrate chain was cleaved in large quantities in the presence of magnesium ions, producing cleavage products in the red box, indicating that the 8-17 DNAzyme chain in this scheme has good enzyme cleavage ability for the rAG site of the substrate chain.

[0074] (b) miRNA-triggered toehold strand displacement reaction

[0075] PAGE and fluorescence spectrophotometer were used to verify the feasibility of the target miRNA triggering the toehold strand displacement reaction. Two groups of reaction solutions with and without the target miRNA let-7a were set up respectively, and the PAGE electrophoresis was observed for hybridization and enzyme cleavage products, and the fluorescence spectrum was observed for fluorescence signals. The specific process is as follows:

[0076] Three groups of experiments were set up, DNAzyme chain (1 μM) + blocking chain (1 μM), DNAzyme chain (1 μM) + blocking chain (1 μM) + substrate chain (1 μM), DNAzyme chain (1 μM) + blocking chain (1 μM) + miRNA (1 μM). Mg was added to the reaction solution. 2+ (1mM), Tris-HCl (5mM, pH=7.5), NaCl (5mM), and finally DEPC water was added to make up to 20μL; the reaction system was denatured at 95℃ for 6min, cooled naturally, and incubated at 37℃ for 1h. After the reaction was completed, the reaction product was analyzed by gel electrophoresis under the following conditions: voltage 80v, running time about 2.5h; finally, dyed for 50min, and imaged and analyzed by gel imaging system. Figure 6Lanes 5 and 6 show that when there is no miRNA-7a, the DNAzyme chain and the closed chain are stably hybridized (purple box), the separate bands of the DNAzyme chain and the closed chain disappear, and the substrate chain band is clear (lane 6). Therefore, when the closed chain exists, the substrate chain cannot hybridize with the DNAzyme chain and cannot be cleaved by the enzyme; Lane 7 shows that when miRNA exists, the hybridization bands of the DNAzyme chain and the closed chain disappear, forming clear hybridization bands of miRNA and the closed chain (green box), indicating that the miRNA has a good replacement ability for the DNAzyme chain.

[0077] (c) Effect of target miRNA on enzyme cleavage ability

[0078] Two groups of experiments were set up respectively. The experimental group was added with target miRNA let-7a (1 μM), and the blank group was not added with target miRNA. Mg was added to the reaction solution. 2+ (1mM), Tris-HCl (5mM, pH=7.5), NaCl (5mM), and finally DEPC water was added to make up to 20μL; the reaction system was denatured at 95℃ for 6min, cooled naturally, and incubated at 37℃ for 1h. After the reaction was completed, the reaction product was analyzed by gel electrophoresis under the following conditions: voltage 80v, running time about 2.5h; finally, dyed for 50min, and imaged and analyzed by gel imaging system. Figure 7 Lanes 6 and 7 show that when miRNA is present, Mg 2+ It can catalyze the DNAzyme sequence in the DNAzyme chain to specifically recognize and cleave the substrate chain, causing the substrate chain band to disappear and produce enzyme cleavage products, proving that the scheme is feasible.

[0079] (3) Optimization of reaction conditions

[0080] (a) Optimization of reaction time

[0081] The reaction included miRNA let-7a (1 μM), DNAzyme chain (1 μM), blocking chain (1 μM), substrate chain (1 μM), Mg 2+ (1mM), Tris-HCl (5mM, pH=7.5), NaCl (5mM), and finally DEPC water was added to make up to 20μL, denatured at 95℃ for 6min, cooled naturally to room temperature, and then the cleavage reaction time was set to 0min, 5min, 10min, 30min, 1h, 2h, and 4h respectively. Figure 8As shown in (A), as the reaction time increases, the fluorescence signal gradually increases. When the reaction time is 10 min, the fluorescence signal reaches a stable state. Even if the reaction time is extended to 4 h, there is no significant effect on further enhancing the fluorescence signal. Therefore, this example selects a reaction time of 10 min as the optimal enzyme cutting time for subsequent research.

[0082] (b) Reaction temperature optimization

[0083] The reaction included miRNA let-7a (1 μM), DNAzyme chain (1 μM), blocking chain (1 μM), substrate chain (1 μM), Mg 2+ (1mM), Tris-HCl (5mM, pH=7.5), NaCl (5mM), and finally DEPC water was added to make up to 20μL, denatured at 95℃ for 6min, cooled naturally to room temperature, and the cutting temperatures were set to 4℃, 25℃, 37℃, 40℃ and 50℃ respectively. Fig. 9 As shown, the fluorescence value of the system does not change much in the range of 4°C to 50°C, which proves that the present strategy can detect miRNA in a wider temperature range. The miRNA detection strategy designed based on the present invention is expected to be applied to miRNA detection and analysis in cells. Therefore, this example selects 37°C as the optimal temperature for subsequent research.

[0084] (c) Optimization of magnesium ion concentration

[0085] miRNA let-7a (1 μM), DNAzyme chain (1 μM), blocking chain (1 μM), substrate chain (1 μM), Tris-HCl (5 mM, pH = 7.5), and NaCl (5 mM) were placed in a humidified medium containing different concentrations of Mg. 2+ 20 μL system, denature at 95℃ for 6 min, cool to room temperature naturally, and perform cleavage reaction at 37℃ for 10 min. Fig.10 As shown in the figure, the fluorescence value changes slowly between 0 and 1 mM of magnesium ion concentration. After 1 mM, the fluorescence value increases significantly with the increase of magnesium ion concentration until the fluorescence signal stabilizes at 100 mM. Therefore, 100 mM (final concentration 10 mM) was selected as the optimal magnesium ion concentration for subsequent research.

[0086] (d) Metal ion specific screening

[0087] The reaction system consisted of miRNA let-7a (1 μM), DNAzyme chain (1 μM), blocking chain (1 μM), substrate chain (1 μM), Tris-HCl (5 mM, pH = 7.5), and NaCl (5 mM) in a Zn-containing 2+ , Fe 2+ Mg 2+ and Pb2+ 20 μL of the system (metal ion concentration is 10 mM) was denatured at 95°C for 6 min, cooled to room temperature naturally, and cleaved at 37°C for 10 min. Fig.11 As shown, the substrate chain bands in lanes 5 and 7 disappeared and cleavage products were produced, indicating that Pb 2+ and Mg 2+ It can efficiently catalyze 8-17 DNAzyme to recognize and cut the substrate chain, among which Mg 2+ The catalytic system has a better effect; the substrate chains in lanes 6 and 8 are clear, and no enzyme cleavage products are produced, so Fe 2+ 、Zn 2+ No catalytic activity. The results show that this method has good metal ion selectivity. Based on Mg 2+ It is non-toxic to cells and widely exists in cells, and can directly trigger DNAzyme enzymes to catalyze the cleavage of substrates in cells. Therefore, the present invention selects Mg 2+ The optimal catalytic metal ion was used for subsequent experiments.

[0088] (e) Specificity of detecting miRNA let-7a

[0089] DNAzyme chain (1 μM), blocking chain (1 μM), substrate chain (1 μM), Tris-HCl (5 mM, pH = 7.5), NaCl (5 mM), Mg 2+ (10 mM) were placed in 20 μL system containing a series of different types of miRNA (each miRNA concentration was 1 μM), denatured at 95°C for 6 min, cooled naturally to room temperature, and cleaved at 37°C for 10 min. Fig.12 (A) Only miRNAlet-7a (lane 8) can trigger the exposure of the DNAzyme chain in the system, making the DNAzyme sequence of the DNAzyme chain available in the Mg 2+ Under the catalysis of , the substrate chain is efficiently cut, resulting in the disappearance of the substrate band and the generation of new short-chain products; other miRNA sequences (lanes 5, 6, and 7) cannot trigger the system's ability to cut the substrate; Fig.12 The fluorescence image of (B) shows that the fluorescence signal can be significantly enhanced only in the presence of miRNA-7a, further proving the ability of miRNA-7a to trigger the cleavage of the substrate. In summary, the strategy of the present invention can efficiently and specifically detect the target miRNA-7a.

[0090] (5) Anti-interference test

[0091] In order to investigate the anti-interference ability of the detection system, experimental groups with serum and without serum were set up respectively, and the difference in fluorescence values ​​between the two groups with and without miRNA was compared. The proportions of other raw materials in the system were the same as before. Fig.13 In the absence of miRNA (KB) or the presence of miRNA (target), the fluorescence values ​​of the groups with serum (serum) and without serum (no serum) were relatively stable, indicating that the system has good anti-interference ability in serum.

[0092] 2. Detection Example

[0093] The above system was used to perform imaging detection of miRNA let-7a in normal cells (NRK), liver cancer cells (SMMC), lung cancer cells (A549) and cervical cancer cells (Hela). First, gold nanoparticles modified with DNAzyme chains (2 μM), blocking chains (1 μM), Tris-HCl (5 mM, pH = 7.5), NaCl (5 mM), Mg 2+ The reaction system of (10 mM) was placed at 95°C for denaturation for 6 min, cooled naturally to room temperature, and then diluted 5 times with PBS for later use. The density of each well was 6×10 4 When the cells covered 75% of the plate area, 1 μM substrate chain was added to each well of the culture dish to a final concentration of 0.1 μM. The cells were then cultured at 37°C and 5% CO. 2 Incubate in an incubator until the cells have grown to 95% of the surface of the slide, wash with PBS three times, and add 200 μL of the prepared reaction system to each well of the 12-well plate for each adherent cell (NRK, SMMC, Hela, and A549) and incubate at 37°C, 5% CO 2 The cells were incubated in an incubator for 2 h for cleavage reaction, washed three times with PBS, stained with Hoechst dye for 30 min for cell nuclei, and then washed three times with PBS for laser confocal imaging to achieve fluorescence quantitative imaging detection of intracellular miRNA let-7a. Fig.14 It can be seen that the fluorescence signal in NRK cells is higher than that in other cancer cells, indicating that the target miRNA is lowly expressed in related cancer cells and highly expressed in normal cells.

[0094] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the present invention can be implemented in other specific forms without departing from the spirit or essential features of the present invention. Therefore, the embodiments should be considered exemplary and non-restrictive in all respects, and the scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims be included in the present invention.

[0095] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A miRNA imaging analysis method based on strand displacement-mediated isothermal amplification, characterized in that: The steps include: According to the sequence of the target miRNA, a closed chain is designed and a DNAzyme chain is synthesized, wherein the closed chain has a complementary sequence capable of hybridizing with a partial region of the DNAzyme chain; Designing a substrate chain containing rAG sites, both ends of which are modified with fluorescent quenching groups and can hybridize with the DNAzyme chain, and the DNAzyme can specifically recognize and cut the rAG sites in the substrate chain; The 5' end of the DNAzyme chain was modified on the surface of gold nanoparticles; The gold nanoparticles modified with the DNAzyme chain, the closed chain, the substrate chain and the sample to be tested are prepared into a reaction system, and imaging analysis is performed after the reaction.

2. The miRNA imaging analysis method based on strand displacement-mediated isothermal amplification according to claim 1, characterized in that: The reaction system was in Mg 2+ The reaction is carried out under the presence of 3. The miRNA imaging analysis method based on strand displacement-mediated isothermal amplification according to claim 2, characterized in that: The 5' end of the DNAzyme chain was modified on the surface of gold nanoparticles using the salt aging method.

4. The miRNA imaging analysis method based on strand displacement-mediated isothermal amplification according to claim 1, characterized in that: The number of hybridized bases between the blocking strand and the DNAzyme strand is greater than the number of hybridized bases between the DNAzyme strand and the substrate strand.

5. The miRNA imaging analysis method based on strand displacement-mediated isothermal amplification according to claim 1, characterized in that: The fluorescence quenching groups are BHQ-1 and FAM.

6. The miRNA imaging analysis method based on strand displacement-mediated isothermal amplification according to claim 1, characterized in that: Gold nanoparticles can deliver the reaction system into cells for imaging analysis of intracellular miRNA.

Images