Sterile animal detection method

Abstract

The sterile animal detection method consists of a PCR (Polymerase Chain Reaction) method and a culture method, and the detection is qualified through the PCR method and the culture detection. According to the method, the existence of bacteria and fungus contaminated samples can be comprehensively detected at the gene level through 16s and ITS PCR methods, the culture method includes the category of multiple types of microorganisms of anaerobic aerobic bacteria and fungi, the combination of the culture method and the culture method is more beneficial to detection of microorganisms which are difficult to cover by a conventional method, and the reliability and the safety of sterile animals are improved.

Description

Technical Field

[0001] The invention relates to the biological field, and in particular to a method for detecting sterile animals. Background Art

[0002] Germ-free animals provide an ideal model for studying the pure interaction between microorganisms and hosts. Through the study of germ-free animals, we can clearly understand the specific contributions of microorganisms to host growth, development and metabolism under normal physiological conditions. In the study of intestinal microorganisms, it is known that intestinal flora can help the host digest food. In the germ-free animal model, researchers have found that compared with normal animals, germ-free animals have a significantly reduced ability to digest certain complex carbohydrates. This shows that intestinal microorganisms play a key role in the carbohydrate metabolism process, and the functions of microorganisms can be accurately determined by comparing the presence or absence of microorganisms. Only by ensuring that there is no metabolic interference from microorganisms in germ-free animals can we more accurately and effectively carry out research on the immune system, drug metabolism system, etc. of germ-free animals. Therefore, a detection method for germ-free animals is needed to achieve this. Summary of the invention

[0003] The purpose of the present invention is to provide a method for detecting sterile animals.

[0004] The present invention achieves the above-mentioned purpose through the following technical scheme: a method for detecting sterile animals, which consists of a PCR method and a culture method, and the detection is qualified if both the PCR method and the culture method are detected;

[0005] The PCR method includes the following steps:

[0006] 1) Sample pretreatment: Add an appropriate amount of physiological saline to the sample (the liquid level should be 5 mL above the sample), place it on a vortex shaker and shake until there are no obvious particles, and centrifuge it at 3500 rpm for 5 minutes for later use;

[0007] 2) Nucleic acid extraction;

[0008] 3) 16s and ITS PCR amplification: The DNA solutions extracted from all samples to be tested were subjected to 16s bacterial and ITS eukaryotic PCR amplification, and the primer sequences are as follows:

[0009] Primer Information:

[0010] 16S-F:AGAGTTTGATCMTGGCTCAG

[0011] 16S-R:TACGGYTACCTTGTTACGACTT

[0012] ITS1:TCCGTAGGTGAACCTGCGG

[0013] ITS4:TCCTCCGCTTATTGATATGC

[0014] 4) Gel electrophoresis: The obtained PCR product is subjected to gel electrophoresis and observed in a gel imager to see if there are band images. If no bands appear, it indicates that the PCR sterility test is qualified. If there are bands, re-testing is required.

[0015] Furthermore, the culture method comprises the following steps:

[0016] 1) Sample pretreatment: Add an appropriate amount of physiological saline to the sample (the liquid level should be 5 mL above the sample), place it on a vortex shaker and shake until there are no obvious particles, and centrifuge it at 3500 rpm for 5 minutes for later use;

[0017] 2) Reagent packaging: prepare several 15*150mm borosilicate test tubes, sterilize them by high pressure in advance and dry them for later use; prepare thioglycollate fluid culture medium, brain heart infusion broth culture medium, tryptic soy peptone liquid culture medium and nutrient agar respectively, sterilize them by high pressure at 121℃, 1.01Kpa, 15min, and then dispense the thioglycollate fluid culture medium, brain heart infusion broth culture medium and tryptic soy peptone liquid culture medium into sterile test tubes, and pour the nutrient agar into a disposable sterile plate to cool and solidify for later use;

[0018] 3) Sample culture: 500 μL of each sample was inoculated into thioglycollate fluid culture medium, brain heart infusion broth culture medium, and tryptic soy bean liquid culture medium and marked; 10 μL of each sample was spread and inoculated on a nutrient agar plate, all of which were carried out in a sterile operating table; each sample was cultured in a 25°C or 37°C microbial incubator after inoculation;

[0019] 4) Observation of results: The culture cycle is 14 days. Observe whether there is turbidity in the test tube and whether there are colonies on the nutrient agar plate. If there is none, it means that the culture method test is qualified. Otherwise, it is reported as unqualified.

[0020] Compared with the prior art, the beneficial effects of the sterile animal detection method of the present invention are: the 16s and ITS PCR methods can comprehensively detect the presence of bacterial and fungal contaminated samples at the genetic level, and the culture method covers the scope of multiple types of microorganisms such as anaerobic aerobic bacteria and fungi. The combination of the two is more conducive to detecting microorganisms that are difficult to cover by conventional methods, thereby improving the reliability and safety of sterile animals. DETAILED DESCRIPTION

[0021] A sterile animal detection method, which consists of a PCR method and a culture method. The detection is qualified if both the PCR method and the culture method are passed.

[0022] The PCR method includes the following steps:

[0023] 1) Sample pretreatment: Add an appropriate amount of physiological saline to the sample (the liquid level should be 5 mL above the sample), place it on a vortex shaker and shake until there are no obvious particles, and centrifuge it at 3500 rpm for 5 minutes for later use.

[0024] 2) Nucleic acid extraction: Take 180μL of supernatant from the above centrifuged sample and put it into a clean 1.5mL EP tube, add 20μL lysozyme solution, vortex for about 15 seconds to mix, and place in a 37℃ water bath for 30 minutes. Add 20μL of proteinase K storage solution and 200μL SL buffer to the tube, lyse the bacterial cells, enzymatically hydrolyze the histones bound to nucleic acids, and make the DNA free in the solution, then add 200μL of anhydrous ethanol to precipitate the DNA. Add the resulting mixture to the nucleic acid purification column, centrifuge to remove the solvent, add 10mM Tris-Hcl (pH7.5) to wash the excess salt ions, centrifuge to remove the solvent, and add 10μL TE buffer to obtain a DNA solution.

[0025] 3) 16s and ITS PCR amplification: The DNA solutions extracted from all samples to be tested were subjected to 16s bacterial and ITS eukaryotic PCR amplification, and the primer sequences are as follows:

[0026] Primer Information:

[0027] 16S-F:AGAGTTTGATCMTGGCTCAG

[0028] 16S-R:TACGGYTACCTTGTTACGACTT

[0029] ITS1:TCCGTAGGTGAACCTGCGG

[0030] ITS4:TCCTCCGCTTATTGATATGC

[0031] 4) Gel electrophoresis: The obtained PCR product is subjected to gel electrophoresis and observed in a gel imager to see if there are bands. If there are no bands, it means that the PCR sterility test is qualified. If there are bands, re-testing is required.

[0032] The culture method includes the following steps:

[0033] 1) Sample pretreatment: Add an appropriate amount of physiological saline to the sample (the liquid level should be 5 mL above the sample), place it on a vortex shaker and shake until there are no obvious particles, and centrifuge it at 3500 rpm for 5 minutes for later use.

[0034] 2) Reagent packaging: Prepare several 15*150mm borosilicate test tubes, sterilize them by high pressure in advance and dry them for later use. Prepare thioglycollate fluid culture medium, brain heart infusion broth culture medium, tryptic soy peptone liquid culture medium and nutrient agar respectively, sterilize them by high pressure at 121℃, 1.01Kpa, 15min, and dispense thioglycollate fluid culture medium, brain heart infusion broth culture medium and tryptic soy peptone liquid culture medium into sterile test tubes, and pour nutrient agar into disposable sterile plates to cool and solidify for later use.

[0035] 3) Sample culture: Take 500 μL of each sample and inoculate it into thioglycollate fluid culture medium, brain heart infusion broth culture medium, and trypticase soytone liquid culture medium and mark it. Take 10 μL of each sample and spread it on the nutrient agar plate. All the above are carried out in a sterile operating table. After inoculation, each sample is cultured in a 25℃ and 37℃ microbial incubator respectively;

[0036] 4) Observation of results: The culture cycle is 14 days. Observe whether there is turbidity in the test tube and whether there are colonies on the nutrient agar plate. If there is none, it means that the culture method test is qualified. Otherwise, it is reported as unqualified.

[0037] The present invention can comprehensively detect the presence of bacterial and fungal contaminated samples at the gene level through the 16s and ITS PCR methods, and the culture method covers the scope of multiple types of microorganisms such as anaerobic aerobic bacteria and fungi. The combination of the two is more conducive to detecting microorganisms that are difficult to cover by conventional methods, thereby improving the reliability and safety of sterile animals.

[0038] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It is obvious to those skilled in the art that the present invention is not limited to the details of the above exemplary embodiments, and the present invention can be implemented in other specific forms without departing from the spirit or basic features of the present invention. Therefore, no matter from which point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes that fall within the meaning and scope of the equivalent elements of the claims are included in the present invention.

[0039] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A method for detecting sterile animals, characterized in that: It consists of PCR method and culture method. If both PCR method and culture test are passed, the test is qualified. The PCR method includes the following steps: 1) Sample pretreatment: Add an appropriate amount of physiological saline to the sample (the liquid level should be 5 mL above the sample), place it on a vortex shaker and shake until there are no obvious particles, and centrifuge it at 3500 rpm for 5 minutes for later use; 2) Nucleic acid extraction; 3) 16s and ITS PCR amplification: The DNA solutions extracted from all samples to be tested were subjected to 16s bacterial and ITS eukaryotic PCR amplification, and the primer sequences are as follows: Primer Information: 16S-F:AGAGTTTGATCMTGGCTCAG 16S-R:TACGGYTACCTTGTTACGACTT ITS1:TCCGTAGGTGAACCTGCGG ITS4:TCCTCCGCTTATTGATATGC 4) Gel electrophoresis: The obtained PCR product is subjected to gel electrophoresis and observed in a gel imager to see if there are band images. If no bands appear, it indicates that the PCR sterility test is qualified. If there are bands, re-testing is required.

2. The method for detecting sterile animals according to claim 1, characterized in that: The culture method comprises the following steps: 1) Sample pretreatment: Add an appropriate amount of physiological saline to the sample (the liquid level should be 5 mL above the sample), place it on a vortex shaker and shake until there are no obvious particles, and centrifuge it at 3500 rpm for 5 minutes for later use; 2) Reagent packaging: prepare several 15*150mm borosilicate test tubes, sterilize them by high pressure in advance and dry them for later use; prepare thioglycollate fluid culture medium, brain heart infusion broth culture medium, tryptic soy peptone liquid culture medium and nutrient agar respectively, sterilize them by high pressure at 121℃, 1.01Kpa, 15min, and then dispense the thioglycollate fluid culture medium, brain heart infusion broth culture medium and tryptic soy peptone liquid culture medium into sterile test tubes, and pour the nutrient agar into a disposable sterile plate to cool and solidify for later use; 3) Sample culture: 500 μL of each sample was inoculated into thioglycollate fluid culture medium, brain heart infusion broth culture medium, and tryptic soy bean liquid culture medium and marked; 10 μL of each sample was spread and inoculated on a nutrient agar plate, all of which were carried out in a sterile operating table; each sample was cultured in a 25°C or 37°C microbial incubator after inoculation; 4) Observation of results: The culture cycle is 14 days. Observe whether there is turbidity in the test tube and whether there are colonies on the nutrient agar plate. If there is none, it means that the culture method test is qualified. Otherwise, it is reported as unqualified.