Kit for early detection of lung cancer and probe and primer combination thereof

Abstract

The invention provides a kit for early detection of lung cancer. The kit is used for simultaneously detecting methylation of an OPLAH gene and a HOXA7 gene. According to the combination of OPLAH and HOXA7 disclosed by the invention, the sensitivity is greatly improved compared with that of single gene detection, the specificity is not greatly influenced, and the Youden index is also improved; the technical problems that in the prior art, the sensitivity of single-gene tumor detection is limited, and although the sensitivity can be improved by increasing the number of detected genes, the overall specificity can be reduced are solved.

Description

Technical Field

[0001] The present invention relates to the field of biological detection, and in particular to a kit for early detection of lung cancer and a probe and primer combination thereof. Background Art

[0002] DNA methylation is one of the earliest gene modification methods discovered by humans and exists in almost all higher organisms. DNA methylation can inhibit or even silence the expression of certain genes, while demethylation can restore gene expression. In eukaryotic cells other than plants, DNA methylation usually occurs on cytosine (C) in CpG dinucleotide sequences, forming 5-methylcytosine (5-mC). Although the frequency of CpG dinucleotide sequences in the genome of mammals is much lower than that of other dinucleotide sequences, the frequency of CpG dinucleotide sequences in the promoter region of genes is very high, even reaching more than 5 times the average, forming the so-called CpG island. In healthy people, cytosine in CpG islands is usually in an unmethylated state, while cytosine outside CpG islands is usually methylated, and this methylated state can be stably retained during cell division. Changes in methylation status are an important factor in causing tumors. This change includes a decrease in the overall methylation level of the genome and an abnormal increase in the local methylation level of the CpG island of tumor suppressor genes, which in turn causes the expression of proto-oncogenes and the inactivation of tumor suppressor genes. Since DNA methylation is an early event in the development of tumors, and local methylation of CpG islands precedes the malignant proliferation of cancer cells, DNA methylation detection has important clinical significance for the early screening and diagnosis of tumors. According to current research data, different tumors have different methylated genes, that is, specific tumors will specifically methylate one or some genes. For example, according to the "Expert Consensus on Early Colorectal Cancer Screening Process in China" and "Expert Consensus on Lung Cancer Screening and Management in China" newly released in 2019, it is recommended that Septin 9 gene and SHOX2 methylation detection can be used for early screening of colorectal cancer patients and lung cancer patients, respectively.

[0003] Lung cancer is a malignant tumor with high morbidity and mortality in China and even in the world, which seriously threatens human life, health and safety. However, in China, the five-year survival rates of patients with stage I, stage II, stage III and stage IV lung cancer are 84%, 50%, 22% and 5% respectively, that is, the earlier the discovery, the higher the survival rate of the patient. In recent years, the development of sequencing technology has provided more ideas for the field of molecular diagnosis, and molecular markers for early diagnosis of lung cancer have emerged in an endless stream, such as gene expression, structural variation, DNA methylation, blood free DNA fragmentation characteristics, terminal structure, transcription factor binding site analysis, etc. Among them, gene methylation detects the epigenetic modification of specific genes in clinical samples to obtain earlier and more stable test results. This method can be flexibly applied to tissue samples, blood, urine and other samples that can be used for liquid biopsy. Therefore, how to develop sensitive and specific biological markers and detection technologies has great clinical value for early screening, diagnosis and prognosis monitoring of lung cancer.

[0004] At present, the commonly used methods for early detection of lung cancer in clinical practice are mainly focused on imaging tests, sputum, and bronchoalveolar lavage fluid tests. The detection sensitivity is limited and it cannot detect lesions in the early stage. After different degrees of clinical intervention, it cannot significantly reduce the mortality rate. Low-dose spiral computed tomography technology has higher sensitivity and can identify early lesions, but the low specificity of the detection method will lead to false positive diagnosis, increase the psychological pressure of the subjects, and cause excessive consumption of medical resources in the later stage.

[0005] In recent years, the method of detecting DNA methylation has been applied to the early detection of tumors, and methylation detection first requires the extraction of free DNA in human plasma. Plasma free DNA (cfDNA) is a degradation product released by solid tumor cells into the blood. Abnormally methylated DNA of the same gene accounts for only a very small part of the total DNA in peripheral blood, about 0.01% to 0.1%. These unmethylated DNAs differ slightly from methylated DNA in the methylation modification on cytosine, so it is necessary to detect abnormal methylated DNA from a highly complex "background". In addition, the DNA in circulating blood is usually degraded (generally tens to hundreds of base pairs) 168 nucleotide fragments, and the half-life of plasma free tumor DNA (ctDNA) is only 2.5h, so timely extraction and good extraction technology are required to obtain a high recovery rate.

[0006] As of May 2022, three companies worldwide have developed lung cancer methylation detection products that have obtained Class III medical device registration certificates, namely the "Human Plasma SHOX2 / PTGER4 Dual Gene Methylation Detection Kit - Epi prolung" developed by German Epigenomics AG in 2015, the "Human Bronchoalveolar Lavage Fluid SHOX2 / RASSF1A Dual Gene Methylation Detection Kit - " developed by Shanghai Toujing Life Science in 2018, and the "Human Plasma SHOX2 / PTGER4 / RASSF1A Triple Gene Methylation Detection Kit - Ai Feiming" developed by Beijing Aikelun Biotechnology in 2022. However, the methylation regions of the above-mentioned genes have low sensitivity and specificity for the detection of early lung cancer patients, which limits the clinical application of methylation detection of lung cancer-related genes. Summary of the invention

[0007] In order to solve the above problems, the present invention provides a kit for early detection of lung cancer, which comprises a kit for simultaneously detecting methylation of OPLAH gene and HOXA7 gene.

[0008] In one embodiment, the kit includes: a probe for detecting methylation of the OPLAH gene SEQ ID No.4: ACAACCAACGACCGACCGA, a forward primer for detecting methylation of the OPLAH gene SEQ ID No.5: GTAGTTCGTAGTTTTGTAGAG, a reverse primer for detecting methylation of the OPLAH gene SEQ ID No.6: CGACGAACAAACGC; and a probe for detecting methylation of the HOXA7 gene SEQ ID No.13: CCCAAACCGTAACCGAACGC, a forward primer for detecting methylation of the HOXA7 gene SEQ ID No.14: TTCGGGTTTATATAATGTTAATAG, and a reverse primer for detecting methylation of the HOXA7 gene SEQ ID No.15: AACGCAAAACAAATTACC.

[0009] In one embodiment, the kit further comprises: a probe for detecting the internal reference gene ACTB, SEQ ID No.37: ACCACCACCCAACACACAATAACAAACACA, a forward primer for detecting the internal reference gene ACTB, SEQ ID No.38: AGGAGGTAGGGAGTATATAGG, and a reverse primer for detecting the internal reference gene ACTB, SEQ ID No.39: CAACCAATAAAACCTACTCCTC.

[0010] In one embodiment, the kit further comprises a reagent for extracting plasma free DNA, and the reagent is used to extract plasma free DNA by cooperating with an adsorption column and a vacuum pump.

[0011] In one embodiment, the kit further comprises a methylation conversion reagent.

[0012] In one embodiment, a probe and primer combination is provided, the combination comprising a probe for detecting methylation of the OPLAH gene SEQ ID No.4: ACAACCAACGACCGACCGA, a forward primer for detecting methylation of the OPLAH gene SEQ ID No.5: GTAGTTCGTAGTTTTGTAGAG, a reverse primer for detecting methylation of the OPLAH gene SEQ ID No.6: CGACGAACAAACGC; and a probe for detecting methylation of the HOXA7 gene SEQ ID No.13: CCCAAACCGTAACCGAACGC, a forward primer for detecting methylation of the HOXA7 gene SEQ ID No.14: TTCGGGTTTATATAATGTTAATAG, and a reverse primer for detecting methylation of the HOXA7 gene SEQ ID No.15: AACGCAAAACAAATTACC.

[0013] In one embodiment, the combination further includes a probe for detecting the internal reference gene ACTB, SEQ ID No.37: ACCACCACCCAACACACAATAACAAACACA, a forward primer for detecting the internal reference gene ACTB, SEQ ID No.38: AGGAGGTAGGGAGTATATAGG, and a reverse primer for detecting the internal reference gene ACTB, SEQ ID No.39: CAACCAATAAAACCTACTCCTC.

[0014] The combination of OPLAH and HOXA7 of the present invention has greatly improved sensitivity compared to single gene detection, and the specificity is not greatly affected, and the Youden index is also improved; it overcomes the technical problem that the sensitivity of single gene detection of tumors in the prior art is often limited, and although increasing the number of detected genes can improve the sensitivity, it will also reduce the overall specificity. The Youden index is a method for evaluating the authenticity of a screening test, indicating the total ability of the screening method to find real patients and non-patients; the larger the index, the better the effect of the screening experiment and the greater the authenticity. The present invention screens out a highly sensitive probe primer combination of OPLAH and HOXA7 methylation, which has good sensitivity and specificity.

[0015] The present invention develops a method through vacuum filtration, which can complete column extraction within 10 minutes, reduce the degradation of plasma free DNA (ctDNA) during the extraction process; improve the extraction efficiency of plasma free DNA, and elute the DNA in a smaller system to ensure that the final recovered DNA concentration is higher, and improve the final detection sensitivity of lung cancer by increasing the sample DNA concentration. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0017] Figure 1 It is a graph showing the PCR amplification results of four different sets of primers and probes for detecting OPLAH gene methylation according to the present invention;

[0018] Figure 2 It is a graph showing the PCR amplification results of four different sets of primers and probes for detecting HOXA7 gene methylation in the present invention;

[0019] Figure 3 It is a graph showing the PCR amplification results of four different sets of primers and probes for detecting HOXA9 gene methylation in the present invention. DETAILED DESCRIPTION

[0020] In order to enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below in conjunction with embodiments. Obviously, the described embodiments are only part of the embodiments of this application, rather than all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of this application.

[0021] Example 1 Extraction of plasma free DNA

[0022] 1. Plasma separation

[0023] 1. Transfer the whole blood to a 15 mL centrifuge tube and centrifuge at 2000 g for 10 minutes.

[0024] 2. Take the plasma, transfer it to a 15mL centrifuge tube, centrifuge it at 16000g at 4 degrees for 10 minutes, discard the sediment, and take the supernatant to a new 15mL centrifuge tube.

[0025] (II) Plasma extraction

[0026] 1. Take 3.5 ml of plasma and 3.6 ml of lysis buffer, vortex and mix, incubate at room temperature for 10 minutes. Add 2.5 ml of ethanol and vortex and mix.

[0027] 2. Place the adsorption column on the QIAvac vacuum manifold, add 800μ of the lysed sample, start the vacuum pump (aspirator), and transfer the remaining sample to the adsorption column in batches until all the sample has passed through the column.

[0028] 3. Pipette 600 μl of washing solution A (washing solution A: 2M isoguanidine bisulfate, 100 mM Tric-Hcl, 50% ethanol, pH 7.0) into the adsorption column until all washing solution A passes through the column.

[0029] 4. Pipette 1.2 ml of washing solution B (washing solution B: 85% ethanol) into the adsorption column. Washing solution B needs to be added to the adsorption column twice. After washing solution B has completely passed through the column, remove the adsorption column and place it in a collection tube.

[0030] 5. Centrifuge at 13000 rcf for 2 min and remove excess washing solution B.

[0031] 6. Transfer the adsorption column to a 1.5 ml centrifuge tube, add 30 μl of nuclease-free water, and let stand for 5 minutes.

[0032] 7. Centrifuge at 13000 rcf for 1 min and collect the eluate.

[0033] 8. The samples are temporarily stored at 4°C and the methylation conversion must be completed on the same day.

[0034] Example Dimethylation Conversion

[0035] 1. Add 20 μl urine DNA sample and 130 μl conversion solution to PCR 8 tube;

[0036] 2. Place on the PCR instrument and follow the following procedure: 98 degrees for 10 minutes, 64 degrees for 150 minutes, and 4 degrees for less than 20 hours;

[0037] 3. Add 600 μl of binding buffer B to the centrifuge column, transfer the transformed sample to the centrifuge column, mix by inverting six times, and centrifuge at 13,000 rcf for 1 minute;

[0038] 4. Add 100 μl of washing solution C and pass through the centrifugal column at 13000 rcf;

[0039] 5. Add 200 μl of freshly prepared desulfurization solution and let it stand at room temperature for 15 minutes;

[0040] 6. Centrifuge at 13000rcf to remove the desulfurization liquid.

[0041] 7. Add 200 μl of washing solution C and pass through the centrifugal column at 13000 rcf.

[0042] 8. Repeat step 7 once.

[0043] 9. Add 10 μl of nuclease-free water, pass through the centrifugal column at 13,000 rcf, and collect the eluate.

[0044] Store at 10.4 degrees for short term and at -20 degrees for less than 2 weeks.

[0045] Preparation of 50mL conversion solution: Use an electronic balance to weigh 0.6g NaOH, 6.94g NaHSO3, 2.43g (NH4)2SO3.H2O, 0.88g vitamin C, 2.75g p-diphenol in a 50ml beaker, add about 30ml water, stir at room temperature to dissolve for 10 minutes, wait until the insoluble matter is reduced, measure 16.7ml 50% NH4HSO3, continue stirring at room temperature for about 20 minutes, and adjust the volume to 50ml. Transfer to a brown bottle and keep away from light.

[0046] Preparation of 100mL system binding liquid B: Use an electronic balance to weigh 45.8g of guanidine isothioate, 1.13g of Na2HPO4.12H2O, and 12.65g of NaH2PO4.12H2O in sequence, add water to about 95ml, stir at 50 degrees for 1 hour to dissolve, and make up to 100mL.

[0047] Preparation of 2mL desulfurization solution: Take 200μL of 1M NaOH, add 1800μL of nuclease-free water, mix well. Prepare and use immediately.

[0048] Preparation of washing solution C for 100 mL system: Measure 85 mL of anhydrous ethanol and add 15 mL of nuclease-free water.

[0049] Example 3 Comparison of plasma free DNA extraction by the method of the present invention and Thermo Fisher plasma extraction kit A29319

[0050] 1. Sample extraction

[0051] 20 mL of normal human plasma sample was collected and 150 BP small fragment DNA was added to simulate small fragment free DNA in plasma.

[0052] 1. Take 3.5 ml of plasma and 3.6 ml of lysis buffer, vortex and mix, incubate at room temperature for 10 minutes. Add 2.5 ml of ethanol and vortex and mix.

[0053] 2. Place the adsorption column on the QIAvac vacuum manifold, add 800μ of the lysed sample, start the vacuum pump (aspirator), and transfer the remaining sample to the adsorption column in batches until all the sample has passed through the column.

[0054] 3. Pipette 600 μl of washing solution A into the adsorption column until all washing solution A passes through the column.

[0055] 4. Pipette 1.2 ml of washing solution B into the adsorption column. Washing solution B needs to be added to the adsorption column twice. After washing solution B has completely passed through the column, remove the adsorption column and place it in a collection tube.

[0056] 5. Centrifuge at 13000 rcf for 2 min and remove excess washing solution B.

[0057] 6. Transfer the adsorption column to a 1.5 ml centrifuge tube, add 30 μl of nuclease-free water, and let stand for 5 minutes.

[0058] 7. Centrifuge at 13000 rcf for 1 min and collect the eluate.

[0059] 8. The samples were temporarily stored at 4 degrees and prepared for PCR detection of the recovery rate of 150 BP.

[0060] The Thermo Fisher plasma extraction kit was operated according to the instructions of A29319, and the elution volume was also 30 μl.

[0061] 2. PCR detection

[0062] The reaction system is as follows:

[0063] Probe primer concentration 10 μM Total Add 0.5 μl of probe 0.5μl Add 1 μl of each primer 2μl PCRMIX 12.5 μl 12.5μl Water 6μl 6μl Template 4μl 4μl

[0064] PCR reaction conditions:

[0065]

[0066] The extraction method of the present invention carried out two groups of extraction six parallel test results, S-150BP is the test result of the extraction by the Thermo Fisher kit; the average Ct value of the six parallel test results extracted by the extraction method of the present invention in one group is 19.51, and the Ct value extracted by the corresponding Thermo Fisher kit is 20.58, and the Ct value difference is 1.07; the Ct value of the six parallel test results extracted by the extraction method of the present invention in another group, the Ct value of the present invention is 19.48, and the Ct value extracted by the corresponding Thermo Fisher kit is 20.52, and the Ct value difference is 1.04. Therefore, the recovery rate of free 150BP DNA extracted by the method of the present invention is about twice that of the Thermo Fisher kit, and the peak value of plasma free DNA is between 140-170BP, indicating that the method of the present invention has a higher recovery rate for plasma free DNA.

[0067] Example 4 Methylation sequencing of potential gene chips for lung cancer hypermethylation

[0068] 60 lung cancer tissue samples and 60 paracancerous tissue samples were collected. Tissue samples were extracted using DNeasy Blood & Tissue Kit No. 69504. Methylation conversion was performed according to the method of Application Example 2. After conversion, Shanghai Jingneng Biotechnology used 935K chip for methylation sequencing. Lung cancer tissue was set as Group A and paracancerous tissue was set as Group C. The following results were obtained:

[0069] probe number GroupA_AVG Group C_AVG deltaBeta P value _RefGene_G UCSC_RefGene_Name 1 0.598623952 0.370362602 0.12842156 9.83E-05 TSS1500 HOXA9 2 0.377237193 0.673965719 -0.121415072 7.60E-05 S1500;TSS1 5PARP15;PARP15 3 0.360497913 0.174453073 0.244345801 5.17E-06 TSS200 HOXA9 4 0.507622392 0.547010249 0.103507142 5.13E-05 TSS1500 HOXA9 5 0.511663639 0.264341545 0.247322094 4.83E-06 TSS200 OPLAH 6 0.549782092 0.472377598 0.139068147 4.36E-06 1;exon_1;T SHOXA7 7 0.533520196 0.20203472 0.30427242 2.03E-05 SS200;TSS2 0OPLAH 8 0.505924899 0.172019448 0.296574081 1.60E-05 SS200;TSS2 0HOXA7 9 0.665711591 0.306834276 0.234893703 1.37E-05 SS200;TSS2 0HOXA9 10 0.541727979 0.442310899 0.161467904 1.19E-05 1;exon_1;T SHOXA7 11 0.927862043 0.927850401 1.16E-05 0.998005052 exon_4 SKI 12 0.05226443 0.052556105 -0.000291676 0.96794094 TSS200 EMX1 13 0.449677474 0.447249311 0.002428163 0.960996345 1;exon_1;e SHOX2; SHOX2; SHOX2 14 0.388329825 0.391597486 -0.003267661 0.957202498 exon_1;5UT RSHOX2; SHOX2 15 0.050840189 0.051166743 -0.000326554 0.956902213 TSS1500 OPLAH 16 0.197974048 0.194209943 0.003764105 0.956895117 exon_2 EMX1 17 0.817177926 0.819592309 -0.002414383 0.955021319 n_3; exon_3 HOXA7;HOXA7;;HOXA3;HOXA3 18 0.698706399 0.696482465 0.002223934 0.95408387 xon_3;exon _HOXA10-HOXA9;HOXA9 19 0.480936555 0.478956748 0.001979808 0.95383506 TSS1500 FOXI2 20 0.689951586 0.689261842 0.000689744 0.943169198 exon_14 OPLAH

[0070] Result analysis: Sort the Pvalues ​​and find multiple probes with the highest Pvalues ​​(e.g., 20). Exclude probes with negative deltaBeta values. If the top-ranked gene appears in different probes or appears multiple times, it indicates that the gene has a high methylation site for lung cancer and can be considered as a candidate target for lung cancer for subsequent verification.

[0071] In this sequencing result, OPLAH, HOXA7 and HOXA9 genes appeared many times, and their P values ​​were very high, indicating that OPLAH, HOXA7 and HOXA9 genes are highly correlated genes among target genes related to abnormal methylation of lung tumors.

[0072] Example 5 Screening of combinations of lung cancer target genes OPLAH, HOXA7 and HOXA9 and screening of probe primers

[0073] Tissue samples from lung cancer patients were collected, and the tissue samples were extracted using the DNeasy Blood & Tissue Kit (Cat. No. 69504). Methylation conversion was performed according to the method of Application Example 2, and the converted samples were used for probe primer screening.

[0074] (I) Screening of probe primers for detecting methylation of OPLAH, HOXA7 and HOXA9 genes

[0075] 1. Screening of probe primers for OPLAH gene methylation

[0076] Table 1

[0077]

[0078]

[0079] 2. Screening of probe primers for HOXA7 gene methylation

[0080] Table 2

[0081]

[0082] 3. Screening of probe primers for HOXA9 gene methylation

[0083] Table 3

[0084]

[0085]

[0086] 4. PCR reaction system and conditions are shown in Table 4:

[0087] Table 4

[0088] Probe primer concentration 10 μM Total Add 0.5 μl of probe 0.5μl Add 1 μl of each primer 2μl PCRMIX 12.5 μl 12.5μl Water 6μl 6μl Template 4μl 4μl

[0089] PCR reaction conditions:

[0090]

[0091] 5. Filter results

[0092] like Figure 1 As shown, in the OPLAH gene, the combined two amplification curves have the best comprehensive evaluation and are used as the preferred combination for OPLAH gene methylation detection.

[0093] like Figure 2 As shown, in the HOXA7 gene, the combination of amplification curve comprehensive evaluation is the best and is the preferred combination for HOXA7 gene methylation detection.

[0094] like Figure 3 As shown, in the HOXA9 gene, the combination of two amplification curves has the best comprehensive evaluation and is the preferred combination for HOXA9 gene methylation detection.

[0095] (II) Combined screening for detecting methylation of OPLAH, HOXA7 and HOXA9 genes

[0096] Lung cancer patient tissue samples, paracancerous tissue samples, and normal human nodule tissue samples were collected from a hospital in Shanghai. Tissue samples were extracted using the DNeasy Blood & Tissue Kit, catalog number: 69504, and methylation conversion was performed according to the method of Application Example 2. Methylation detection was performed using the converted samples.

[0097] OPLAH gene probe primer, HOXA7 gene probe primer and ACTB internal reference probe primer were reacted in the same tube, the probe for detecting ACTB gene was SEQ ID No.37: ACCACCACCCAACACACAATAACAAACACA, the forward primer for detecting ACTB gene was SEQ ID No.38: AGGAGGTAGGGAGTATATAGG, and the forward primer for detecting ACTB gene was SEQ ID No.39: CAACCAATAAAACCTACTCCTC; the PCR MIX used was Zhuhai Baorui M209, and the reaction system was as shown in Table 5.

[0098] Table 5

[0099]

[0100]

[0101] PCR reaction conditions:

[0102]

[0103] CT value of OPLAH - CT value of ACTB = ΔCT1 CT value of HOXA7 - CT value of ACTB = ΔCT2 CT value of HOXA9 - CT value of ACTB = ΔCT3 The test results are analyzed in Table 6 below.

[0104] Table 6

[0105]

[0106]

[0107] Result judgment criteria:

[0108] When ΔCT1 is less than 5, the result is positive; when ΔCT1 is greater than or equal to 5, the result is negative.

[0109] When ΔCT2 is less than 12, the result is positive; when ΔCT2 is greater than or equal to 12, the result is negative.

[0110] When ΔCT3 is less than 8, the result is positive; when ΔCT3 is greater than or equal to 8, the result is negative.

[0111] In clinical practice, lung cancer tissue is considered a positive sample, while adjacent cancerous and nodule tissues are considered negative samples.

[0112] The results of each gene detection are shown in Table 7.

[0113] Table 7

[0114]

[0115] The performance indicators of single-gene detection are poor, and multi-gene combination is used to improve sensitivity, as shown in Table 8.

[0116] Table 8

[0117]

[0118] The sensitivity of single-gene detection of tumors is often limited. Although increasing the number of detected genes can improve the sensitivity, it will also reduce the overall specificity. The key to the current combination of multi-gene detection is how to find a suitable combination that can increase the detection sensitivity while not greatly affecting the overall specificity. Such a combination will have a significant improvement in the Youden Index. In the present invention, the combination of OPLAH and HOXA7 has greatly improved sensitivity compared to single-gene detection, while the specificity is not greatly affected, and the Youden Index is also improved.

[0119] It should be understood that the disclosed invention is not limited only to the specific method, scheme and material of description, because these all can change.It should also be understood that the terminology used herein is only for the purpose of describing specific embodiment scheme, rather than being intended to limit the scope of the present invention, and the scope of the present invention is only limited to the appended claims.

[0120] Those skilled in the art will also recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are also intended to be encompassed by the appended claims.

Claims

1. A kit for early detection of lung cancer, characterized in that: The kit is a kit for simultaneously detecting the methylation of OPLAH gene and HOXA7 gene.

2. The kit according to claim 1, characterized in that The kit comprises: a probe for detecting methylation of the OPLAH gene SEQ ID No.4: ACAACCAACGACCGACCGA, a forward primer for detecting methylation of the OPLAH gene SEQ ID No.5: GTAGTTCGTAGTTTTGTAGAG, a reverse primer for detecting methylation of the OPLAH gene SEQ ID No.6: CGACGAACAAACGC; and a probe for detecting methylation of the HOXA7 gene SEQ ID No.13: CCCAAACCGTAACCGAACGC, a forward primer for detecting methylation of the HOXA7 gene SEQ ID No.14: TTCGGGTTTATATAATGTTAATAG, and a reverse primer for detecting methylation of the HOXA7 gene SEQ ID No.15: AACGCAAAACAAATTACC.

3. The kit according to claim 2, characterized in that The kit also includes: a probe for detecting the internal reference gene ACTB, SEQ ID No.37: ACCACCACCCAACACACAATAACAAACACA, a forward primer for detecting the internal reference gene ACTB, SEQ ID No.38: AGGAGGTAGGGAGTATATAGG, and a reverse primer for detecting the internal reference gene ACTB, SEQ ID No.39: CAACCAATAAAACCTACTCCTC.

4. The kit according to claim 1, characterized in that The kit also includes a plasma free DNA extraction reagent, and the extraction reagent is used to extract the plasma free DNA through the combination of an adsorption column and a vacuum pump.

5. The kit according to claim 1, characterized in that The kit also includes a methylation conversion reagent.

6. A probe and primer combination, characterized in that: The combination includes a probe for detecting methylation of the OPLAH gene SEQ ID No. 4: ACAACCAACGACCGACCGA, a forward primer for detecting methylation of the OPLAH gene SEQ ID No. 5: GTAGTTCGTAGTTTTGTAGAG, a reverse primer for detecting methylation of the OPLAH gene SEQ ID No. 6: CGACGAACAAACGC; and a probe for detecting methylation of the HOXA7 gene SEQ ID No. 13: CCCAAACCGTAACCGAACGC, a forward primer for detecting methylation of the HOXA7 gene SEQ ID No. 14: TTCGGGTTTATATAATGTTAATAG, and a reverse primer for detecting methylation of the HOXA7 gene SEQ ID No. 15: AACGCAAAACAAATTACC.

7. The probe and primer combination according to claim 6, characterized in that: The combination also includes a probe SEQ ID No.37: ACCACCACCCAACACACAATAACAAACACA for detecting the internal reference gene ACTB, a forward primer SEQ ID No.38: AGGAGGTAGGGAGTATATAGG for detecting the internal reference gene ACTB, and a reverse primer SEQ ID No.39: CAACCAATAAAACCTACTCCTC for detecting the internal reference gene ACTB.

Images