Primer probe composition for pancreatic cancer postoperative MRD detection and dynamic monitoring, kit and application

Abstract

The invention provides a primer probe composition and a kit for post-operation MRD (minimal residual focus) detection and dynamic monitoring of pancreatic ductal adenocarcinoma (PDAC). The primer probe composition disclosed by the invention is used for amplifying a CpG site enrichment region of a gene mir129-2 promoter region. By using the method provided by the invention, the specific CpG site enrichment region can be specifically amplified in a high methylation state, and cannot be amplified in a low or no methylation state. The kit provided by the invention comprises a methylation primer and a probe of the gene mir129-2, and further comprises a primer and a probe of a reference gene ACTB. The kit can be used for detecting the methylation state of the gene mir129-2 starter region, and the methylation state of the gene mir129-2 starter region can be used as a marker for post-operation MRD detection and dynamic monitoring of pancreatic ductal adenocarcinoma (PDAC), and is used for evaluating the recurrence risk of a post-operation patient of the pancreatic ductal adenocarcinoma (PDAC).

Description

Technical Field

[0001] The present invention belongs to the field of gene detection, and more specifically, the present invention relates to a primer-probe combination, a kit and an application thereof for postoperative MRD detection and dynamic monitoring of pancreatic ductal adenocarcinoma (PDAC). Background Art

[0002] Pancreatic cancer (PDAC) is one of the most aggressive malignancies in the world, among which pancreatic ductal adenocarcinoma (PDAC) is the most common and deadly. Surgical resection combined with adjuvant systemic chemotherapy is currently the only chance for long-term survival, but most patients are diagnosed at an advanced stage, which makes them unable to undergo radical surgery, and most patients who undergo resection will relapse locally or at a distant site. Common detection methods for PDAC are imaging tests including contrast-enhanced computed tomography (CT), magnetic resonance imaging (MRI), endoscopic ultrasound (EUS), and CA19-9 detection. However, the challenges of traditional imaging-based PDAC detection include high cost, invasiveness, and poor sensitivity and specificity, which make these methods insufficient for early detection of PDAC and early detection of recurrence. Therefore, more accurate biomarkers and detection methods are urgently needed to better guide the diagnosis and treatment of pancreatic ductal adenocarcinoma (PDAC).

[0003] In recent years, liquid biopsy has received great attention, among which circulating tumor DNA (ctDNA) has been widely used as a valuable clinical biomarker. Compared with tumor tissue, ctDNA in the blood is less affected by intratumor heterogeneity. In addition, ctDNA has a short half-life and can be used as a real-time tumor biomarker to dynamically reflect the state of the tumor at a specific moment. At the same time, ctDNA carries tumor-related genomic information, such as gene expression levels, mutations, and methylation status. Compared with traditional biopsy markers, ctDNA is an ideal biomarker, especially for real-time monitoring of treatment effects and prognosis evaluation. It has recently been found that ctDNA can be used as an effective biomarker for accurately evaluating minimal residual disease (MRD) in solid tumors. Common methods for ctDNA MRD detection include Digital PCR, NGS (next-generation sequencing, NGS) and WGS (Whole genome sequencing), which have the problems of cumbersome processes, difficulty in standardization and high costs. Moreover, it is much more difficult to use ctDNA biomarkers for early detection of recurrence than to use these markers in companion diagnostics. Recently emerging ctDNA methylation markers can indicate the presence of MRD and can also identify patients at high risk of relapse.

[0004] In recent years, abnormal DNA methylation has been considered as a promising non-invasive cancer detection marker. Increasing evidence shows that abnormal DNA methylation promotes tumorigenesis and tumor progression mainly through global hypomethylation, focal hypermethylation of multiple genomic regions (mainly CpG sites), and direct mutagenesis of methylated cytosine. Although some methylation biomarker studies have been conducted for pancreatic ductal adenocarcinoma (PDAC), the exploration of methylation biomarkers in plasma of pancreatic ductal adenocarcinoma (PDAC) is still in its early stages and still requires more in-depth research.

[0005] Therefore, there is still a need to develop a methylation marker detection method for pancreatic ductal adenocarcinoma (PDAC) with acceptable sensitivity and specificity and low cost, which is suitable for rapid detection in large populations. At the same time, research on the regulatory mechanism between specific methylation biomarkers and tumor progression will better guide the design direction. Summary of the invention

[0006] In view of the shortcomings of the prior art, the present invention proposes a primer-probe combination, method and kit for postoperative MRD detection and dynamic monitoring of pancreatic cancer. In the present invention, the methylation of the promoter region of mir129-2 gene is detected for postoperative MRD detection and dynamic monitoring of PDAC. The detection and clinical follow-up analysis confirm that the methylation of the promoter region of mir129-2 can predict the postoperative recurrence of PDAC.

[0007] To achieve the above object, the present invention provides the following technical solutions: A primer-probe combination for postoperative MRD detection and dynamic monitoring of pancreatic cancer, comprising: specific primers for specifically detecting the methylation region of the promoter of the gene mir129-2 and the internal reference gene ACTB; The primer sequence for the specific detection gene mir129-2 promoter methylation region is: Mir129-2-F: GGATGGTGAGATTGAGTC (SEQ ID NO: 1); Mir129-2-R:ATCTCCGAACCCTAAAACCG (SEQ ID NO:2); The specific primer sequence of the internal reference gene ACTB is: ACTB-F:GTAATGTTAGGAGTATTTTGTGGATA (SEQ ID NO:3) ACTB-R: CTAACCCAAAAAAACCCAATCCTA (SEQ ID NO: 4).

[0008] As a further solution of the present invention, the sequence of the fluorescent probe for specifically detecting the methylation region of the promoter of the gene mir129-2 is: Mir129-2-P:CGATGGAACGCGTTGGGGAGATT (SEQ ID NO:5); The 5' end of the probe is labeled with a fluorescent reporter group FAM, and the 3' end is labeled with a fluorescent quencher group BHQ1; The specific probe sequence of the internal reference gene ACTB is: ACTB-P: AGAAGAAGGGAGGGGTGTTAGGAGAGG (SEQ ID NO: 6); The 5' end of the probe is labeled with a fluorescent reporter group CY5, and the 3' end is labeled with a fluorescent quencher group BHQ2.

[0009] The primer-probe combination of the present invention is used for amplifying the CpG site-enriched region of the promoter region of the gene mir129-2.

[0010] The present invention also provides a kit for postoperative MRD detection and dynamic monitoring of pancreatic cancer, comprising the primer-probe combination mentioned in the present invention.

[0011] As a further embodiment of the present invention, a kit for detecting and dynamically monitoring postoperative MRD of pancreatic cancer further comprises the probe mentioned in the present invention, and more preferably, further comprises at least one of a nucleic acid extraction reagent, a nucleic acid conversion reagent PCR MIX, a positive control and a negative control.

[0012] In the present invention, the methylation state of the promoter region of gene mir129-2 can be detected by the kit of the present invention, and the methylation state of the promoter region of gene mir129-2 can be used as a marker for postoperative MRD detection and dynamic monitoring of pancreatic ductal adenocarcinoma (PDAC), and is used for recurrence risk assessment of postoperative patients with pancreatic ductal adenocarcinoma (PDAC). The present invention adopts a multiplex fluorescence quantitative PCR detection method, which has high specificity and sensitivity, good repeatability, simple operation, and better performance than the pancreatic ductal adenocarcinoma (PDAC) tumor marker CA19-9 used clinically; in patients with negative CA19-9, methylation of the promoter region of mir129-2 gene can still effectively predict postoperative recurrence of patients with pancreatic ductal adenocarcinoma (PDAC). The present invention can help clinicians more accurately assess the risk of postoperative recurrence of pancreatic ductal adenocarcinoma (PDAC), improve the treatment effect, avoid unnecessary treatment, and thus reduce medical costs.

[0013] The present invention also provides an application in the preparation of a kit for detecting and dynamically monitoring MRD after pancreatic cancer surgery, comprising the following steps: Step S1: Nucleic acid extraction: extracting DNA from peripheral plasma or tissue; Step S2: Nucleic acid conversion: treating the DNA in step S1 with bisulfite or bisulfite or trap salt and purifying it to obtain a modified sample to be tested; Step S3: target amplification: using the kit for postoperative MRD detection and dynamic monitoring of pancreatic ductal adenocarcinoma (PDAC) of the present invention, multiplex fluorescence quantitative PCR amplification is performed on the modified sample to be tested; Step S4: Result interpretation: Detect FAM and CY5 signal channels simultaneously, and read the number of cycles required to reach the set threshold value Ct value as the judgment standard. If the CT value of the CY5 signal channel of the sample to be tested is less than 31, the sample to be tested is valid. Under the premise of validity, if the CT value of the FAM signal channel is less than 45 and there is a typical S-shaped amplification curve, the sample to be tested is judged as positive, and if the CT value is equal to 45 or no value, the sample to be tested can be judged as negative.

[0014] Step S5: Calculation of methylation ratio: The comparative CT (ΔΔCT) method was used to determine the methylation ratio of the mir129-2 promoter region in the sample. Using the comparative CT (ΔΔCT) method, the amplification of the target and the endogenous control in the sample and the reference sample was measured. The measurement results were normalized by the endogenous control. The methylation ratio in each sample was determined by comparing the standardized target amount in each sample with the standardized target amount in the reference sample. The reference samples were human HCT116 DKO methylated DNA (100% methylated sample) and human HCT116 DKO non-methylated DNA (0% methylated sample), (Zymo product number: D5014).

[0015] Step S6: Quantitative calculation of plasma samples: convert the methylation ratio into mhGE / ML (methylated genome equivalent per milliliter of plasma). The calculation method of mhGE / ML is: ((methylation ratio * ng * 1000) / 3.3) / ML. Where ng: is the total amount of cfDNA extracted from the plasma sample, ML: is the plasma volume.

[0016] In the present invention, by using the above method, a specific CpG site-enriched region can be specifically amplified when it is in a high methylation state, but cannot be amplified when it is in a low or no methylation state.

[0017] The present invention has the following beneficial effects: The primer-probe combination of the present invention is used to amplify the CpG site-enriched region of the promoter region of the gene mir129-2. Using the method of the present invention, a specific CpG site-enriched region can be specifically amplified when it is in a high methylation state, and cannot be amplified when it is in a low or no methylation state. The kit of the present invention includes a methylation primer and probe for the gene mir129-2, and also includes a primer and probe for an internal reference gene ACTB. The methylation state of the promoter region of the gene mir129-2 can be detected by this kit. The methylation state of the promoter region of the gene mir129-2 can be used as a marker for postoperative MRD detection and dynamic monitoring of pancreatic ductal adenocarcinoma (PDAC), and is used for recurrence risk assessment of patients after pancreatic ductal adenocarcinoma (PDAC) surgery. The present invention adopts a multiplex fluorescence quantitative PCR detection method with high specificity and sensitivity, good repeatability, simple operation, and better performance than the pancreatic ductal adenocarcinoma (PDAC) tumor marker CA19-9 used clinically. In patients with negative CA19-9, methylation of the promoter region of the mir129-2 gene can still effectively predict postoperative recurrence in patients with pancreatic ductal adenocarcinoma (PDAC). The present invention can help clinicians more accurately assess the risk of postoperative recurrence of pancreatic ductal adenocarcinoma (PDAC), improve treatment effects, avoid unnecessary treatment, and thus reduce medical costs.

[0018] In order to more clearly illustrate the structural features and effects of the present invention, the present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of group comparison of methylation of the promoter of gene mir129-2 in different pancreatic lesion samples mentioned in the embodiments of the present invention, wherein methylation of the promoter region of gene Mir129-2 is a specific biomarker for pancreatic malignant tumors, p<0.001.

[0020] Figure 2 The figure is a schematic diagram showing that methylation of the promoter region of the gene Mir129-2 mentioned in the embodiment of the present invention can effectively distinguish adjacent cancer samples from pancreatic ductal adenocarcinoma (PDAC) samples, wherein the area under the curve is 0.994, and when the cut-off value is 2.81% (methylation ratio), the sensitivity is 97.756% and the specificity is 98.693%.

[0021] Figure 3 Schematic diagram of the comparison of methylation of the gene Mir129-2 in PDAC stages (I-IV) mentioned in the examples of the present invention, wherein the methylation of the promoter of the gene Mir129-2 was increased in PDAC I-IV samples, which was significantly different from that of the adjacent cancer samples (Normal), p<0.001.

[0022] Figure 4Schematic diagram of ROC curve for preoperative blood diagnosis of pancreatic ductal adenocarcinoma (PDAC) mentioned in the embodiment of the present invention.

[0023] Figure 5 Schematic diagram of ROC curve for preoperative blood staging diagnosis of pancreatic ductal adenocarcinoma (PDAC) mentioned in the embodiment of the present invention.

[0024] Figure 6 It is a schematic diagram of the feedback of the pancreatic ductal adenocarcinoma (PDAC) disease state mentioned in the embodiment of the present invention.

[0025] Figure 7-Figure 9 Schematic diagram of the postoperative recurrence monitoring for pancreatic ductal adenocarcinoma (PDAC) mentioned in the embodiments of the present invention. DETAILED DESCRIPTION

[0026] The present invention will be further explained below in conjunction with the accompanying drawings and related knowledge, and described clearly and completely. Obviously, the described application is only a part of the embodiments of the present invention, rather than all the embodiments.

[0027] The present invention provides a primer-probe combination for postoperative MRD detection and dynamic monitoring of pancreatic cancer, comprising: specific primers for specifically detecting the methylation region of the promoter of the gene mir129-2 and the internal reference gene ACTB; The primer sequences for specific detection of the methylation region of the promoter of the gene mir129-2 are: Mir129-2-F: GGATGGTGAGATTGAGTC (SEQ ID NO: 1); Mir129-2-R:ATCTCCGAACCCTAAAACCG (SEQ ID NO:2); The specific primer sequence of the internal reference gene ACTB is: ACTB-F:GTAATGTTAGGAGTATTTTGTGGATA (SEQ ID NO:3) ACTB-R: CTAACCCAAAAAAACCCAATCCTA (SEQ ID NO: 4).

[0028] Further, based on the above composition, the present invention also mentions a kit for postoperative MRD detection and dynamic monitoring of pancreatic ductal adenocarcinoma (PDAC), comprising: a primer and probe composition for specifically detecting the DNA methylation state of a specific region of the gene Mir129, the sequence of which is as follows: Mir129-2-F: GGATGGTGAGATTGAGTC (SEQ ID NO: 1) Mir129-2-R:ATCTCCGAACCCTAAAACCG (SEQ ID NO:2) Mir129-2-P:CGATGGAACGCGTTGGGGAGATT (SEQ ID NO:5) The 5' end of the fluorescent probe is labeled with a fluorescent reporter group FAM, and the 3' end is labeled with a fluorescent quencher group BHQ1; The specific primer and probe combination of the internal reference gene ACTB has the following sequence: ACTB-F:GTAATGTTAGGAGTATTTTGTGGATA (SEQ ID NO:3) ACTB-R: CTAACCCAAAAAAACCCAATCCTA (SEQ ID NO:4) ACTB-P: AGAAGAAGGGAGGGGTGTTAGGAGAGG (SEQ ID NO: 6) The 5' end of the probe is labeled with a fluorescent reporter group CY5, and the 3' end is labeled with a fluorescent quencher group BHQ2.

[0029] In the present invention, the primer-probe combination can specifically amplify the CpG site-enriched region of the promoter region of the gene mir129-2, and can only be amplified when the region is in a high methylation state, and cannot be amplified when it is low or no methylation state. This specificity makes the detection result more accurate and reliable, and can effectively distinguish the different methylation states of the gene promoter region; in the high methylation state, the cytosine of the CpG site is methylated, and this modification affects the binding ability of the primer to the DNA template and the efficiency of the DNA polymerase. The primer-probe combination is specially designed to specifically recognize and bind to the high methylation CpG site-enriched region, thereby achieving amplification.

[0030] In addition, since the primer-probe combination is amplified only when the CpG site-enriched region is in a high methylation state, non-specific amplification of low or no methylation regions is avoided, thereby greatly reducing the probability of false positive results. This makes the test results more accurately reflect the true methylation state of the gene promoter region, which helps to improve the reliability of disease diagnosis, prognosis evaluation, etc.; this specific amplification can effectively distinguish the different methylation states of the gene promoter region, not only to determine whether methylation exists, but also to make a preliminary assessment of the degree of methylation based on the amplification situation. It is of great value for the early diagnosis, disease monitoring, and treatment effect evaluation of some diseases. In tumor research, the methylation state of the gene promoter region is often closely related to the occurrence, development, and prognosis of the tumor. By accurately detecting the methylation state of the promoter region of the gene mir129-2, it can provide a more powerful basis for the diagnosis and treatment of diseases such as pancreatic ductal adenocarcinoma.

[0031] In the present invention, the specific region of the gene mir129-2 detected has a sequence containing multiple CpG dinucleotide structures, and the C base of the CpG dinucleotide structure is modified with a methylation group, and this methylation modification is closely related to the progression of pancreatic ductal adenocarcinoma (PDAC); further preferably, the specific region of the gene mir129-2 is specifically detected, and the sequence of the specific region after modification with bisulfite or bisulfite or trap salt is as follows: GGAGTGGTGAGATTGAGTCGCGATGGAACGCGTTGGGGAGATTTAGTTTGTTCGGTTTTAGGGTTCGGAGAT (SEQ ID NO: 7); In the present invention, the internal reference gene ACTB can be used to indicate the total human genome content in the sample to be tested, and can be used to monitor the extraction efficiency and quality, as well as the effectiveness of the entire detection process.

[0032] In the kit of the present invention, the probe for each gene is connected with a specific fluorescent group; preferably, the probe for the human mir129-2 gene is labeled with FAM fluorescein, and the probe for the human ACTB gene is labeled with CY5 fluorescein, thereby achieving methylation detection of multiple gene regions in a single tube reaction; In the present invention, the kit also includes a fully methylated positive control product and an unmethylated negative control product, which are used to monitor the effectiveness of the entire methylation status detection.

[0033] The kit of this invention not only contains primers and probes for detecting the methylation status of the gene mir129-2, but also comes with primers and probes for the internal reference gene ACTB. The introduction of the internal reference gene can correct various factors in the experimental process, such as sample quality, DNA extraction efficiency, PCR amplification efficiency, etc., thereby improving the accuracy and comparability of the test results; by using this kit, the methylation status of the promoter region of the gene mir129-2 can be easily detected. And this methylation status is a marker for the detection and dynamic monitoring of minimal residual disease (MRD) after pancreatic ductal adenocarcinoma surgery, which is of great significance for assessing the risk of recurrence in patients after pancreatic ductal adenocarcinoma surgery.

[0034] Another aspect of the present invention provides a method for detecting methylation of the gene mir129-2 in vitro, comprising the following steps: Nucleic acid extraction: Extract DNA from peripheral plasma or tissue; Nucleic acid conversion: The extracted DNA is treated with bisulfite, bisulfite or trap salt and purified to obtain a modified sample to be tested; Target amplification: using the kit for postoperative MRD detection and dynamic monitoring of pancreatic ductal adenocarcinoma (PDAC) of the present invention, multiplex fluorescence quantitative PCR amplification is performed on the modified sample to be tested; Interpretation of results: FAM and CY5 signal channels are detected simultaneously, and the number of cycles required to reach the set threshold is read as the judgment standard. If the CT value of the CY5 signal channel of the sample to be tested is less than 31, the sample to be tested is valid. Under the premise of validity, the CT value of the FAM signal channel is less than 45, and there is a typical S-shaped amplification curve, the sample to be tested is judged as positive, and the CT value is equal to 45 or no value, the sample to be tested can be judged as negative.

[0035] Preferably, it is used to detect the methylation status of multiple CpGs in at least one region in the specific region of the gene mir129-2, to achieve high-specificity and sensitive detection of pancreatic ductal adenocarcinoma (PDAC) in plasma samples, and in tissue samples, it can significantly distinguish between cancer tissue and normal tissue (paracancerous tissue).

[0036] The present invention adopts a multiplex fluorescence quantitative PCR detection method, which has the characteristics of high specificity and sensitivity, can accurately detect low-abundance methylated DNA, and can effectively detect the methylation status of the promoter region of the gene mir129-2 even when the methylation level in the sample is low. The detection method has good repeatability, can ensure stable and consistent results in experiments of different batches, and is conducive to routine application in clinical laboratories. At the same time, its operation is relatively simple, does not require complex experimental techniques and equipment, and is easy to promote and popularize; compared with the pancreatic ductal adenocarcinoma tumor marker CA19-9 commonly used in clinical practice, the detection method of the present invention shows better performance in terms of specificity, sensitivity and accuracy. Especially in patients with negative CA19-9, methylation of the promoter region of the mir129-2 gene can still effectively predict postoperative recurrence in patients with pancreatic ductal adenocarcinoma, making up for the shortcomings of traditional markers and providing clinicians with more comprehensive and accurate diagnostic information.

[0037] The present invention can help clinicians more accurately assess the risk of recurrence in patients with pancreatic ductal adenocarcinoma after surgery, thereby developing personalized treatment plans for patients. For patients with positive methylation status, postoperative monitoring and treatment can be strengthened to improve the treatment effect; while for patients with negative methylation status, unnecessary overtreatment can be avoided, medical costs can be reduced, and the quality of life of patients can be improved.

[0038] The following provides specific embodiments of the present invention; Example 1

[0039] Plasma sample extraction, conversion detection and result interpretation 1. Plasma cfDNA extraction 1) Transfer 200µl of proteinase K to a 15ml centrifuge tube; 2) Transfer 2 ml of plasma sample to a centrifuge tube containing proteinase K and shake gently to mix; 3) Add 1.6 ml of buffer ACL (containing 1 µg of Carrier RNA) to the sample and vortex for 15 seconds. Place in a 60°C water bath for 30 minutes, occasionally inverting several times to mix; 4) Add 3.6 ml of buffer ACB to the sample. Vortex to mix for 15 seconds. Place on ice for 5 minutes. (You can place it in a -20℃ refrigerator for 10 minutes or a 4℃ refrigerator for 20-30 minutes); 5) Assemble the centrifuge device and place it in a 50ml collection tube; 6) Pour the buffer ACB and sample mixture from step 4 into the centrifuge and centrifuge at 2000xg for 5 minutes; 7) Open the lid of the centrifuge tube, take out the recovery column, and discard the centrifuge device and 50ml centrifuge tube; 8) Place the recovery column in step 7 into a 2 ml collection tube. Add 600 µl of Wash Buffer I to the recovery column. Centrifuge at 13,000 x g for 30 seconds; 9) Discard the filtrate and put the recovery column back into the collection tube. Add 600µl of Wash Buffer II to the column. Centrifuge at 13,000xg for 30 seconds; 10) Discard the filtrate and put the recovery column back into the collection tube. Add 600µl of anhydrous ethanol to the column. Centrifuge at 13,000xg for 30 seconds; 11) Discard the filtrate and put the recovery column back into the new collection tube. Centrifuge at 13,000xg for 2 minutes; 12) Take out the recovery column, put it in a 1.5 ml centrifuge tube, open the cover of the column and dry it for 10 minutes; 13) Add 53 µl of enzyme-free water to the recovery column. Allow to stand for 3 minutes. Centrifuge at ≥13,000 × g for 1 minute; 14) The cfDNA recovered by centrifugation is immediately subjected to subsequent sulfite conversion.

[0040] 2. Sulfite conversion of cfDNA 1) Add 100ul of pre-prepared sulfite solution to each sample (50ul), vortex gently to mix and centrifuge; 2) Place in PCR instrument and run the program as shown in Table 1: Table 1: Sulfite conversion procedure

[0041] 3) Prepare a purification column for each sample, add 600ul of M binding buffer to each purification column, and place it in a collection tube; 4) After the transformation process is completed, remove the reaction tube from the PCR instrument, centrifuge it briefly, and then transfer 150ul of the transformation mixture in the reaction tube to the device in step 3 and mix it upside down; 5) Cover the tube and centrifuge at 10,000 x g for 30 seconds; 6) Discard the filtrate, put the purification column back into the collection tube, add 100µl of M washing buffer, and centrifuge at 13000xg for 30 seconds; 7) Add 200 µl of M de-yellowing buffer to the column, incubate at room temperature for 15-20 minutes, and centrifuge at 13,000 x g for 30 seconds; 8) Add 200 µl of M wash buffer to the column and centrifuge at 13,000 x g for 30 seconds; 9) Repeat step 8 once, discard the filtrate, put the purification column back into the collection tube, and centrifuge at 14000xg for 2 minutes; 10) Take out the purification column and put it into a 1.5 ml centrifuge tube. Leave it at room temperature for 3 minutes with the lid open. Add 23 µl of elution buffer and leave it at room temperature for 3 minutes. Centrifuge at 14,000 x g for 1 minute. 11) The converted cfDNA is recovered by centrifugation and immediately subjected to subsequent PCR testing.

[0042] 3. Methylation-specific fluorescence quantitative PCR detection The above-mentioned cfDNA purified after sulfite sulfation was used as a template for methylation-specific fluorescent quantitative PCR. The primers and probes of the gene mir129-2 and the internal reference gene ACTB were placed in the same tube for fluorescent quantitative PCR amplification reaction (instrument: ABI7500). The reaction system is shown in Table 2, and the reaction conditions are shown in Table 3.

[0043] Table 2: Methylation-specific fluorescence quantitative PCR reaction system:

[0044] Table 3: Methylation-specific fluorescence quantitative PCR reaction conditions:

[0045] 4. Interpretation of results The FAM and CY5 signal channels are detected at the same time, and the Ct value of the number of cycles required to reach the set threshold is used as the judgment standard. If the CT value of the CY5 signal channel of the sample to be tested is less than 31, the sample to be tested is valid. Under the premise of validity, if the CT value of any of the FAM and VIC signal channels is less than 45 and there is a typical S-shaped amplification curve, the sample to be tested is judged as positive, and if the CT value is equal to 45 or no value, the sample to be tested can be judged as negative.

[0046] Example 2: Detection of clinical samples of pancreatic tissue using the composition of the present invention 306 cases of paracancerous tissues (Normal) (no obvious tumor cells were visible under the microscope after HE staining), 179 pancreatic ductal adenocarcinoma tissues (PDAC), 46 pancreatic cystic tumors (MCN&SCN), 19 pancreatic solid pseudopapillary tumors (SPT), 36 neuroendocrine tumors (NET), 34 intraductal papillary mucinous tumors (IPMN) were taken. DNA extraction was performed using the paraffin-embedded tissue DNA extraction kit of Guangzhou Meiji Biotechnology Co., Ltd., and the transformation and detection process of Example 1 was used for detection. By comparing the methylation ratios of the mir129-2 gene in the lesion tissue and paracancerous tissue, it can be found that the methylation of the promoter region of the gene mir129-2 is significantly increased in the pancreatic ductal adenocarcinoma (PDAC) sample, and there is a statistical difference with other types of samples, so the composition of the present invention can significantly distinguish pancreatic ductal adenocarcinoma (PDAC) from other pancreatic lesion samples and paracancerous samples, and the methylation of the promoter region of the gene mir129-2 is a specific biomarker for pancreatic ductal adenocarcinoma (PDAC). The statistical results are as follows Figure 1 As shown, the comparison of methylation groups of the mir129-2 promoter in different pancreatic lesion samples showed that methylation of the promoter region of the gene Mir129-2 was a specific biomarker for pancreatic malignant tumors; p<0.001; Reference Figure 2 As shown in the figure, diagnostic ROC, methylation of the promoter region of the gene Mir129-2 can effectively distinguish adjacent cancer samples from pancreatic ductal adenocarcinoma (PDAC) samples, with an area under the curve of 0.994, a sensitivity of 97.756%, and a specificity of 98.693% at a cut-off value of 2.81% (methylation ratio).

[0047] Reference Figure 3 As shown, the methylation of the gene Mir129-2 was compared in PDAC stages (I-IV). The methylation of the gene Mir129-2 promoter was increased in PDAC I-IV samples, which was significantly different from that of the adjacent cancer samples (Normal), p<0.001.

[0048] Example 3: Detection of pancreatic ductal adenocarcinoma (PDAC) plasma samples using the composition of the present invention 216 clinical samples were tested, including 157 preoperative plasma samples of pancreatic ductal adenocarcinoma (PDAC) patients (stage I = 50, stage II = 43, stage III = 16, stage IV = 48), and 59 plasma samples of healthy people, which were extracted, transformed, and tested according to the method of Example 1, and the positive and negative judgments were made according to the result interpretation criteria of Example 1. The overall detection sensitivity of preoperative plasma samples of pancreatic ductal adenocarcinoma (PDAC) patients was 87.261%, the specificity was 96.61%, and the area under the curve was 0.952, indicating that the detection index and detection methodology can effectively detect pancreatic ductal adenocarcinoma (PDAC) blood samples, and the methylation of the promoter region of the gene mir129-2 is an effective marker for judging pancreatic ductal adenocarcinoma (PDAC).

[0049] Reference Figure 4 Shown is the ROC curve for preoperative blood diagnosis of pancreatic ductal adenocarcinoma (PDAC); According to the pancreatic ductal adenocarcinoma (PDAC) staging, the later the stage of the patient, the higher the detection sensitivity (stage I: 78%, stage II: 90.70%, stage III: 93.75%, stage IV: 95.83%), and the specificity is (stage I: 93.22%, stage II: 96.61%, stage III: 100%, stage IV: 100%). Reference Figure 5 Shown is the ROC curve for preoperative blood staging diagnosis of pancreatic ductal adenocarcinoma (PDAC).

[0050] Example 4: Reference Figure 6 As shown, the composition of the present invention can feedback the disease state of pancreatic ductal adenocarcinoma (PDAC) A total of 63 samples were collected before and after surgery. Paired blood samples were collected before surgery (1-3 days before surgery) and after surgery (2 weeks to 1 month after surgery). The methylation status of the promoter region of the gene mir129-2 was detected. There was a significant difference in the methylation status of the promoter region of the gene mir129-2 in the blood before and after surgery, p=0.0083, indicating that the methylation status of the promoter region of the gene mir129-2 can well reflect the disease status of pancreatic ductal adenocarcinoma (PDAC).

[0051] Example 5: The composition of the present invention is used for monitoring recurrence after surgery for pancreatic ductal adenocarcinoma (PDAC) A total of 114 patients with pancreatic ductal adenocarcinoma (PDAC) who underwent surgery (2 weeks to 1 month) had their blood samples tested for mir129-2 methylation and were followed up clinically. Imaging was used to determine disease recurrence and follow-up was terminated to determine whether mir129-2 promoter methylation could be used to monitor recurrence after surgery for pancreatic ductal adenocarcinoma. The samples were also compared with the PDAC-specific tumor marker CA19-9 to determine the effectiveness of the two.

[0052] Reference Figure 7 As shown, Result 1: 2 weeks to 1 month after surgery, the methylation level of the promoter of the gene mir129-2 in plasma samples can effectively predict postoperative recurrence in patients with pancreatic ductal adenocarcinoma (PDAC), HR=21.16, p<0.001.

[0053] Reference Figure 8 As shown in the figure, result 2: CA19-9 tumor markers are commonly used in clinical practice, and have a certain predictive effect on postoperative recurrence of pancreatic ductal adenocarcinoma (PDAC), but the predictive ability is far weaker than that of mir129-2 promoter methylation, CA19-9 HR = 4.35. Compared with CA19-9, mir129-2 promoter methylation has higher specificity and accuracy, and can more accurately identify patients with a high risk of postoperative recurrence. The mir129-2 promoter methylation is more closely associated with postoperative recurrence of PDAC, and has a stronger predictive ability for recurrence risk.

[0054] Reference Fig. 9 As shown, Result 3: In CA19-9 negative samples, promoter methylation of the gene mir129-2 can still effectively predict the recurrence of pancreatic ductal adenocarcinoma (PDAC), HR15.28, P = 0.012.

[0055] The technical principle of the present invention is described above in combination with the specific embodiments, which are only preferred implementations of the present invention. The protection scope of the present invention is not limited to the above embodiments, and all technical solutions under the idea of ​​the present invention belong to the protection scope of the present invention. Those skilled in the art can think of other specific implementations of the present invention without creative work, and these methods will fall within the protection scope of the present invention.

Claims

1. A primer-probe combination for postoperative MRD detection and dynamic monitoring of pancreatic cancer, characterized in that: include: Specific primers for the specific detection of the methylation region of the promoter of the gene mir129-2 and the internal reference gene ACTB; The primer sequence for the specific detection gene mir129-2 promoter methylation region is: Mir129-2-F: GGAGTGGTGAGATTGAGTC (SEQ ID NO: 1); Mir129-2-R:ATCTCCGAACCCTAAAACCG (SEQ ID NO:2); The specific primer sequence of the internal reference gene ACTB is: ACTB-F: GTAATGTTAGGAGTATTTTGTGGATA (SEQ ID NO:3); ACTB-R: CTAACCCAAAAAAACCCAATCCTA (SEQ ID NO: 4).

2. A primer-probe combination for postoperative MRD detection and dynamic monitoring of pancreatic cancer according to claim 1, characterized in that: The fluorescent probe sequence for specifically detecting the methylation region of the promoter of the gene mir129-2 is: Mir129-2-P: CGATGGAACGCGTTGGGGAGATT (SEQ ID NO: 5); The 5' end of the probe is labeled with a fluorescent reporter group FAM, and the 3' end is labeled with a fluorescent quencher group BHQ1; The specific probe sequence of the internal reference gene ACTB is: ACTB-P: AGAAGAAGGGAGGGGTGTTAGGAGAGG (SEQ ID NO: 6); The 5' end of the probe is labeled with a fluorescent reporter group CY5, and the 3' end is labeled with a fluorescent quencher group BHQ2.

3. A kit for detecting and dynamically monitoring MRD after pancreatic cancer surgery, characterized in that: The invention comprises the primer-probe combination as claimed in claim 1.

4. A kit for postoperative MRD detection and dynamic monitoring of pancreatic cancer according to claim 3, characterized in that: The invention comprises the primer-probe combination as claimed in claim 2.

5. A kit for postoperative MRD detection and dynamic monitoring of pancreatic cancer according to claim 3, characterized in that: It also includes at least one of a nucleic acid extraction reagent, a nucleic acid conversion reagent PCR MIX, a positive control, and a negative control.

6. An application in the preparation of a kit for MRD detection and dynamic monitoring after pancreatic cancer surgery, characterized in that: The following steps are involved: Step S1: Nucleic acid extraction: extracting DNA from peripheral plasma or tissue; Step S2: Nucleic acid conversion: treating the extracted DNA with bisulfite or bisulfite or trap salt and purifying it to obtain a modified sample to be tested; Step S3: target amplification: using the kit described in any one of claims 3 to 5, performing multiplex fluorescence quantitative PCR amplification on the modified sample to be tested; Step S4: Result interpretation: FAM and CY5 signal channels are detected simultaneously, and the number of cycles required to reach the set threshold is read as the judgment standard; if the CT value of the CY5 signal channel of the sample to be tested is less than 31, the sample to be tested is valid. Under the premise of validity, if the CT value of the FAM signal channel is less than 45 and there is a typical S-shaped amplification curve, the sample to be tested is judged to be positive; if the CT value is equal to 45 or no value, the sample to be tested can be judged to be negative; Step S5: Calculation of methylation ratio: using the comparative CT method to determine the methylation ratio of the mir129-2 promoter region in the sample; and measuring the amplification of the target and the endogenous control in the sample and the reference sample; standardizing the measurement results by the endogenous control, and obtaining the standardized target amount in each sample and the standardized target amount in the reference sample to determine the methylation ratio in each sample; Step S6: Quantitative calculation of plasma samples: convert the methylation ratio into mhGE / ML, where the calculation method of mhGE / ML is: ((methylation ratio * ng * 1000) / 3.3) / ML, where ng: is the total amount of cfDNA extracted from the plasma sample, and ML: is the plasma volume.

7. The use of the method of claim 6 in the preparation of a kit for detecting and dynamically monitoring MRD after pancreatic cancer surgery, characterized in that: In step S5, the reference samples are human HCT116 DKO methylated DNA and human HCT116 DKO non-methylated DNA.

Images