Flow cell with patterned bonding regions

Abstract

An example flow cell includes a patterned substrate having an active region and a bonding region at least partially surrounding the active region. The active region includes a first recess defined in a layer of the patterned substrate, a surface chemistry positioned in the first recess, and a first gap region surrounding the first recess. The bonding region includes a second recess defined in the layer and a second gap region surrounding the second recess. An adhesive is positioned over the second recess and over the second gap region. A cover is attached to the adhesive such that a flow channel is defined between a portion of the cover and the active area.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 373,617, filed on August 26, 2022, the contents of which are incorporated herein by reference in their entirety.

[0003] References to sequence listings

[0004] This application contains a sequence listing, which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML copy was created on August 15, 2023, is named "ILI242BPCT_IP-2339-PCT_SL.xml", and is 15,796 bytes in size. Background Art

[0005] Circulation cells are used in a variety of methods and applications such as gene sequencing, genotyping, etc. For nucleic acid analysis, the surface of the circulation cell can be functionalized with specific surface chemicals such as primers, polymerases, etc., depending on the reaction that will occur. The specified reaction can then be observed or detected, and subsequent analysis can help identify or reveal the characteristics of the chemicals involved in the reaction. In some examples, the controlled reaction changes the charge, conductivity, or some other electrical property, so electronic systems can be used for detection. In other examples, the controlled reaction produces fluorescence, so optical systems can be used for detection. Summary of the invention

[0006] Disclosed herein is a flow cell comprising at least one patterned substrate. The patterned substrate comprises an active region and a bonding region. The bonding region of the patterned substrate may be bonded to a cover, a second patterned substrate, or a second portion of a patterned substrate comprising a bonding region but not comprising an active region. In examples disclosed herein, the bonding region is patterned to have features, including recesses or columns separated by gap regions. These features introduce additional axes for adhesive bonding and also increase the surface area of ​​the substrate available for bonding. Therefore, the overall compression and shear holding force at the bonding region increases. The bonding region in the examples disclosed herein can improve the bonding integrity of the flow cell and help prevent fluid leakage during use. BRIEF DESCRIPTION OF THE DRAWINGS

[0007] By referring to the following detailed description and accompanying drawings, the features of the examples of the present disclosure will become apparent, wherein like reference numerals correspond to similar but possibly not identical parts. For the sake of brevity, reference numerals or features having previously described functions may or may not be described in conjunction with other drawings in which they appear.

[0008] Figure 1is a top view of an example of a patterned substrate including an active area and a bonding area;

[0009] Figure 2A is along Figure 1 A cross-sectional view taken along line 2A-2A shows the Figure 1 An example of a flow cell of an example of a patterned substrate;

[0010] Figure 2B is along Figure 1 A cross-sectional view taken along line 2B-2B shows the Figure 1 An example of a flow cell of another example of a patterned substrate;

[0011] Figure 2C is along Figure 1 A cross-sectional view taken along line 2C-2C shows the Figure 1 An example of a flow cell of yet another example of a patterned substrate;

[0012] Figure 2D is along Figure 1 The cross-sectional view taken along line 2D-2D shows the Figure 1 An example of a flow cell of yet another example of a patterned substrate;

[0013] FIG. 3A to FIG. 3B each of which is a perspective view of a different recessed portion formed in a layer of a patterned substrate;

[0014] FIG. 4A to FIG. 4G each of which is a cross-sectional view of a different geometry of a recess in a bonding area of ​​a patterned substrate;

[0015] Figure 5 yes Figure 4A a perspective view of the recessed portion geometry shown;

[0016] Figure 6 yes Figure 4B a perspective view of the recessed portion geometry shown;

[0017] Figure 7 yes Figure 4C a perspective view of the recessed portion geometry shown;

[0018] Figure 8 is a cross-sectional view of yet another geometry of a recessed portion in a bonding area of ​​a patterned substrate;

[0019] Fig.9A is a top view of a bonding area including recessed portions and a feature overhanging each recessed portion;

[0020] Fig. 9B is along Fig.9A A cross-sectional view taken along line 9B-9B;

[0021] Fig. 9C is along Fig.9A A cross-sectional view taken along line 9C-9C of ;

[0022] Fig. 10A and Fig. 10B is a perspective view of different pillars formed on a layer of a patterned substrate;

[0023] Fig.11 is a perspective view of one example of the geometry of posts in a bonding area of ​​a patterned substrate;

[0024] Fig.12 is a perspective view of another example of the geometry of posts in a bonding area of ​​a patterned substrate;

[0025] Fig.13 is a perspective view of yet another example of a post geometry in a bonding region of a patterned substrate;

[0026] Fig.14A and Fig. 14B each is a perspective view of another example of the geometry of posts in a bonding area of ​​a patterned substrate;

[0027] Fig.15 is a cross-sectional view of a complementary metal oxide semiconductor (CMOS) integrated with an example of a flow cell disclosed herein;

[0028] Fig.16A and Fig. 16B each of which is a top view of an example photoresist pattern for forming a bonding area including recesses and features overhanging each recess;

[0029] Fig.17 Depicted showing the use of Fig.16A or Fig. 16B A schematic flow chart of an example method for forming a photoresist pattern;

[0030] Fig.18 depicts a schematic flow chart illustrating another example method for making recessed features in a bonding area of ​​a patterned substrate; and

[0031] FIG. 19A to FIG. 19C is a graph depicting the results of a cyclic pressure test, wherein the percentage of flow cells that survived the pressure test is depicted on the Y-axis and the number of pressure cycles is depicted on the X-axis. DETAILED DESCRIPTION

[0032] The flow cell disclosed herein comprises at least one patterned substrate, the patterned substrate comprising a patterned active area and a patterned bonding area. The patterned active area comprises a recessed portion or a column functionalized by a surface chemical substance that promotes a desired reaction. The patterned bonding area comprises a recessed portion or a column that is not functionalized by a surface chemical substance, but increases the surface that can be used for bonding with an adhesive.

[0033] In some examples, the patterned substrate is incorporated into a flow cell suitable for optical detection of the reaction. In other examples, the patterned substrate is incorporated into a flow cell integrated above a solid-state imager (such as a complementary metal oxide semiconductor (CMOS) imager). In these examples, the flow cell is suitable for optical detection of the reaction.

[0034] definition

[0035] It should be understood that, unless otherwise indicated, the terms used herein are to be understood to have their ordinary meanings in the relevant art. Several terms used herein and their meanings are listed below.

[0036] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0037] The terms comprise, include, contain and forms of these terms are synonymous with each other and are intended to be equally broad.

[0038] The terms top, bottom, lower, upper, and above are used herein to describe the various components of the flow cell and / or the flow cell. It should be understood that these directional terms are not intended to imply a specific orientation, but are used to specify the relative orientation between components. The use of directional terms should not be interpreted as limiting the examples disclosed herein to any specific orientation.

[0039] The terms first, second, etc. are not intended to imply a particular orientation or order, but are used to distinguish one element from another.

[0040] It should be understood that the ranges provided herein include the specified range and any value or sub-range within the specified range, as if such value or sub-range was explicitly listed. For example, a range of about 400 nm to about 1 μm (1000 nm) should be interpreted as including not only the explicitly listed limits of about 400 nm to about 1 μm, but also individual values, such as about 708 nm, about 945.5 nm, etc., and sub-ranges, such as about 425 nm to about 825 nm, about 550 nm to about 940 nm, etc. In addition, when "about" and / or "substantially" are used to describe values, they are intended to cover minor variations (up to + / - 10%) from the value.

[0041] The term "active area" refers to a region of a patterned substrate that includes features (ie, depressions or posts) that support surface chemistry that facilitates a desired reaction that is detected when a flow cell containing the patterned substrate is in operation.

[0042] As used herein, the term "attachment" refers to the state in which two things are joined, fastened, adhered, connected or combined with each other, directly or indirectly. For example, the bond formed can be covalent or non-covalent. A covalent bond is characterized by the sharing of electron pairs between atoms. Non-covalent bonds are physical bonds that do not involve sharing of electron pairs and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions.

[0043] As used herein, "bonding region" refers to a region of a patterned substrate to be bonded to another material, which may be a cover, another patterned substrate, or a portion of a patterned substrate, as examples. In examples disclosed herein, the bond formed at the bonding region is a chemical bond.

[0044] As used herein, the term "deposition" refers to any suitable application technique, which may be manual or automated, and in some cases, results in modification of surface properties. Generally speaking, deposition may be performed using vapor deposition techniques, coating techniques, grafting techniques, and the like. Some specific examples include chemical vapor deposition (CVD), spraying (e.g., ultrasonic spraying), spin coating, thick coating or dip coating, doctor blade coating, whipping dispensing, flow through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, and the like.

[0045] As used herein, the term "recess" refers to a discrete concave feature of a substrate, wherein the recess has a surface opening that is at least partially surrounded by a gap region of the substrate. The recess may have any of a variety of shapes at the opening in its surface, including, for example, circular, elliptical, square, polygonal, star-shaped (with any number of vertices), etc. A cross-section of the recess taken orthogonally to the substrate surface may be curved, square, polygonal, hyperbolic, conical, angular, etc. Several example recesses are described herein.

[0046] When used in reference to a collection of items, the term "each" is intended to identify a single item in the collection, but does not necessarily refer to every item in the collection. Exceptions may occur if explicitly disclosed or the context clearly dictates otherwise.

[0047] As used herein, the term "flow cell" is intended to mean a container having a flow channel in which a reaction can be performed, an inlet for delivering reagents to the flow channel, and an outlet for removing reagents from the flow channel. In some examples, the flow cell enables detection of reactions occurring in the chamber. For example, the flow cell may include one or more transparent surfaces that allow optical detection of arrays, optically labeled molecules, etc. within the flow channel.

[0048] As used herein, a "flow channel" or "channel" may be a region defined between two bonded components that can selectively receive a liquid sample. In some examples, a flow channel may be defined between a patterned substrate and a cover, and thus may be in fluid communication with one or more recesses or ports defined in or on the patterned substrate. A flow channel may also be defined between two patterned substrates bonded together, or between a patterned substrate and a portion of a patterned substrate.

[0049] As used herein, the term "gap region" refers to a region of, for example, a substrate that separates features (e.g., recesses or columns) defined in or on the substrate. For example, a gap region may separate one recess or column of an array from another recess or column of the array. Two recesses or columns that are separated from each other may be discrete, i.e., lack physical contact with each other. In the examples disclosed herein, the gap region is continuous, while the recesses or columns are discrete, such as for multiple recesses defined in an otherwise continuous surface or multiple columns formed on an otherwise continuous surface.

[0050] As used herein, "negative photoresist" refers to a photosensitive material in which portions exposed to light of a particular wavelength become insoluble in a developer. In these examples, the solubility of the insoluble negative photoresist in the developer is less than 5%. For negative photoresists, exposure to light changes the chemical structure so that the exposed portions of the material become less soluble in the developer (compared to the unexposed portions). Although insoluble in the developer, the insoluble negative photoresist may be at least 99% soluble in a remover that is different from the developer. The remover may be, for example, a solvent or a mixture of solvents used in a stripping process.

[0051] In contrast to an insoluble negative photoresist, any portion of the negative photoresist that is not exposed to light is at least 95% soluble in a developer. This portion may be referred to as a "soluble negative photoresist." In some examples, the soluble negative photoresist is at least 98%, such as 99%, 99.5%, 100%, soluble in a developer.

[0052] As used herein, "nucleotide" includes a nitrogenous heterocyclic base, a sugar, and one or more phosphate groups. Nucleotide is a monomeric unit of a nucleic acid sequence. In ribonucleic acid (RNA), the sugar is ribose, and in deoxyribonucleic acid (DNA), the sugar is deoxyribose, i.e., a sugar lacking a hydroxyl group present at the 2' position of ribose. Nitrogenous heterocyclic bases (i.e., nucleobases) may be purine bases or pyrimidine bases. Purine bases include adenine (A) and guanine (G) and their modified derivatives or analogs. Pyrimidine bases include cytosine (C), thymine (T) and uracil (U) and their modified derivatives or analogs. The C-1 atom of deoxyribose is bonded to the N-1 of pyrimidine or the N-9 of purine. Nucleic acid analogs may have any of a modified phosphate backbone, sugar, or nucleobase. Examples of nucleic acid analogs include, for example, universal bases or phosphate-sugar backbone analogs, such as peptide nucleic acids (PNA).

[0053] The term "polymer hydrogel" refers to a semi-rigid polymer that is permeable to liquids and gases. A polymer hydrogel can swell when a liquid (e.g., water) is absorbed and can shrink when the liquid is removed, such as by drying. Although a hydrogel can absorb water, it is not water soluble.

[0054] As used herein, "positive photoresist" refers to a photosensitive material in which portions exposed to light of a particular wavelength become soluble in a developer. In these examples, any portion of the positive photoresist exposed to light is at least 95% soluble in the developer. This portion may be referred to herein as a "soluble positive photoresist." In some examples, the portion of the positive photoresist exposed to light (i.e., the soluble photoresist) is at least 98%, such as 99%, 99.5%, 100%, soluble in the developer. For positive photoresists, exposure to light changes the chemical structure so that the exposed portion of the material becomes more soluble in the developer (compared to the unexposed portion).

[0055] Compared to soluble positive photoresists, any portion of the positive photoresist that is not exposed to light is insoluble (less than 5% soluble) in the developer. This portion may be referred to as "insoluble positive photoresist". Although insoluble positive photoresists are insoluble in developers, they may be at least 99% soluble in a remover that is different from the developer. In some examples, the insoluble positive photoresist is at least 98%, such as 99%, 99.5%, or 100%, soluble in the remover. The remover may be a solvent or a mixture of solvents used in the stripping process.

[0056] As used herein, the term "post" refers to a discrete raised feature of a substrate, wherein the post has a base portion at least partially surrounded by a gap region of the substrate, and has a top surface positioned a distance from the base portion by the body of the post. The post can have any of a variety of shapes at the top portion, including, for example, circular, oval, square, polygonal, star-shaped (with any number of vertices), etc. A cross-section of the post taken orthogonally to the substrate surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. Several example posts are described herein.

[0057] As used herein, the term "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA). Some primers referred to herein as amplification primers are used as the starting point for template amplification and cluster generation. Other primers referred to herein as sequencing primers are used as the starting point for DNA synthesis. The 5' end of each primer in the primer set can be modified to allow coupling reaction with the functional group of the polymer chain. The primer length can be any number of base lengths and can include a variety of non-natural nucleotides. In one example, the sequencing primer is a short chain ranging from 10 to 60 bases, or 20 to 40 bases.

[0058] The term "partially patterned substrate" refers to a single-layer or multi-layer support that includes bonding areas but does not include active areas.

[0059] The term "patterned substrate" refers to a single-layer or multi-layer support including active areas and bonding areas.

[0060] The term "surface chemistry" refers to the polymer hydrogels and primers that facilitate the desired reactions to be detected when the flow cell containing the patterned substrate is in operation.

[0061] The term "transparent" refers to a material, for example, in the form of a layer, that is capable of transmitting a specific wavelength or range of wavelengths. For example, the material may be transparent to the wavelengths used in the sequencing operation. Transparency can be quantified using transmittance, i.e., the ratio of the light energy falling on a subject to the light energy transmitted through the subject. The transmittance of a transparent layer will depend on the thickness of the layer, the wavelength of the light, and the dose of light to which it is exposed. In the examples disclosed herein, the transmittance of a transparent metal layer may range from 0.1 (10%) to 1 (100%). The material of the transparent metal layer may be a pure material, a material with some impurities, or a mixture of materials, as long as the resulting layer is capable of having the desired transmittance.

[0062] Flow cell

[0063] Examples of flow cells disclosed herein include at least one patterned substrate. Figure 1A top view of an example of a patterned substrate 10 is shown in FIG. The patterned substrate 10 includes an active area 12 or 12' and a bonding area 14 or 14' and 14" at least partially surrounding the active area 12 or 12'.

[0064] Figure 1 The patterned substrate 10 shown in FIG. 1 includes two active areas 12 or 12' and corresponding bonding areas 14 or 14' located on both sides of the active areas 12 or 12'. Figure 1 Two active areas 12 or 12' are shown in the figure, but it should be understood that any number of active areas 12 or 12' (e.g., a single active area 12 or 12', four active areas 12 or 12', eight active areas 12 or 12', etc.) can be included in the patterned substrate 10. Each active area 12 or 12' is isolated from every other active area 12 or 12' (e.g., by bonding areas 14 or 14') so that a fluid introduced into any particular active area 12 or 12' does not flow into any other active area 12 or 12'.

[0065] In one example, the active region 12 or 12' has a substantially rectangular configuration with pointed or rounded ends. The length and width of the active region 12 or 12' may be respectively smaller than the length and width of the layer 18 in which the active region 12 or 12' is formed (see, e.g. Figure 2A ) so that a portion of the layer 18 surrounding each active area 12 or 12' can be used as a bonding area 14 or 14' and 14", that is, can be used to attach to the cover 30. Examples of the cover 30 include a cover 46 ( Figure 2A and Figure 2B ), partially patterned substrate 48 ( Figure 2C ) or another patterned substrate 10" ( Figure 2D ). In some cases, the width of each active area 12 or 12' can be at least about 1 mm, at least about 2.5 mm, at least about 5 mm, at least about 7 mm, at least about 10 mm, or more. In some cases, the length of each active area 12 or 12' can be at least about 10 mm, at least about 25 mm, at least about 50 mm, at least about 100 mm, or more. The width and / or length of each active area 12 or 12' can be greater than, less than, or between the values ​​specified above.

[0066] The bonding area 14 or 14' flanking the longer side of the active area 12 or 12' is patterned with a recessed portion 16' (see, e.g. Figure 2A ) or column 34' (see e.g. Figure 2B ), which increases the contact adhesive 28 (see e.g. Figure 2A ) of the surface area of ​​layer 18.

[0067] In one example, the bonding area 14 or 14' has a rectangular configuration.The length and width of the bonding area 14 or 14' may be the same as the length and width of the active area 12 or 12', respectively.

[0068] Alternatively, the length and width of the bonding area 14 or 14' can be slightly smaller than the length and width of the active area 12 or 12', respectively. In some cases, the width of each bonding area 14 or 14' can be at least about 1mm, at least about 2.5mm, at least about 5mm, at least about 7mm, at least about 10mm or larger. In some cases, the length of each bonding area 14 or 14' can be at least about 10mm, at least about 25mm, at least about 50mm, at least about 100mm or larger. The width and / or length of each bonding area 14 or 14' can be greater than, less than, or between the values ​​specified above.

[0069] Another bonding area 14 ″ flanks the shorter sides of the active area 12 or 12 ′ and the shorter sides of the bonding area 14 or 14 ′. This bonding area 14 ″ is not patterned with recesses 16 ′ or posts 34 ′, but is a substantially flat portion of the layer 18 .

[0070] Figure 2A , Figure 2B , Figure 2C and Figure 2D Examples of flow cells 20A, 20B, 20C, 20D including at least one patterned substrate 10 are shown in FIG. Figure 2A , Figure 2C and Figure 2D The example flow cells 20A, 20C, 20D shown in the drawings include an example of a patterned substrate 10 having an active area 12 and bonding areas 14, 14' at least partially surrounding the active area 12, wherein the active area 12 includes a first recess 16 defined in a layer 18 of the patterned structure 10, a surface chemical (e.g., a polymer hydrogel 22 and primers 24A, 24B) positioned in the first recess 16, and a first gap area 26 surrounding the first recess 16; and wherein the bonding area 14 includes a second recess 16' defined in the layer 18 and a second gap area 26' surrounding the second recess 16'; an adhesive 28 positioned in the second recess 16' and on the second gap area 26'; and a cover 30 attached to the adhesive 28 such that a flow channel 32 is defined between a portion of the cover 30 and the active area 12.

[0071] Figure 2BThe example flow cell 20B shown in the figure includes another example of a patterned substrate 10' having an active area 12' and a bonding area 14' at least partially surrounding the active area 12', wherein the active area 12' includes a first column 34 defined in a layer 18 of the patterned substrate 10', a surface chemical (e.g., a polymer hydrogel 22 and primers 24A, 24B) positioned above the first column 34, and a first gap area 26 surrounding the first column 34; and wherein the bonding area 14' includes a second column 34' defined in the layer 18 and a second gap area 26' surrounding the second column 34'; an adhesive 28 positioned above the second gap area 26' and above the second column 34'; and a cover 30 attached to the adhesive 28 such that a flow channel 32 is defined between a portion of the cover 30 and the active area 12'.

[0072] When the flow cells 20A, 20B, 20C, 20D are used with an optical detection device, the layer 18 may be a single layer substrate that is patterned, or may be part of a multi-layer substrate that includes the layer 18 (that is patterned) positioned over one or more additional layers.

[0073] When layer 18 is a single layer substrate, layer 18 can be any support material that can be patterned to have recesses 16, 16' or pillars 34, 34'. Examples of materials suitable for single layer substrates include epoxysilicone, glass, modified or functionalized glass, plastics (including acrylic, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as available from Chemours) and polytetrafluoroethylene (such as polytetrafluoroethylene). ), cycloolefins / cycloolefin polymers (COP) (such as those available from Zeon ), polyimide, etc.), nylon (polyamide), ceramic / ceramic oxides, silicon dioxide, fused silica or silicon dioxide-based materials, aluminum silicates, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5) or other tantalum oxides (TaO x ), hafnium oxide (HfO2), carbon, metal, inorganic glass, etc. In some cases, the single-layer substrate is selected to be transparent to the excitation and emission wavelengths used in the optical detection of the reactions occurring within the flow cells 20A, 20B, 20C, 20D.

[0074] One example of a multilayer substrate includes layer 18 that is patterned with recesses 16, 16' or posts 34, 34' and is positioned above a base support 36. As an example, layer 18 can be an inorganic oxide that is selectively applied to the base support 36 in a desired pattern. Examples of suitable inorganic oxides include tantalum oxide (e.g., Ta2O5), aluminum oxide (e.g., Al2O3), silicon oxide (e.g., SiO2), hafnium oxide (e.g., HfO2), and the like. As another example, layer 18 can be a resin matrix material that is applied to the base support 36 and then patterned. Some examples of suitable resins include polyhedral oligomeric silsesquioxane-based resins, non-polyhedral oligomeric silsesquioxane epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opened epoxy resins), acrylic resins, acrylate resins, methacrylate resins, amorphous fluoropolymer resins (e.g., available from Bellex) and the like. ), and their combinations.

[0075] As used herein, the term "polyhedral oligomeric silsesquioxane" (trade name Commercially available from Hybrid Plastics) refers to a hybrid intermediate between silicon dioxide (SiO2) and organosilicon (R2SiO2) (e.g., RSiO2). 1.5 ). Examples of polyhedral oligomeric silsesquioxanes may be as described by Kehagias et al. in Microelectronic Engineering 86 (2009) pp. 776-778, which is incorporated by reference in its entirety. In one example, the composition is a composition having the formula [RSiO 3 / 2 ] n of an organosilicon compound, wherein the R groups may be the same or different. Exemplary R groups of polyhedral oligomeric silsesquioxanes include epoxy, azide / azido, thiol, poly(ethylene glycol), norbornene, tetrazine, acrylate and / or methacrylate, or additionally for example alkyl, aryl, alkoxy and / or haloalkyl groups. The resin compositions disclosed herein may include one or more different cage or core structures as monomer units. The average cage content may be adjusted during synthesis and / or controlled by purification methods, and the cage size distribution of the monomer units may be used in the examples disclosed herein.

[0076] The multi-layered base support 36 may be any of the examples described herein for a single-layer substrate.

[0077] When the flow cell 20A, 20B, 20C, 20D is used with an electronic detection device, the layer 18 can be a passivation layer or one of several stacked passivation layers coupled to a complementary metal oxide semiconductor (CMOS) chip (see Fig.15). In these examples, layer 18 can provide a level of corrosion protection for the embedded metal layer of the CMOS chip closest to layer 18. When stacked passivation layers are used, the layer forming the bottom surface of the recess 16 or defining the column 34 is selected to be transparent to light emission (e.g., visible light) generated by reactions occurring at the surface chemical substances. Similarly, when stacked passivation layers are used, the outermost layer is selected to at least initially resist the fluid environment and moisture that may be introduced into or present in the flow channel 32. The material that is at least initially resistant acts as an etching barrier to high pH reagents (e.g., pH range of 8 to 14) and acts as a moisture barrier. Examples of suitable materials for passivation layers include silicon nitride (Si3N4), silicon oxide (SiO2), tantalum oxide (e.g., tantalum pentoxide (TaO5)), hafnium oxide (HaO2), boron-doped p+ silicon, etc. In some examples, the stack of passivation layers may also include non-passivating materials, such as tantalum layers. While several example materials have been provided, it should be understood that other layers that provide suitable etch rates to produce the desired recess geometry and passivation (if necessary) may be used. The total thickness of the passivation layer (including layer 18) may range from about 100 nm to about 500 nm.

[0078] exist Figure 2A , Figure 2C and Figure 2D In the example shown, the active area 12 and the bonding area 14 include recessed portions 16 , 16 ′.

[0079] In some examples, the geometric shape of each first recessed portion 16 and each second recessed portion 16 'is the same. In other words, in these examples, all recessed portions 16, 16 'have the same geometric shape. In these examples, the geometric shape of recessed portions 16, 16 'is selected from the group consisting of cylinder, elliptical cylinder, sphere, cube, cuboid, lanceolate, polygonal prism and their combination. The example of a suitable polygonal prism includes a triangular prism, a square prism (i.e., a cube), a rectangular prism (i.e., a cuboid), a pentagonal prism, a hexagonal prism, an octagonal prism or a trapezoidal prism. Any shape that generally has an oblique angle can alternatively have a rounded corner. In addition, it should be understood that the recessed portions 16, 16 'combined with geometric shapes have an overall shape that combines two or more of the listed three-dimensional shapes.

[0080] Figure 3A and Figure 3B 1 shows a perspective view of some geometric shapes of the recessed portions 16, 16'. Specifically, Figure 3A A perspective view of the cylindrical recesses 16, 16' is shown in FIG. Figure 3B A perspective view of the oval cylindrical recesses 16 , 16 ′ is shown in FIG.

[0081] Each recess 16, 16' is a three-dimensional space extending inward (downward) from the surface of layer 18. Thus, recesses 16, 16' are recessed areas relative to interstitial areas 26, 26' of layer 18 surrounding recesses 16, 16', respectively.

[0082] The layout or pattern of the recessed portion 16 in the active area 12 can be the same or different from the layout or pattern of the recessed portion 16' in the bonding area 14. The corresponding layout can be a regular, repeated or irregular pattern. In one example, the recessed portions 16, 16' in the active area 12 and the bonding area 14 are arranged in a hexagonal grid so as to be closely packed and improve density. Other layouts may include, for example, rectangular layouts, triangular layouts, etc. In some examples, the layout or pattern can be an xy format of the recessed portions 16 or 16' in the form of rows and columns, and separated by gap areas 26 or 26'. The recessed portions 16 or 16' can be arranged in other patterns, such as stripes, swirls, lines, triangles, rectangles, circles, arcs, checkered patterns, diagonal lines, arrows and / or squares. The recessed portions 16 or 16' can also be configured as grooves extending partially along the length or width of the layer 18.

[0083] The layout or pattern of the recesses 16 or 16' can be characterized relative to the density (e.g., the number of recesses 16, 16') of the respective recesses 16, 16' in the active area 12 and the bonding area 14. For example, the recesses 16 and / or 16' can be approximately 2 million / mm 2 The density can be adjusted to different densities, including, for example, about 100 / mm 2 , about 1,000 pieces / mm 2 , about 100,000 / mm 2 , about 1 million pieces / mm 2 , about 2 million pieces / mm 2 , about 5 million pieces / mm 2 , about 10 million / mm 2 , about 50 million / mm 2 or greater or lesser density. It should also be understood that the density of the recesses 16 or 16' may be between a value selected from the lower limit value and a value selected from the upper limit value of the above range. For example, a high-density array may be characterized as having recesses 16 or 16' spaced less than about 100 nm, a medium-density array may be characterized as having recesses 16 or 16' spaced from about 400 nm to about 1 μm, and a low-density array may be characterized as having recesses 16 or 16' spaced greater than about 1 μm. Although exemplary densities have been provided, it should be understood that any suitable density may be used. In some cases, it may be desirable that the spacing between recesses 16 or 16' is even greater than the examples listed herein.

[0084] The layout or pattern of the recessed portion 16 or 16' may also be characterized according to or alternatively according to the average pitch or spacing (center-to-center spacing) from the center of one recessed portion 16 or 16' to the center of the adjacent recessed portion 16 or 16' or the average pitch or spacing (edge-to-edge spacing) from the left edge of one recessed portion 16 or 16' to the right edge of the adjacent recessed portion 16 or 16'. The pattern may be regular so that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, about 50nm, about 0.1μm, about 0.5μm, about 1μm, about 5μm, about 10μm, about 100μm, or more or less. The average pitch of a particular pattern of recessed portions 16 or 16' may be between a value selected from the lower limit value and a value selected from the upper limit value of the above range. In one example, the recessed portion 16 or 16' has a pitch (center-to-center spacing) of about 1.5μm. While example average pitch values ​​have been provided, it should be understood that other average pitch values ​​may be used.

[0085] The size of each recess 16 , 16 ′ may be characterized by its volume, open area, depth and / or diameter or length and width.

[0086] Each recess 16, 16' may have any volume that is capable of receiving the desired materials, such as the surface chemistry for the recess 16 and the adhesive 28 for the recess 16'. As an example, the volume may be at least about 1 x 10 -3 μm 3 , at least about 1×10 -2 μm 3 , at least about 0.1 μm 3 , at least about 1 μm 3 , at least about 10 μm 3 , at least about 100 μm 3 Alternatively or in addition, the volume may be at most about 1×10 4 μm 3 , at most about 1×10 3 μm 3 , up to about 100μm 3 , up to about 10μm 3 , up to about 1μm 3 , up to about 0.1μm 3 or smaller.

[0087] The area occupied by each recess opening may be at least about 1×10 -3 μm 2 , at least about 1×10 -2 μm 2 , at least about 0.1 μm 2, at least about 1 μm 2 , at least about 10 μm 2 , at least about 100 μm 2 Alternatively or in addition, the area may be at most about 1×10 3 μm 2 , up to about 100μm 2 , up to about 10μm 2 , up to about 1μm 2 , up to about 0.1μm 2 , at most about 1×10 -2 μm 2 The area occupied by each recess opening may be greater than, less than, or in between the values ​​specified above.

[0088] The depth of each recess 16 is large enough to accommodate the surface chemistry, and the depth of each recess 16' depends on the desired surface area for bonding. The depth can be measured from the surface of the layer 18 to the deepest point at the bottom of the recess 16 or 16'. As an example, the depth of the respective recess 16, 16' can be at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or in addition, the depth of the respective recess 16, 16' can be at most about 1×10 3 In some examples, the depth of each recess 16, 16' is about 0.4 μm. The depth of each recess 16, 16' may be greater than, less than, or between the values ​​specified above.

[0089] In some cases, the diameter or length and / or width or other longest dimension of a particular geometry of the recess 16, 16' may be at least about 10 nm, at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or in addition, the size may be at most about 1×10 3 In some examples, the diameter of each cylindrical recess 16, 16' is about 0.4 μm. The size of each recess 16, 16' can be greater than, less than, or between the values ​​specified above.

[0090] In other examples, the geometry of each first recessed portion 16 is different from the geometry of each second recessed portion 16'. In other words, in these other examples, all recessed portions 16 in the active area 12 have one type of geometry, and all recessed portions 16' in the bonding area 14 have a different type of geometry. In these examples, the geometry of the recessed portion 16 is selected from the group consisting of a cylinder, an elliptical cylinder, a sphere, a cube, a cuboid, a lanceolate, a polygonal prism, and combinations thereof, and the geometry of the recessed portion 16' in the bonding area 14 is a different geometry selected from the same group.

[0091] In one example, the geometry of each first recessed portion 16 is cylindrical, and the geometry of each second recessed portion 16' is elliptical cylindrical, spherical, cubic, cuboid, lanceolate, polygonal, or a combination thereof. In another example, the geometry of each first recessed portion 16 is elliptical cylindrical, and the geometry of each second recessed portion 16' is cylindrical, spherical, cubic, cuboid, lanceolate, polygonal, or a combination thereof. Any layout, size, and / or other characteristics of these geometries may be used.

[0092] In other examples, the geometric shape of each first concave portion 16 is selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a cuboid, a cone, and a polygonal prism; and the geometric shape of each second concave portion 16 'includes a wide portion P W The narrow part of the opening P N In these other examples, any of the layouts, dimensions, and / or other features described herein for a cylinder or an elliptical cylinder may be used for the first recessed portion 16 .

[0093] FIG. 4A to FIG. 4E Depicted includes the wide portion P W The narrow part of the opening P N sectional views of different examples of the geometry of FIG. In each of these examples, the narrow portion P N The size D1 of the opening is smaller than the wide part P W At least one dimension D2 is parallel to dimension D1 across the opening.

[0094] exist FIG. 4A to FIG. 4E In any of the examples shown, it will be appreciated that the adhesive 28 will fill the entire recess 16'. The wide portion P of these examples of the recess 16' W The surface area of ​​the patterned substrate 10 available for bonding is increased. W The overhang and / or the angled or curved walls also form a cavity that can effectively capture adhesive 28 within the recessed portion 16 ′.

[0095] exist 4A to 4D In the example shown, the narrow portion P N having a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube and a cuboid; the wide portion P W A geometric shape having a shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a cuboid, a lanceolate, a sphere, a polygonal prism and a cone.

[0096] In each of these examples, the patterned substrate 10 includes a layer 18, at least one additional layer 38 located below the layer 18, and a base support 36 located below the at least one additional layer 38; and for each second recessed portion 16', the narrow portion P N Defined in layer 18 and passing through the layer; wide portion P W The base support member 36 defines a wide portion P W Additional layer 38 may be any material described herein for layer 18, or may be any passivation layer described herein. Base support 36 may be any of the examples described herein.

[0097] exist Figure 4A In the example shown, the narrow portion P N having a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube and a cuboid; the wide portion P W An example of this type of recess 16' is Figure 5 It is shown as having a cylindrical narrow portion P N and conical wide part P W .

[0098] when Figure 4A The narrow portion P of the example shown in N When is a cylinder or elliptical cylinder, the dimension D1 across the opening is the diameter, which can be any of the dimensions described herein for the recessed portion geometry. Figure 4A The narrow portion P of the example shown in N When the concave portion is a cube or a cuboid, the dimension D1 across the opening is the width or height of the cube or cuboid, which may be equivalent to any dimension described herein for the concave portion geometry. N The depth will depend on the narrow portion P formed by N The thickness of layer 18 is .

[0099] exist Figure 4A and Figure 5 In the example shown, the narrow portion P N The wide portion P that opens to define the concave portion 16' WThe conical geometry of the cone. The narrow part P of the conical geometry parallel to dimension D1 N The size D2 of the opening increases along the width P W The depth of increases moving from layer 18 toward base support 36. The dimension D2 at any point along the cone geometry may be in the range of about 10 nm to about 10 μm.

[0100] exist Figure 4A In the example geometry of , the angled walls defined in layer 38 increase the bonding surface area and also create a cavity for adhesive 28.

[0101] exist Figure 4B In the example shown, the narrow portion P N has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube and a cuboid; and the wide portion P W It also has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube and a cuboid. An example of this type of recess 16 'is Figure 6 The narrow portion P is shown as having a cubic shape. N and the wide part P of the rectangular parallelepiped (or rectangular prism) shape W .

[0102] when Figure 4B The narrow portion P of the example shown in N When is a cylinder or elliptical cylinder, the dimension D1 across the opening is the diameter, which can be any dimension described herein for the recessed portion geometry (eg, diameter, length, etc.). Figure 4B The narrow portion P of the example shown in N When the concave portion is a cube or a cuboid, the dimension D1 across the opening is the width or height of the cube or cuboid, which may be equivalent to any dimension described herein for the concave portion geometry. N The depth will depend on the narrow portion P formed by N The thickness of layer 18 is .

[0103] exist Figure 4B and Figure 6 In the example shown, the narrow portion P N The wide portion P that opens to define the concave portion 16' W The narrow part P of the cylinder, elliptical cylinder, cube or rectangular parallelepiped geometry parallel to dimension D1 N The dimension D2 of the opening along the wide portion P WThe depth of is the same moving from layer 18 toward base support 36. The dimension D2 at any point along the cylindrical, ellipsoidal cylindrical, cubic, or cuboid geometry may be in the range of about 10 nm to about 10 μm.

[0104] exist Figure 4B In the example geometry of W This increases the bonding surface area and also creates a cavity for the adhesive 28.

[0105] exist Figure 4C In the example shown, the narrow portion P N has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube and a cuboid; and the wide portion P W It also has a geometric shape selected from the group consisting of a sphere or a lanceolate. Figure 4C The overall geometry of the recessed portion 16' shown resembles an inverted light bulb. An example of this type of recessed portion 16' is shown in FIG. Figure 7 The narrow portion P is shown as having a cylindrical shape. N and the lanceolate width P W .

[0106] when Figure 4C The narrow portion P of the example shown in N When is a cylinder or elliptical cylinder, the dimension D1 across the opening is the diameter, which can be any of the dimensions described herein for the recessed portion geometry. Figure 4C The narrow portion P of the example shown in N When the concave portion is a cube or a cuboid, the dimension D1 across the opening is the width or height of the cube or cuboid, which may be equivalent to any dimension described herein for the concave portion geometry. N The depth will depend on the narrow portion P formed by N The thickness of layer 18 is .

[0107] exist Figure 4C and Figure 7 In the example shown, the narrow portion P N The wide portion P that opens to define the concave portion 16' W The narrow part P of the spherical or lanceolate geometry parallel to dimension D1 N The size D2 of the opening increases along the width P WThe depth of the concave portion 16' varies as the depth moves from the layer 18 toward the base support 36. Specifically, the dimension D2 gradually increases and then gradually decreases from the layer 18 toward the base support 36. The dimension D2 at any point along the sphere or lanceolate geometry can be in the range of about 10 nm to about 10 μm. In this example, the sphere or lanceolate extends through the depth of the layer 38 so that the underlying base support 36 forms the bottom surface of the recess 16'.

[0108] exist Figure 4C In the example geometry of , the curved walls defined in layer 38 increase the bonding surface area and also create a cavity for adhesive 28.

[0109] exist Figure 4D In the example shown, the narrow portion P N has a conical geometry; and the wide portion P W It also has a lanceolate geometry. Figure 4D The overall geometry of the recessed portion 16 ′ shown resembles a teardrop or raindrop.

[0110] Figure 4D The narrow part P N The dimension D1 across the opening can be any diameter described herein for the cylindrical recess 16, 16'. In one example, Figure 4D The narrow part P N The size D1 of the opening is in the range of about 10 nm to about 10 μm. N The depth will depend on the narrow portion P formed by N The thickness of layer 18. In this example, the narrow portion P N The size increases as the width increases from the opening to the wide part P W Increase by moving.

[0111] exist Figure 4D In the example shown, the narrow portion P N The wide portion P that opens to define the concave portion 16' W The narrow part P of the lanceolate body parallel to dimension D1 N The size D2 of the opening increases along the width P W The depth of the lanceolate geometry varies as one moves from layer 18 toward base support 36. Specifically, dimension D2 gradually increases and then gradually decreases from layer 18 toward base support 36. Dimension D2 at any point along the lanceolate geometry may be in the range of about 10 nm to about 10 μm. In this example, the lanceolate partially extends through the depth of layer 38 so that the underlying base support 36 is not exposed. In other examples, the underlying base support 36 may form the bottom surface of the lanceolate portion of the recess 16'.

[0112] exist Figure 4D In the example geometry of , the curved walls defined in layers 18 and 38 increase the bonding surface area and also create a cavity for adhesive 28.

[0113] exist Figure 4E In the example shown, the recess 16' is defined in the layer 18 located above the base support 36. This geometry can also be defined in a single layer substrate or in the outermost passivation layer of a CMOS device. In this example, the recess 16' has a concave surface geometry in which the interior is wider than the surface entrance (opening), but does not include a separate narrow portion P having a depth extending through the layer 18. N , as referenced 4A to 4D In contrast, the narrow portion P N Enter the wide part P W This geometry resembles an onion underground.

[0114] Figure 4E The dimension D1 of the cross-opening in the can be any diameter described herein for the cylindrical recessed portion 16, 16'. The opening opens directly into the wide portion P defining the recessed portion 16'. W The dimension D2 of the spherical geometry parallel to the dimension D1 across the opening increases along the width P W The depth of the sphere 16' changes as one moves from layer 18 toward base support 36. Specifically, dimension D2 gradually increases and then gradually decreases from the opening toward base support 36. Dimension D2 at any point along the sphere geometry may be in the range of about 10 nm to about 10 μm. In this example, the sphere partially extends through the depth of layer 18 so that the underlying base support 36 (or other layers) are not exposed. In other examples, the underlying base support 36 may form the bottom surface of the spherical recess 16'.

[0115] exist Figure 4E In the example geometry of , the curved walls defined in layer 18 increase the bonding surface area and also create cavities for adhesive 28 .

[0116] like FIG. 4A to FIG. 4E as well as Figure 5 , Figure 6 and Figure 7 As shown, the gap region 26' in these examples is defined by the surface of the layer 18 that at least partially defines the recessed portion 16'. Thus, the gap region 26' is a portion of a continuous surface except where an opening to the respective recessed portion 16' is defined.

[0117] It should be understood that FIG. 4A to FIG. 4E Any of the geometric shapes of the recessed portion 16' shown in the figure may be used according to the present invention for reference Figure 2AThe recesses 16 , 16 ′ described may be positioned in the bonding area 14 in any of the arrangements described.

[0118] As reference 4A to 4D As mentioned, at least one additional layer 38 is located below layer 18, and at least a portion of recess 16' may be defined in at least one additional layer 38. In some examples, two or more additional layers 38 may be included. In a specific example, 2 to 10 additional layers may be included. Figure 4F and Figure 4G An example of a recess 16 ′ that may be formed in the stack of layers 18 , 38 is shown in . Figure 4F The example in depicts a cross section of a cone geometry (with stepped sidewalls instead of smooth sidewalls), and Figure 4G The example in depicts a cross-section of a cylindrical geometry (having two different diameters D1 , D2 along the depth, as opposed to having a single diameter along the depth).

[0119] exist Figure 4F In the example shown, the patterned substrate 10 includes a layer 18, a plurality of additional layers 38A-38D positioned below the layer 18, and a base support 36 positioned below the plurality of additional layers 38A-38D. In this example, the etching rate of the layer 18 and each additional layer 38A-38D increases as one moves from the layer 18 toward the base support 36. Thus, the etching rates of the layers 18-38D are as follows: 18<38A<38B<38C<38D. In this example, the base support 36 is not etchable and therefore acts as an etch stop after etching the layer 38D adjacent to the base support 36. Because the etching rates of the layers 18, 38A-38D are different, the slope of the recessed portion wall can be adjusted by changing the etching conditions for each layer. Figure 4F In the example shown, the geometry of the recess 16 ′ increases as one moves from the opening defined in the layer 18 toward the base support 36 .

[0120] exist Figure 4G In the example shown, patterned substrate 10 includes layer 18, a plurality of additional layers 38A-38E below layer 18, and base support 36 below the plurality of additional layers 38A-38E. In this example, layer 18 has a first etch rate, and the etch rate of each additional layer 38A-38E alternates between a second etch rate and the first etch rate as one moves from layer 18 toward base support 36. Figure 4G In the example shown, the first etch rate is less than the second etch rate. Therefore, the etch rate of layer 18-38E is as follows: 18 = 38B = 38D < 38A = 38C = 38E. In this example, base support 36 is not etchable and therefore acts as an etch stop after etching layer 38E adjacent to base support 36. Figure 4G In the example shown, the geometry of recess 16' varies between first dimension D1 and second dimension D2 as one moves from the opening defined in layer 18 toward base support 36. In this example, the varying dimensions create increased surface area for adhesive 28 to grip the sidewalls of recess 16'.

[0121] In the example of using different layers 18, 38 with different etch rates in the active regions 12, 12', it will be appreciated that the etch that forms the recessed portion 16 can be controlled so that a desired geometry is formed throughout the layers 18, 38. For example, to form a cylindrical geometry (e.g., Figure 4F ), the etching conditions for layers with lower etching rates (eg, 18, 38A, 38B) may involve longer etching times than for layers with higher etching rates (eg, 38C, 38D).

[0122] In another example in which the geometry of each first recess 16 is different from the geometry of each second recess 16', the geometry of each first recess 16 is selected from the group consisting of a cylinder, an elliptical cylinder, a sphere, a cube, a cuboid, a cone, a lanceolate, a polygonal prism, and combinations thereof; the geometry of each second recess 16' is selected from the group consisting of an inclined cylinder, an inclined elliptical cylinder, an inclined cube, an inclined cuboid, and an inclined polygonal prism; and the geometry of each second recess 16' has a central axis that is at a non-ninety-degree angle relative to a plane at the bottom of the second recess 16'. In this example, the previously described cylinders, elliptical cylinders, cubes, cuboids, and polygonal prisms (including their respective sizes) can be used, except that they are inclined relative to the plane on which they are formed. In addition, it should be understood that with reference to 4A to 4D Each of the example geometries of the described second recessed portion 16 ′ may be angled such that the central axis is at a non-ninety degree angle relative to a plane at the bottom of the second recessed portion 16 ′.

[0123] Figure 8 An example of a cross section of an inclined cylindrical recess 16 ′ in a bonding area 14 is shown in FIG.

[0124] In this example, the dimension D of the opening across each inclined cylindrical recess 16' can be any diameter described herein for cylindrical recesses 16, 16'. Similar to cylindrical recesses 16, 16', this dimension is consistent along the depth of each inclined cylinder; however, unlike cylindrical recesses 16, 16', the central axis is not at a 90° angle relative to the bottom of the recess 16'. Figure 8As shown, some of the recesses 16' in the bonding area 14 are inclined in a first direction, and some other recesses 16' in the bonding area 14 are inclined in a second direction. As depicted, the recesses 16' inclined in the first direction have a central axis A1 at an angle θ1 ranging from about 35° to about 85°, and the recesses 16' inclined in the second direction have a central axis A2 at an angle θ2 ranging from about 95° to about 145°. In other examples, all of the inclined cylindrical recesses 16' in the bonding area 14 can be inclined in the same direction.

[0125] exist Figure 8 In the example shown, the recess 16' is defined in, for example, a layer 18, 38 of a CMOS device. It should be understood that the inclined cylindrical geometry may also be defined in a layer 18 directly above the base support 36, or in a single layer substrate, or in a stack including multiple additional layers 38A, 38B, etc.

[0126] Reference now 9A to 9C , yet another example of a recess 16' in a bonding area 14 may include a feature 44 that overhangs the recess 16' and provides an additional surface for adhesive 28 to bond. In this example, the patterned surface 10 also includes a plurality of features 44, wherein each feature 44 extends over a portion of a corresponding one of the second recesses 16' and is supported by a second gap region 26' surrounding a corresponding one of the second recesses 16', wherein adhesive 28 is wrapped around each feature 44 (e.g., Fig. 9B and Fig. 9C shown).

[0127] like Fig.9A As shown in the top view in FIG. 1 , the bonding area 14 includes a recessed portion 16', which is cylindrical or elliptical cylindrical in this example, and a feature 44 is suspended above a portion of each recessed portion 16'. The gap area 26' around each recessed portion 16' provides support for each feature 44. The geometry of each feature 44 is such that it does not cover the recessed portion opening and does not extend into the entire depth of the recessed portion 16'. Therefore, each feature 44 only partially covers the recessed portion opening (thereby allowing the adhesive 28 to enter the recessed portion 16') and only partially extends into the depth of the recessed portion 16' (thereby allowing the adhesive 28 to reach the bottom of each recessed portion 16' and wrap around the bottom of the feature 44). In the example shown, the feature 44 is a beam having a diameter less than the diameter of the recessed portion 16' and having a circular portion that partially extends into the depth of the recessed portion 16'.

[0128] exist 9A to 9CIn the example shown, the recess 16' is defined in the layer 18 above the base support 36, and the feature 44 is supported by the layer 18. However, it should be understood that the feature 44 may be integrated into a cylindrical or elliptical cylindrical recess 16' formed in the layers 18, 38 of the CMOS device or in a single layer substrate.

[0129] In other examples, the feature 44 is formed in the layers 18, 38. In these examples, the layers 18, 38 are continuous except where the second recessed portion 16' is formed.

[0130] In each example of patterned structure 10 including recessed portions 16 ′ in bonding area 14 , it should be understood that adhesive 28 fills recessed portions 16 ′ and is present over interstitial regions 26 ′ in bonding area 14 .

[0131] Reference now Figure 2B Another example of active area 12 ′ and bonding area 14 ′ includes posts 34 , 34 ′.

[0132] In some examples (such as Figure 2B ), each first column 34 and each second column 34' have the same geometric shape. In other words, in these examples, all columns 34, 34' have the same geometric shape. In these examples, the geometric shape of the columns 34, 34' is selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a cuboid, a cone, a polygonal prism, and combinations thereof. Fig. 10A A perspective view of the cylindrical columns 34, 34' is shown in FIG. Fig. 10B A perspective view of an elliptical cylindrical column 34, 34' is shown in FIG. Figures 11 to 14B Other post 34, 34' geometries are shown and described.

[0133] Each post 34, 34' is a three-dimensional structure extending outward from the surface of layer 18 (or other layers, such as layer 38, or base support 36). Thus, posts 34, 34' are raised areas relative to gap areas 26, 26' of layer 18 or 38 or base support 36, respectively, surrounding posts 34, 34'.

[0134] The layout or pattern of the posts 34 in the active area 12 can be the same or different from the layout or pattern of the posts 34' in the bonding area 14. The corresponding layout can be a regular, repeated or irregular pattern. In one example, the posts 34, 34' in the active area 12 and the bonding area 14 are arranged in a hexagonal grid to closely pack and improve density. Other layouts may include, for example, rectangular layouts, triangular layouts, etc. In some examples, the layout or pattern can be an xy format of posts 34 or 34' in the form of rows and columns, and separated by gap areas 26 or 26'. Posts 34 or 34' can be arranged in other patterns, such as stripes, swirls, lines, triangles, rectangles, circles, arcs, checkered patterns, diagonal lines, arrows and / or squares.

[0135] The layout or pattern of the pillars 34 or 34' can be characterized relative to the density (e.g., the number of pillars 34, 34') of the corresponding pillars 34, 34' in the active area 12' and the bonding area 14'. For example, the pillars 34 and / or 34' can be approximately 2 million / mm 2 The density can be adjusted to different densities, including, for example, about 100 / mm 2 , about 1,000 pieces / mm 2 , about 100,000 / mm 2 , about 1 million pieces / mm 2 , about 2 million pieces / mm 2 , about 5 million pieces / mm 2 , about 10 million / mm 2 , about 50 million / mm 2 Or a greater or lesser density. It should also be understood that the density of the columns 34 or 34' may be between a value selected from the lower limit value and a value selected from the upper limit value of the above range. For example, a high-density array may be characterized as having columns 34 or 34' spaced less than about 100 nm, a medium-density array may be characterized as having columns 34 or 34' spaced from about 400 nm to about 1 μm, and a low-density array may be characterized as having columns 34 or 34' spaced greater than about 1 μm. Although exemplary densities have been provided, it should be understood that any suitable density may be used. In some cases, it may be desirable that the spacing between the columns 34 or 34' is even greater than the examples listed herein.

[0136] The layout or pattern of the posts 34 or 34' may also be characterized based on or alternatively based on the average pitch or spacing (center-to-center spacing) from the center of one post 34 or 34' to the center of an adjacent post 34 or 34' or the average pitch or spacing (edge-to-edge spacing) from the left edge of a post 34 or 34' to the right edge of an adjacent recess 34 or 34'. The pattern may be regular so that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, about 100 μm, or more or less. The average pitch of a particular pattern of posts 34 or 34' may be between a value selected from the lower limit value and a value selected from the upper limit value of the above range. Although exemplary average pitch values ​​have been provided, it should be understood that other average pitch values ​​may be used.

[0137] The size of each post 34 or 34' can be characterized by its top surface area, height and / or diameter (if circular or elliptical), or length and width. The surface area of ​​the top surface of the post 34 or 34' can be about 1×10 -3 μm 2 to about 100 μm 2 In the range of, for example, about 1×10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , at least about 10 μm 2 , or larger, or smaller. The height of the pillar 34 or 34' may be in the range of about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or larger, or smaller. For another example, each of the diameter or length and width of the pillar 34 or 34' may be in the range of about 10 nm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or larger, or smaller.

[0138] In other examples, the geometry of each first post 34 is different from the geometry of each second post 34'. In other words, in these other examples, all posts 34 in active area 12 have one type of geometry, and all posts 34' in bonding area 14 have a different type of geometry. In these examples, the geometry of posts 34 in active area 12' is selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a cuboid, a cone, and a polygonal prism, and the geometry of posts 34 in bonding area 14' is a different geometry selected from the same group.

[0139] In one example, the geometry of each first post 34 is cylindrical, and the geometry of each second post 34' is an elliptical cylinder. In another example, the geometry of each first post 34 is an elliptical cylinder, and the geometry of each second post 34' is a cylinder. Any layout, size and / or other characteristics of these geometries can be used.

[0140] Fig.11 and Fig.12 Other examples of suitable geometries of the posts 34' in the bonding region 14' are shown in FIG. In these examples, the geometry of each second post 34' includes a plurality of second posts extending outwardly to a wide portion P. W2 The narrow part P N2 ; and for each of these second columns 34 'geometry, across the narrow portion P N2 The size D3 of the base is smaller than the width P W2 At least one dimension D4 is parallel to dimension D3 across the base.

[0141] exist Fig.11 and Fig.12 In the example shown, it will be appreciated that adhesive 28 will fill the space covering gap region 26' and surrounding post 34' and will extend over post 34' (similar to Figure 2B The adhesive 28 shown). The wide portion P of these examples of the column 34' W2 The surface area of ​​the patterned substrate 10' available for bonding in the bonding region 14' is increased.

[0142] exist Fig.11 and Fig.12 In the example shown, the narrow portion P N2 having a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a cuboid, and a cone; and the wide portion P W2 A geometric shape having a shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, and a cuboid.

[0143] In each of these examples, the patterned substrate 10 includes a layer 18, at least one additional layer 38 below the layer 18, and a base support 36 below the at least one additional layer 38; and for each second pillar 34' geometry: the wide portion P W2 is defined in layer 18; and the narrow portion P N2 Defined in at least one additional layer 38. The two (or more) layers 18, 38 may be supported by a base support 36. These additional layers 38 may be any material described herein for layer 18, or may be any passivation layer described herein.

[0144] exist Fig.11 In the example shown, the wide portion PW2 It has a cylindrical shape, and the narrow part P N2 It has a conical shape. Define the wide part P W2 The dimension D4 of the cylinder may be any diameter described herein for the cylindrical or elliptical cylindrical recess 16, 16'. N2 The maximum size and width of the part P W2 adjacent, and the dimensions of the cone decrease along the height of the column 34' from the layer 18 toward the base support 36. Thus, the smallest dimension D3 of the column 34' is located at the bottom of the cone geometry and is smaller than dimension D4. Fig.11 The height of the posts 34' shown in FIG. 5 can be any of the dimensions described herein for the depths of the recesses 16, 16'.

[0145] exist Fig.12 In the example shown, the wide portion P W2 and the narrow part P N2 Both have corresponding rectangular parallelepiped geometry, but the wide part P W2 It can also be a cube or an elliptical cylinder, and the narrow part P N2 It can also be a cylinder, an elliptical cylinder or a cube. Define the width P W2 The dimension D4 of the rectangular parallelepiped (or other geometric shape) can be any dimension described herein for the concave portion geometry. N2 The dimension D3 of the cuboid (or other geometric shape) is smaller than the dimension D4. Fig.12 The height of the posts 34' shown in FIG. 5 can be any of the dimensions described herein for the depths of the recesses 16, 16'.

[0146] In another example in which the geometry of each first column 34 is different from the geometry of each second column portion 34', the geometry of each first column 34 is selected from the group consisting of a cylinder, an elliptical cylinder, a sphere, a cube, a cuboid, a cone, a lanceolate, a polygonal prism, and combinations thereof; the geometry of each second column 34' is selected from the group consisting of an inclined cylinder, an inclined elliptical cylinder, an inclined cube, an inclined cuboid, and an inclined polygonal prism; and each second column 34' has a central axis that is at an angle other than ninety degrees relative to a plane at the bottom of the second column 34'. Fig.13 A perspective view of the inclined cylindrical column 34' is shown in FIG.

[0147] In this example, the dimension D across the top surface of the inclined cylindrical recess 34' can be any diameter described herein for the cylindrical posts 16, 16'. Similar to the cylindrical recesses 16, 16', this dimension is consistent along the height of each inclined cylindrical post 34'; but unlike the cylindrical recesses 16, 16', the central axis A of the post 34' is not at a 90° angle relative to the plane on which the post 34' is formed. In one example, the central axis A is at an angle θ ranging from about 35° to about 85° or from about 95° to about 145° relative to the plane on which the post 34' is formed.

[0148] When the bonding area 14' includes a plurality of inclined cylindrical posts 34' (or other inclined geometries), the posts 34' may be inclined in the same direction, or some posts 34' may be inclined in a first direction and some other posts 34' may be inclined in a second direction (similar to Figure 8 The inclined cylindrical recess shown in FIG.

[0149] exist Fig.13 In the example shown, the pillars 34' are defined in the layer 18 above the base support 36. Alternatively, the pillars 34' may be formed in a stack of layers 18, 38 (eg, a stack of CMOS devices) or in a single layer substrate.

[0150] As reference Fig.11 and Fig.12 As mentioned, at least one additional layer 38 is located below layer 18, and at least a portion of pillars 34' can be defined in at least one additional layer 38. In some examples, two or more additional layers 38 can be included. In a specific example, 2 to 10 additional layers can be included. Fig.14A and Fig. 14B An example of a pillar 34 ′ that may be formed in the stack of layers 18 , 38 is shown in . Fig.14A The example in depicts a cross section of a cone geometry (an inverted cone with stepped sidewalls instead of smooth sidewalls), and Fig. 14B The example in depicts a cross-section of a cylindrical geometry (having two different diameters along the depth, as opposed to having a single diameter along the depth).

[0151] exist Fig.14AIn the example shown, the patterned substrate 10 includes a layer 18, a plurality of additional layers 38A-38C located below the layer 18, and a base support 36 located below the plurality of additional layers 38A-38C. In this example, the etching rate of the layer 18 and each additional layer 38A-38C increases as one moves from the layer 18 toward the base support 36. Thus, the etching rates of the layers 18-38C are as follows: 18<38A<38B<38C. In this example, the base support 36 is not etchable and therefore acts as an etching stop after etching the layer 38C adjacent to the base support 36. Because the etching rates of the layers 18, 38A-38C are different, the slope of the pillar wall can be adjusted by changing the etching conditions for each layer. Fig.14A In the example shown, the geometry of the posts 34 ′ decreases from the layer 18 toward the base support 36 .

[0152] exist Fig. 14B In the example shown, patterned substrate 10 includes layer 18, a plurality of additional layers 38A-38C below layer 18, and base support 36 below the plurality of additional layers 38A-38C. In this example, layer 18 has a first etch rate, and the etch rate of each additional layer 38A-38C alternates between a second etch rate and the first etch rate as one moves from layer 18 toward base support 36. Fig. 14B In the example shown, the first etch rate is less than the second etch rate. Therefore, the etch rate of layer 18-38C is as follows: 18 = 38B < 38A = 38C. In this example, base support 36 is not etchable and therefore acts as an etch stop after etching layer 38C adjacent to base support 36. Fig. 14B In the example shown, the geometry of 34 ′ varies between a first dimension D1 and a second dimension D2 as one moves from the layer 18 toward the base support 36 .

[0153] Although in Fig.11 , Fig.12 and Fig.13 A single column 34' is shown in each of Fig.14A and Fig. 14B Two posts 34' are shown in FIG. 1 , but it should be understood that an array of posts 34' may be formed in the bonding area 14'. Figures 11 to 13 In the example geometry of , the angled wall or overhang 42 created by the post 34' increases the bonding surface area of ​​the adhesive 28. Fig.14A and Fig. 14B In the example geometry of FIG. 3 , the different dimensions increase the surface area for adhesive 28 to grip the sidewalls of post 34 ′.

[0154] In any examples disclosed herein that include one or more additional layers 38 between layer 18 and base support 36, the recess 16 or column 34 within active area 12, 12' may be defined solely in the outermost layer 18, or in the outermost layer 18 and any number of additional layers 38, depending on the desired depth of the recess 16 or the desired height of the column 34.

[0155] More generally refer to FIG. 2A to FIG. 2D Each example of the flow cell 20A, 20B, 20C, 20D includes a surface chemistry in the recess 16 in the active area 12, 12' or on the pillar 34. The surface chemistry includes a polymer hydrogel 22 and primers 24A, 24B.

[0156] The polymer hydrogel 22 can be any gel material that swells when absorbing liquid and shrinks when the liquid is removed, such as by drying. In one example, the polymer hydrogel 22 includes an acrylamide copolymer. Some examples of acrylamide copolymers are represented by the following structure (I):

[0157]

[0158] in:

[0159] R A is selected from the group consisting of azido, optionally substituted amino, optionally substituted alkenyl, optionally substituted alkyne, halogen, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxyl, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol;

[0160] R B is H or optionally substituted alkyl;

[0161] R C , R D and R E are each independently selected from H and optionally substituted alkyl;

[0162] -(CH2) p - each of which may be optionally substituted;

[0163] p is an integer ranging from 1 to 50;

[0164] n is an integer in the range of 1 to 50,000; and

[0165] m is an integer in the range of 1 to 100,000.

[0166] A specific example of the acrylamide copolymer represented by structure (I) is poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide) (PAZAM).

[0167] One of ordinary skill in the art will recognize that the arrangement of recurring "n" and "m" features in structure (I) is representative and that the monomer subunits may be present in the polymer structure in any order (e.g., random, block, patterned, or a combination thereof).

[0168] The molecular weight of the acrylamide copolymer may be in the range of about 5 kDa to about 1500 kDa, or about 10 kDa to about 1000 kDa, or in one specific example may be about 312 kDa.

[0169] In some examples, the acrylamide copolymer is a linear polymer. In some other examples, the acrylamide copolymer is a lightly cross-linked polymer.

[0170] In other examples, the gel material can be a variation of structure (I). In one example, the acrylamide unit can be N,N-dimethylacrylamide. In this example, the acrylamide unit in structure (I) can be replaced by Replace, where R D , R E and R F are each H or C1-C6 alkyl, and R G and R H Each is a C1-C6 alkyl group (rather than H, as in the case of acrylamide). In this example, q can be an integer in the range of 1 to 100,000. In another example, in addition to the acrylamide units, N,N-dimethylacrylamide can also be used. In this example, in addition to the recurring "n" and "m" features, structure (I) can also include Where R D , R E and R F are each H or C1-C6 alkyl, and R G and R H Each is a C1-C6 alkyl group. In this example, q may be an integer in the range of 1 to 100,000.

[0171] As another example of a polymer hydrogel 22, the recurring "n" feature in structure (I) may be replaced with a monomer comprising a heterocyclic azido group having structure (II):

[0172]

[0173] Wherein R1 is H or C1-C6 alkyl; R 2is H or C1-C6 alkyl; L is a linker including a straight chain having 2 to 20 atoms selected from carbon, oxygen and nitrogen and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a straight chain including 1 to 4 atoms selected from carbon, oxygen and nitrogen and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N-substituted amide having H or C1-C4 alkyl attached to N; and Z is a nitrogen-containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl or pyrimidinyl.

[0174] As yet another example, the gel material may include repeating units of each of structures (III) and (IV):

[0175] as well as Where R 1a , R 2a , R 1b and R 2b Each of R is independently selected from hydrogen, optionally substituted alkyl or optionally substituted phenyl; 3a and R 3b Each of L is independently selected from hydrogen, optionally substituted alkyl, optionally substituted phenyl or optionally substituted C7-C14 aralkyl; and each L 1 and L 2 are independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.

[0176] In yet another example, acrylamide copolymers are formed using nitroxide-mediated polymerization, and thus at least some of the copolymer chains have alkoxyamine end groups. In the copolymer chain, the term "alkoxyamine end group" refers to a dormant species -ONR1R2, wherein each of R1 and R2 may be the same or different and may independently be a linear or branched alkyl or cyclic structure, and wherein the oxygen atom is attached to the remainder of the copolymer chain. In some examples, alkoxyamines may also be introduced into some of the recurring acrylamide monomers, such as at position R of structure (I). A Thus, in one example, structure (I) includes alkoxyamine terminal groups; and in another example, structure (I) includes alkoxyamine terminal groups and alkoxyamine groups in at least some of the side chains.

[0177] It should be understood that other molecules can be used to form the polymer hydrogel 22, as long as they can be functionalized by the desired chemical substance (e.g., a single primer set). Some examples of suitable materials for the polymer hydrogel 22 include functionalized silanes, such as norbornene silanes, azidosilanes, alkyne functionalized silanes, amine functionalized silanes, maleimide silanes, or any other silanes with functional groups that can be connected to the desired chemical components, respectively. Other examples of suitable materials for the polymer hydrogel 22 include those with colloidal structures, such as agarose; or those with polymer mesh structures, such as gelatin; or those with cross-linked polymer structures, such as polyacrylamide polymers and copolymers, acrylamide (SFA) or SFA azidized versions. Examples of suitable polyacrylamide polymers can be synthesized by acrylamide and acrylic acid or acrylic acid containing vinyl groups, or by monomers that form [2+2] photocycloaddition reactions. Still other examples of suitable materials for the polymer hydrogel 22 include mixed copolymers of acrylamide and acrylates. A variety of polymer architectures containing acrylic monomers (e.g., acrylamide, acrylate, etc.) can be used in the examples disclosed herein, such as branched polymers, including dendritic polymers (e.g., multi-arm polymers or star polymers), star or star-shaped block polymers, etc. For example, monomers (e.g., acrylamide, acrylamide containing catalyst, etc.) can be incorporated randomly or in blocks into the branches (arms) of the dendritic polymer.

[0178] The gel material of the polymer hydrogel 22 may be formed using any suitable copolymerization method, such as nitroxide-mediated polymerization (NMP), reversible addition-fragmentation chain transfer (RAFT) polymerization, and the like.

[0179] Attachment of the polymer hydrogel 22 to the underlying layer 18 may be by covalent bonding. In some cases, the underlying layer 18 may first be activated, for example, by silanization or plasma ashing. Covalent attachment helps maintain the primers in the desired region during various uses throughout the life of the flow cell.

[0180] Primers 24A and 24B constitute a primer set for sequential paired-end sequencing. In sequential paired-end sequencing, the generated corresponding forward strands are sequenced and removed, and then the generated corresponding reverse strands are sequenced and removed.

[0181] As an example, the primer set may include a P5 primer and a P7 primer, a P15 primer and a P7 primer, or any combination of PA primers, PB primers, PC primers, and PD primers described herein. As an exemplary combination, the primer set may include any two PA, PB, PC, or PD primers, or any combination of a PA primer and a PB, PC, or PD primer, or any combination of a PB primer and a PC or PD primer, or any combination of a PC primer and a PD primer.

[0182] Examples of P5 and P7 primers are used on the surface of commercial flow cells sold by Illumina Inc., for example in HISEQ TM HISEQX TM MISEQ TM MISEQDX TM MINISEQ TM 、NEXTSEQ TM 、NEXTSEQDX TM 、NOVASEQ TM 、ISEQ TM 、GENOME ANALYZER TM and other instrument platforms.

[0183] The P5 primers are:

[0184] P5:5'→3'

[0185] AATGATACGGCGACCACCGAGAUCTACAC(SEQ.ID.NO.1)

[0186] The P7 primer can be any of the following:

[0187] P7#1: 5' → 3'

[0188] CAAGCAGAAGACGGCATACGAnAT(SEQ.ID.NO.2)

[0189] P7#2: 5' → 3'

[0190] CAAGCAGAAGACGGCATACnAGAT(SEQ.ID.NO.3)

[0191] P7#3: 5' → 3'

[0192] CAAGCAGAAGACGGCATACnAnAT(SEQ.ID.NO.4)

[0193] wherein "n" is 8-oxoguanine in each of these sequences.

[0194] The P15 primers are:

[0195] P15:5'→3'

[0196] AATGATACGGCGACCACCGAGAnCTACAC(SEQ.ID.NO.5)

[0197] wherein "n" is allyl-T (a thymine nucleotide analogue having an allyl functional group).

[0198] The above other primers (PA-PD) include:

[0199] PA 5'→3'

[0200] GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG(SEQ.ID.NO.6)

[0201] cPA(PA')5'→3'CTCAACGGATTAACGAAGCGTTCGGACGTGCCAGC(SEQ.ID.NO.7)

[0202] PB 5'→3'

[0203] CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT(SEQ.ID.NO.8)

[0204] cPB(PB')5'→3'AGTTCATATCCACCGAAGCGCCATGGCAGACGACG(SEQ.ID.NO.9)

[0205] PC 5'→3'

[0206] ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT(SEQ.ID.NO.10)

[0207] cPC(PC')5'→3'

[0208] AGTTGCGGATTCGACGCGTTGATATTAGCGGCCGT(SEQ.ID.NO.11)

[0209] PD 5'→3'

[0210] GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC(SEQ.ID.NO.12)

[0211] cPD(PD')5'→3'

[0212] GCTGCATCGAATAGTCCGGCTAACGTAACGCGGC (SEQ. ID. NO. 13).

[0213] Although not shown in the exemplary sequence of PA-PD, it should be understood that any of these primers may include a cleavage site at any point in the chain, such as uracil, 8-oxoguanine, allyl-T, etc., as long as the cleavage sites of primers 24A and 24B are orthogonal (i.e., the cleavage chemistry of primer 24A is different from the cleavage chemistry of primer 24B, and therefore the two primers 24A, 24B are sensitive to different cleavage agents).

[0214] Each of the primers 24A and 24B disclosed herein may also include a polyT sequence at the 5' end of the primer sequence. In some examples, the polyT region includes 2 to 20 T bases. As specific examples, the polyT region may include 3, 4, 5, 6, 7 or 10 T bases.

[0215] The 5' end of the primers 24A, 24B will vary depending on the chemical nature of the polymer hydrogel 22. As two examples, the 5' terminal functional group can be a terminal alkyne (e.g., a hexynyl group) or an internal alkyne, where the alkyne is part of a cyclic compound (e.g., bicyclo[6.1.0]nonyne (BCN)). The terminal alkyne can be attached to an azide group on the polymer hydrogel 22. In another example, the primers 24A, 24B can include an alkene at the 5' end that can react with a reactive thiol group on the polymer hydrogel 22. In yet other specific examples, a succinimide (NHS) ester-terminated primer can react with an amine group on the polymer hydrogel 22, an aldehyde-terminated primer can react with a hydrazine group on the polymer hydrogel 22, an azide-terminated primer can react with an alkyne or DBCO (dibenzocyclooctyne) on the polymer hydrogel 22, or an amino-terminated primer can react with an activated carboxylate group on the polymer hydrogel 22.

[0216] Each example of the flow cell 20A, 20B, 20C, 20D also includes an adhesive 28 in the bonding area 14, 14'. Examples of suitable adhesives 28 include pressure sensitive adhesives and reaction hardening adhesives.

[0217] Examples of pressure sensitive adhesives include the following amorphous polymer chemistries: natural rubber (polyisoprene), styrene block copolymers (such as styrene-isoprene block copolymers (SIS) or styrene-butadiene-styrene block copolymers (SBS)), styrene-butadiene random copolymers, polybutadiene, polyisobutylene, acrylic acid, silicone, polyvinyl ethers, or thermoplastic elastomers. These formulations may include tackifiers, plasticizers, or cross-linking additives to impart stereoregularity to the adhesive. The amorphous polymer film in the pressure sensitive adhesive may be unsupported (commonly referred to as a "transfer tape") or supported by a carrier film such as polyester, polyurethane, polyethylene, polypropylene, nonwoven fibers, or metal foil. When a carrier film is used, the pressure sensitive adhesive may be coated on one side of the carrier film (single coating) or on both sides of the carrier film (double coating).

[0218] Reactive hardening adhesives can be of two types: one-component formulations or two-component formulations. One-component formulations can be composed of the following chemicals: epoxy resins, phenolic resins, polyurethanes, polyimides, or polyethylene-phenolic copolymers. The reaction within the one-component adhesive formulation can be triggered by the following mechanisms: moisture, heat, or ultraviolet light. Dimethacrylate adhesives are a separate type of one-component adhesive that can be used. This particular example cures onto reactive metal surfaces in the absence of air. Two-component adhesive formulations crosslink and harden during the mixing process of 2 functionalized monomers and can have the following chemistries: epoxy resins, phenolic resins, polyurethanes, polyimides, polyethylene-phenolic resins, or acrylic resins.

[0219] In some examples, adhesive 28 may be selected so that its surface energy matches the surface energy of the surface to which it is bonded (e.g., layers 18, 38, 36). Matching materials may be selected, or one or both of adhesive 28 and layers 18, 38 and / or base support 36 may be modified, such as via surface treatment, surface coating, or by adding additives, to achieve a desired surface energy. Examples of suitable surface treatments include reactive plasma ashing, corona discharge plasma, solvent cleaning, or anodizing.

[0220] In bonding area 14, adhesive 28 fills recessed portion 16' and covers gap region 26'. The sidewalls of recessed portion 16' increase the bonding surface area in area 14. In bonding area 14', adhesive 28 fills the space adjacent to gap region 26' around post 34' and extends over post 34'. The sidewalls of post 34' increase the bonding surface area in area 14.

[0221] Each of the flow cells 20A, 20B, 20C, and 20D also includes a cover 30 attached to the patterned substrate 10 by an adhesive 28 . Figure 2A and Figure 2BThe flow cells 20A, 20B of FIG. 1 show a cap 46 as the cover 30 . Figure 2C Flow cell 20C shows patterned substrate 48 as part of cover 30 . Figure 2D Flow cell 20D shows another patterned substrate 10 ″ as a cover 30 .

[0222] As mentioned above, the cover 46 is Figure 2A and Figure 2B 4. The cover 30 of the flow cell 20A, 20B shown in FIG. 46 can be any material that is transparent to the excitation light directed to the active region 12, 12'. In some optical detection systems, the cover 46 can also be transparent to the emission generated by the reaction occurring in the active region 12, 12'. For example, the cover 46 can include glass (e.g., borosilicate, fused silica, etc.) or a transparent polymer. A commercially available example of a suitable borosilicate glass is D Commercially available examples of suitable polymeric materials (ie, cycloolefin polymers) are available from Zeon Chemicals LP. product.

[0223] The cover 46 is physically connected to the patterned substrate 10 by the adhesive 28 at the bonding areas 14, 14'. In one example, the cover 46 can be a block of material having the same length and width as the patterned substrate 10. The cover 46 can have a flat outer surface and a groove 51 defined in the inner surface (i.e., the surface to be adhered to the patterned substrate 10). The groove 51 can be etched into the transparent block or otherwise defined in the transparent block, and can have a size corresponding to the size of the active areas 12, 12'. Therefore, when the cover 46 is mounted to the patterned substrate 10, the grooves 51 are aligned with the active areas 12, 12', respectively, and respectively and partially define the flow channels 32.

[0224] Although not shown, the cover 46 may include corresponding inlet and outlet ports that are configured to fluidly engage other ports (not shown) for directing fluid into the corresponding flow channel 32 (e.g., from a reagent cartridge or other fluid storage system component) and out of the corresponding flow channel 32 (e.g., to a waste removal system).

[0225] Reference now Figure 2C, the partially patterned substrate 48 is the cover 30 of the flow cell 20C. The partially patterned substrate 48 can be any material that is transparent to the excitation light directed to the substrate 12, 12'. In some optical detection systems, the partially patterned substrate 48 can also be directed to the emission generated by the reaction occurring in the active area 12, 12'. Any example of the cover 46 or the base support 36 can be used for the partially patterned substrate 48, as long as the material exhibits the desired transparency.

[0226] The partially patterned substrate 48 is physically connected to the patterned substrate 10 by the adhesive 28 at the bonding areas 14, 14'. In one example, the partially patterned substrate 48 can be a block of material having the same length and width as the patterned substrate 10. The partially patterned substrate 48 can have a flat outer surface and an inner surface, and recessed portions 16" defined in the inner surface at areas aligned with the bonding areas 14, 14'. These recessed portions 16" can have any of the geometric shapes of the recessed portions 16' disclosed herein, and thus can increase the adhesion between the substrates 10, 48. Figure 2C In the example shown, the adhesive 28 defines sidewalls of the flow channels 32 that are defined between the respective active areas 12 , 12 ′ and portions of the patterned substrate 48 .

[0227] In another example (not shown), the partially patterned substrate 48 may further include a groove 51 defined in the inner surface, similar to the reference Figure 2A and Figure 2B These grooves 51 will align with the active areas 12 , 12 ′ of the patterned substrate 10 to partially define the flow channels 32 .

[0228] Although Figure 2C Not shown, but the portion of the patterned substrate 48 may include corresponding inlet and outlet ports that are configured to fluidly engage other ports (not shown) for directing fluid into the corresponding flow channel 32 (e.g., from a reagent cartridge or other fluid storage system component) and out of the corresponding flow channel 32 (e.g., to a waste removal system).

[0229] Reference now Figure 2D , another patterned substrate 10" is used as a cover 30 for the flow cell 20D. The patterned structure 10" can be any example of a patterned substrate 10 or a patterned substrate 10', wherein recesses 16, 16' or columns 34, 34' are defined in active areas and bonding areas 12, 14 or 12', 14'. The two patterned substrates 10 or 10' and 10" are aligned so that the bonding areas 14, 14' are adhered together via the adhesive 28 and the active areas 12, 12' are aligned.

[0230] Although Figure 2DNot shown, but the patterned substrate 10 or 10" may include corresponding inlet and outlet ports that are configured to fluidly engage other ports (not shown) for directing fluid into the corresponding flow channel 32 (e.g., from a reagent cartridge or other fluid storage system component) and out of the corresponding flow channel 32 (e.g., to a waste removal system).

[0231] As mentioned, some examples of flow cells 20A, 20B, 20C, 20D are integrated with electronic detection devices such as complementary metal oxide semiconductor chips 50, examples of which are shown in FIG. Fig.15 Shown in.

[0232] In the illustrated example, the patterned substrate 10 can be directly attached to the complementary metal oxide semiconductor chip 50 by one or more fixing mechanisms (e.g., adhesives, bonding agents, fasteners, etc.), and thus physically contact the complementary metal oxide semiconductor chip. It should be understood that the patterned substrate 10 can be removably coupled to the complementary metal oxide semiconductor (CMOS) chip 50.

[0233] The CMOS chip 50 includes a plurality of stacked layers 52 including, for example, a silicon layer, a dielectric layer, a metal-dielectric layer, a metal layer, etc. The stacked layers 52 constitute device circuits including a detection circuit.

[0234] The CMOS chip 50 includes optical components, such as optical sensors 54 and optical waveguides 56. The optical components are arranged so that each optical sensor 54 is at least substantially aligned with, and thus operably associated with, a single optical waveguide 56 and a single reaction site (i.e., a recess 16 with a surface chemical therein or a column 34 with a surface chemical thereon) of the patterned substrate 10, 10'. However, in other examples, a single optical sensor 54 may receive photons through more than one optical waveguide 56 and / or from more than one reaction site. In these other examples, a single optical sensor 54 is operably associated with more than one optical waveguide 56 and / or more than one reaction site.

[0235] As used herein, a single optical sensor 54 may be an optical sensor including one pixel or more than one pixel. As an example, each optical sensor 54 may have a pixel size of less than about 50 μm. 2 As another example, the detection area may be less than about 10 μm 2 As yet another example, the detection area may be less than about 2 μm 2In the latter example, the optical sensor 54 may constitute a single pixel. The average read noise per pixel of the optical sensor 54 may be, for example, less than about 150 electrons. In other examples, the read noise may be less than about 5 electrons. The resolution of the optical sensor 54 may be greater than about 0.5 megapixels (Mpixel). In other examples, the resolution may be greater than about 5 Mpixel, or greater than about 10 Mpixel.

[0236] Also as used herein, a single optical waveguide 56 can be a light guide comprising a solidified filter material that i) filters the excitation light 58 (propagating from outside the flow cell into the flow channel 32), and ii) allows light emission (not shown, generated by the reaction at the reaction site) to propagate therethrough toward the corresponding optical sensor 54. In one example, the optical waveguide 56 can be, for example, an organic absorption filter. As a specific example, the organic absorption filter can filter the excitation light 58 of about 532 nm wavelength and allow light emission of about 570 nm or longer wavelength. The optical waveguide 56 can be formed by first forming a guide cavity in the dielectric layer 60 and then filling the guide cavity with a suitable filter material.

[0237] The optical waveguide 56 can be configured relative to the dielectric material 60 to form a light-guiding structure. For example, the optical waveguide 56 can have a refractive index of about 2.0 so that light emission is substantially reflected at the interface between the optical waveguide 56 and the surrounding dielectric material 60. In some examples, the optical waveguide 56 is selected so that the optical density (OD) or absorptivity of the excitation light 58 is at least about 4 OD. More specifically, the filter material can be selected and the size of the optical waveguide 56 can be set to achieve at least 4 OD. In other examples, the optical waveguide 56 can be configured to achieve at least about 5 OD or at least about 6 OD.

[0238] In this example, the layers 18, 38 ( Fig.15 The substrate 10 may be a passivation layer (not shown). This layer may or may not be supported by the base support 36, which should be transparent to the excitation light and emission light used during the analysis. At least a portion of the patterned substrate 10 (and therefore one of the passivation layers 18, 38 or the base support 36) is in contact with the first embedded metal layer 62 of the CMOS chip 50 and also in contact with the input region 64 of the optical waveguide 56. The contact of the substrate 10 with the first embedded metal layer 62 may be direct contact or indirect contact through the shielding layer 66.

[0239] The passivation layers 18, 38 of the patterned substrate 10 can provide a level of corrosion protection for the embedded metal layer 62 of the CMOS chip 50 that is closest to the patterned substrate 10. In this example, the passivation layer can be formed of a material that is transparent to light emissions (e.g., visible light) generated by the reactions at the reaction sites and is at least initially resistant to the fluid environment and moisture that may be introduced into or present in the flow channel 32.

[0240] Fig.15 An example of a flow cell 20C is shown in FIG. 1 and thus includes a portion of a patterned substrate 48 as a cover 30, as shown in FIG. Figure 2C In Fig.15 , a single active area 12 and two bonding areas 14 are depicted, so the flow cell 20C includes a single flow channel 12. In this example, however, the partially patterned substrate 48 includes inlet and outlet ports 70, 72 that are configured to fluidly engage other ports (not shown) for directing fluid into the flow channel 32 (e.g., from a reagent cartridge or other fluid storage system component) and out of the flow channel 32 (e.g., to a waste removal system).

[0241] Each reaction site is a localized area where a designated reaction may occur in the patterned substrate 10. Each reaction site includes a recessed portion 16 having a polymer hydrogel 22 and primers 24A, 24B therein.

[0242] In one example, a reaction site is at least substantially aligned with an input region 64 of a single optical waveguide 56. In this way, light emissions at the reaction site can be directed into the input region 64, through the waveguide 56, and to the associated optical sensor 54. In other examples, one reaction site can be aligned with several input regions 64 of several optical waveguides 56. In other examples, several reaction sites can be aligned with one input region 64 of one optical waveguide 56.

[0243] The embedded metal layer 62 may be any suitable CMOS metal, such as aluminum (Al), aluminum chloride (AlCu), tungsten (W), nickel (Ni), or copper (Cu). The embedded metal layer 62 is a functional part of the CMOS AVdd line and is also electrically connected to the optical sensor 54 through the stacked layer 52. Thus, the embedded metal layer 62 participates in the detection / sensing operation.

[0244] It should be understood that other optical sensors 54 and related components can be configured in the same or similar manner. However, it should also be understood that the CMOS chip 50 may not be manufactured identically or consistently. Instead, one or more optical sensors 54 and / or associated components may be manufactured differently or have different relationships relative to each other.

[0245] The stacked layers 52 may include interconnected conductive elements (e.g., conductors, traces, vias, interconnects, etc.) that can conduct electrical current. The circuit may be configured to selectively transmit data signals based on the detected photons. The circuit may also be configured for signal amplification, digitization, storage, and / or processing. The circuit may collect and analyze the detected light emissions and generate data signals for transmitting the detection data to a bioassay system. The circuit may also perform additional analog and / or digital signal processing in the CMOS chip 50.

[0246] The CMOS chip 50 can be manufactured using an integrated circuit manufacturing process. The CMOS chip 50 may include multiple layers, such as a sensor base / layer (e.g., a silicon layer or wafer, or a dielectric layer 60). The sensor base may include an optical sensor 54. When the CMOS chip 50 is fully formed, the optical sensor 54 may be electrically coupled to the rest of the circuitry in the stacked layer 52 through gates, transistors, etc.

[0247] As reference Fig.15 As used herein, the term "layer" is not limited to a single continuous body of material unless otherwise indicated. For example, the sensor base / layer may include multiple sub-layers having different materials and / or may include coatings, adhesives, etc. In addition, one or more layers (or sub-layers) may be trimmed (e.g., etched, deposited with materials, etc.) to provide the features described herein.

[0248] The stacked layer 52 also includes a plurality of metal-dielectric layers. Each of these layers includes a metal element (e.g., M1-M5, which may be, for example, W (tungsten), Cu (copper), Al (aluminum), or any other suitable CMOS conductive material) and a dielectric material 60 (e.g., SiO2). A variety of metal elements M1-M5 and dielectric materials 60 may be used, such as those suitable for integrated circuit manufacturing.

[0249] exist Fig.15 In the example shown, each of the plurality of metal-dielectric layers L1-L6 includes metal elements M1, M2, M3, M4, M5 and a dielectric material 60. In each of the layers L1-L6, the metal elements M1, M2, M3, M4, M5 are interconnected and embedded in the dielectric material 60. In some metal-dielectric layers L1-L6, additional metal elements may also be included. Some of these additional metal elements may be used to address individual pixels through row and column selectors. The voltage at these elements may vary and switch between approximately -1.4V and approximately 4.4V, depending on which pixel the device is reading out.

[0250] Fig.15The configuration of metal elements M1, M2, M3, M4, M5 and dielectric layer 60 in is illustrative of a circuit, and it is understood that other examples may include fewer or additional layers and / or may have different configurations of metal elements M1-M5.

[0251] exist Fig.15 In the example shown, the shielding layer 66 contacts at least a portion of the patterned structure 10. The shielding layer 66 has an aperture at least partially adjacent to the input region 64 of the optical waveguide 56. The aperture enables the reaction site (and at least some light emitted therefrom) to be optically connected to the waveguide 56. It should be understood that the shielding layer 66 can have an aperture at least partially adjacent to the input region 64 of each optical waveguide 56. The shielding layer 66 can extend continuously between adjacent apertures.

[0252] Shielding layer 66 may include any material that can block, reflect and / or significantly attenuate an optical signal propagating through flow channel 32. The optical signal may be excitation light 58 and / or light emission from a reaction site. As an example, shielding layer 66 may be tungsten (W).

[0253] method

[0254] The method used to form the flow cells 20A, 20B, 20C, and 20D will depend, at least in part, on the architecture of the active and bonding regions 12, 12', 14, 14'.

[0255] An example of the method includes forming a patterned substrate 10 by: defining an active area 12 within a layer 18 by defining a first recess 16 at a first predetermined position within a predetermined area of ​​the layer 18 surrounded by a second predetermined area of ​​the layer 18; and introducing a surface chemical into each first recess 16; and defining a bonding area 14 within the layer by defining a second recess 16' at a second predetermined position within a second predetermined area of ​​the layer 18; and introducing an adhesive 28 into the bonding area 14, including each second recess 16'; and positioning a cover 30 in contact with the adhesive 28, thereby securing the cover 30 to the bonding area 14 and forming a flow channel 32 between a portion of the cover 30 and the active area 12.

[0256] When the recesses 16 , 16 ′ have the same geometry, they may be formed simultaneously using the same process.

[0257] To produce identical recesses 16, 16' in a single layer substrate, embossing or etching may be used. When layer 18 is an etchable single layer substrate, defining first recess 16 and second recess 16' having identical geometries involves etching through a portion of the etchable single layer substrate at first and second predetermined locations.

[0258] In order to produce the same recessed portions 16, 16' in the layer 18 of the multilayer substrate, several different techniques can be used. In one example, the inorganic oxide can be selectively applied to the base support 36 with the desired pattern of the profile of the gap region 26, 26' and the recessed portions 16, 16', for example, via vapor deposition, aerosol printing or inkjet printing. In another example, a resin matrix material can be applied to the base support 36 and then patterned to form the recessed portions 16, 16'. Suitable deposition techniques include chemical vapor deposition, dip coating, dip coating, spin coating, spray coating, whipping distribution, ultrasonic spraying, blade coating, aerosol printing, screen printing, micro-contact printing, etc. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping technology, embossing technology, molding technology, micro-etching technology, printing technology, etc.

[0259] In order to produce the same recessed portion 16, 16' in multiple layers 18, 38 of the multilayer substrate, an etching technique can be used. When different layers have different etching rates, the etchant, etching time or other etching conditions can be changed to achieve the desired geometry. In some cases, a photolithographic mask or a metal sacrificial layer can be used to protect the area from being etched and then removed with a suitable remover. A dry etching process (such as anisotropic oxygen plasma, CF4 plasma or a mixture of 90% CF4 and 10% O2 plasma) can be used to etch the resin layer 18, 38.

[0260] When the recesses 16, 16' have different geometric shapes, they can be formed sequentially using different processes. Since the recesses 16 are cylindrical or elliptical cylindrical, they can be formed using any of the techniques disclosed herein, including photolithography, nanoimprint lithography (NIL), stamping technology, embossing technology, molding technology, micro-etching technology, or printing technology disclosed herein. Figure 8 The inclined cylindrical recess 16' shown in Figure 1 can also be formed using any of these techniques.

[0261] 4A to 4D The recessed portion 16' shown in FIG. 1 may be formed using various etching techniques to define a narrow portion P in layer 18. N and the wide portion P in layer 38 W. These processes begin with a stack of layers where a first layer 18 is positioned above at least one additional layer 38, which is positioned above a base support 36. In these examples, layer 18 and the at least one additional layer 38 have different etch rates, and base support 36 is non-etchable. A second recessed portion 16' is formed by sequentially etching through layer 18 at a second predetermined location and then etching through the at least one additional layer 38. An anisotropic etch may be used to etch through layer 18, and then an isotropic etch may be used to etch through layer 38. In this example, first recessed portion 16 may be formed by etching through layer 18 or by sequentially etching through layer 18 and then etching through the at least one additional layer 38 at the first predetermined location. For recessed portion 16, an anisotropic etch may be used through layers 18, 38.

[0262] Figure 4E The recess 16' shown can be Fig.18 The method shown is formed. In this example, the second predetermined area of ​​the layer 18 (where the bonding area 14 will be formed) includes etchable particles 80 mixed in the layer 18; and defining the second recessed portion 16' involves etching the etchable particles 80 from the layer 18. The etchable particles 80 can be any material having an etching rate higher than the etching rate of the layer 18. Therefore, the etchable particles 80 can be exposed to the etchant and removed while the layer 18 remains intact.

[0263] 9A to 9C The recessed portion 16' with the suspended feature 44 shown in the figure can be prepared by first generating the feature 44 using any suitable technique (such as molding, 3D printing, etc.). The feature 44 is then positioned and fixed to the layer 18 (e.g., via an adhesive) in a pattern corresponding to the recessed portion formation, and fixed to the layer 18. The feature 44 can also be formed in the desired position on the layer 18 using vacuum deposition (e.g., by sputtering, thermal evaporation, etc.), solution-based deposition, or spray deposition through a photolithographic mask that exposes the desired position of the feature 44. Once the feature material is deposited, the photolithographic mask and any material thereon can be removed to leave the feature 44 in the desired position. The layer 18 is then selectively etched to form the recessed portion 16' around and below the feature 44. The etching is performed so that after the recessed portion 16' is formed, the gap area 26' of the layer 18 supports the feature 44, but the feature 44 is suspended above the recessed portion 16'.

[0264] Fig.17 Another example of forming feature 44 is shown. This example utilizes a negative or positive photoresist as a mask for a subsequent etch. The material stack may include base support 36, at least one additional layer 38, and layer 18.

[0265] In this example, a photoresist is deposited on layer 18 and patterned. Examples of suitable negative tone photoresists include Other suitable negative photoresists include SU-8 series and series (both available from Kayaku Advanced Materials, Inc.), or UVN TM Series (available from DuPont). Examples of suitable positive photoresists include S1800 series or 1500 series, both available from Kayaku Advanced Materials, Inc. Another example of a suitable positive photoresist is SPR TM -220 (from DuPont).

[0266] When a negative photoresist is used, it is applied to layer 18 using any suitable technique. To develop the negative photoresist, a dose of ultraviolet light is directed to the portions of the photoresist that will become insoluble. The portions not exposed to light will become soluble and can be removed with a developer. The removed portions form a pattern P for forming the second recessed portion 16'.

[0267] When a positive photoresist is used, it is applied to layer 18 using any suitable technique. To develop the positive photoresist, a dose of ultraviolet light is directed to portions of the photoresist that will become soluble and can be removed with a developer. The removed portions form the pattern P for forming the second recessed portion 16'. Portions not exposed to light will become insoluble.

[0268] Fig.16A and Fig. 16B Two examples of patterned photoresists are shown from a top view. The photoresist includes an insoluble photoresist feature 76 that covers a portion of each second predetermined location 78 (see FIG. Fig.17 , where the second recessed portion 16' will be formed), and ii) an insoluble photoresist region 74 that covers the gap region 26' of the second predetermined area surrounding each second predetermined location 78. The outline of the pattern P defined in the insoluble photoresist 74, 76 provides the general shape of the second recessed portion 16'. The insoluble photoresist feature 76 located between the patterns P defines the location where the feature 44 will be formed in the underlying layer 18, 38. The insoluble photoresist feature 76 has a cross-sectional shape relative to the surface plane of the underlying layer 18, the cross-sectional shape being selected from a rectangular ( Fig.16A ), Cross( Fig. 16B), X-shaped, and a group of multiple cross spokes. Insoluble photoresist features 76 can have any configuration that forms a pattern P of etched areas that are close enough together so that their conical etched areas in layer 38 merge together during etching (see Fig.17 ).

[0269] exist Fig.17 In an example method, photoresist is patterned over layer 18 to define i) an insoluble photoresist feature 76 over a portion of each second predetermined location 78 (where a second recess 16' will be formed), and ii) an insoluble photoresist region 74 over a gap region 26' surrounding a second predetermined area (i.e., bonding areas 14, 14') of each second predetermined location 78, thereby exposing an area 78' of layer 18 at each second predetermined location 78.

[0270] In this example method, the second recessed portion 16' is defined by etching an exposed region 78' of the layer 18 at each second predetermined location 78, thereby exposing a region 38' of at least one additional layer 38 at each second predetermined location 78 and forming a layer feature 44' below each insoluble photoresist feature 76; and then etching the exposed region 38' of at least one additional layer 38 at each second predetermined location 78, thereby removing at least a portion of the second layer 38 below each layer feature 44'. In this example, an anisotropic etch may be used to etch the layer 18 at the regions 78' exposed between the photoresist, and then an isotropic etch may be used to etch the layer 38 at the regions 38' exposed between the photoresist.

[0271] like Fig.17 As shown, etching of layer 38 continues partially beneath feature 44' and thus enables etched areas to merge together to extend recess 16' beneath feature 44'. In this example, feature 44' and any remaining portion of layer 38 attached to feature 44' form feature 44.

[0272] Although Fig.17 74, 76. The photoresist regions and features 74, 76 are not shown, but can then be removed in a suitable stripper for the photoresist used. The cured positive photoresist can be stripped with a stripper such as: dimethyl sulfoxide (DMSO) using ultrasonic treatment; acetone wash; propylene glycol monomethyl ether acetate wash; or NMP (N-methyl-2-pyrrolidone) based stripper wash. The cured negative photoresist can be stripped with a stripper such as: dimethyl sulfoxide (DMSO) using ultrasonic treatment; acetone wash; or NMP (N-methyl-2-pyrrolidone) based stripper wash.

[0273] In either of these examples, once the recess 16 , 16 ′ is formed, a surface chemistry is introduced into the recess 16 .

[0274] One example of a suitable technique for introducing surface chemicals may include a selective deposition technique (e.g., a controlled printing technique, etc.). In one example, the pre-grafted polymer hydrogel 22 (i.e., the hydrogel 22 grafted with the primers 24A, 24B) may be deposited into the recessed portion 16, rather than being deposited on the gap regions 26, 26' or in the recessed portion 16'. In another example, the polymer hydrogel 22 may be selectively deposited into the recessed portion 16, rather than being deposited on the gap regions 26, 26' or in the recessed portion 16', and then the primers 24A, 24B may be grafted onto the polymer hydrogel 22 in the recessed portion 16. In the latter example, it should be understood that the layer 18 does not include functional groups for attaching the primers 24A, 24B, and therefore the primers 24A, 24B will be grafted onto the polymer hydrogel 22 in the recessed portion 16, rather than being grafted onto the gap regions 26, 26' or the recessed portion 16'.

[0275] Primers 24A, 24B can be included in a carrier fluid at a concentration ranging from about 0.5 μM to about 100 μM. In one example, the primer concentration can be in the range of about 5 μM to about 25 μM. The carrier fluid of the primer fluid can be water. Buffer and / or salt can be added to the carrier fluid to graft primers 24A, 24B to the appropriate functional groups of the polymer hydrogel 22. The pH range of the buffer is 5 to 12, and the buffer used will depend on the functional groups at the 5' ends of primers 24A, 24B. Neutral buffer and / or salt can be added to the primer fluid for grafting BCN-terminated primers, while alkaline buffer can be added to the primer fluid for copper-assisted grafting methods (e.g., click reactions). Any primer fluid used in the copper-assisted grafting method may also include a copper catalyst. Examples of neutral buffers include tris (hydroxymethyl) aminomethane (TRIS) buffers, such as TRIS-HCl or TRIS-EDTA, or carbonate buffers (e.g., 0.25M to 1M). Sodium sulfate (eg, 1 M to 2 M) is a suitable salt that may be used.

[0276] Examples of alkaline buffers include tris(hydroxymethyl)aminomethane (CHES), 3-(cyclohexylamino)-1-propanesulfonic acid (CAPS), and alkaline buffer solution (from Sigma-Aldrich).

[0277] For grafting, a primer fluid is introduced into the active area 12. Grafting can be performed at a temperature in the range of about 55°C to about 65°C for a time in the range of about 20 minutes to about 60 minutes. In one example, grafting is performed at 60°C for about 30 minutes or 60 minutes. It should be understood that lower temperatures and longer times or higher temperatures and shorter times may also be used. Some primer grafting techniques, such as those involving BCN grafting to tetrazine units, can be performed at room temperature (e.g., 18°C ​​to about 25°C). During the grafting process, primers 24A, 24B are attached to at least some of the azide or tetrazine groups or other functional groups of the polymer hydrogel 22, and have no affinity for the gap regions 26, 26' or recessed portions 16' in which there is no polymer hydrogel 22.

[0278] Another example of a suitable technique for introducing surface chemistry can include the use of photoresist. In this example, the photoresist is developed to mask the bonding area 14 while the surface chemistry (eg, polymer hydrogel 22 and primers 24A, 24B) is added to the active area 12.

[0279] After the photoresist is placed over the bonding area 14, a mixture of polymer hydrogel 22 can be produced and applied to the active area 12, both in the recessed portion 16 and on the gap area 26. In one example, any example of the polymer hydrogel 22 disclosed herein can be present in a mixture (e.g., a mixture with water or a mixture with ethanol and water). The mixture can then be applied to the layer 18 in the active area 12 using spin coating or dipping or dip coating or material flow under positive or negative pressure or another suitable technique. These types of techniques deposit the polymer hydrogel 22 all over the layer 18 of the active area 12. In some examples, the surface of a single layer 18 can be activated, and then the mixture (including the polymer hydrogel 22) can be applied thereto. In one example, silane or a silane derivative (e.g., norbornene silane) can be deposited on the surface of the layer 18 using vapor deposition, spin coating, or other deposition methods. In another example, the layer 18 can be exposed to plasma ashing to generate a surfactant (e.g., -OH group) that can be attached to the polymer hydrogel 22.

[0280] The applied mixture may be exposed to a curing process depending on the chemistry of the polymer hydrogel 22. In an example, curing may be performed at a temperature ranging from room temperature (eg, about 25°C) to about 95°C for a time ranging from about 1 millisecond to about several days.

[0281] When a blanket deposition technique is used, polishing may then be performed to remove the polymer hydrogel 22 from the gap regions 26 while leaving the polymer hydrogel 22 in the recesses 16 at least substantially intact. Primers 24A, 24B may then be grafted onto the polymer hydrogel 22 in the recesses 16 as described herein. The photoresist is then removed from the bonding regions 14 using a suitable remover.

[0282] Once the surface chemistry is in place in the active areas 12 , adhesive 28 may be selectively applied to the bonding areas 14 , and cover 30 may be placed in contact with adhesive 28 .

[0283] A dispensing coater can be used to apply the adhesive 28 so that it is not deposited into the active area 12. An example of a dispensing coater that can be used in this example method is a GPD coater with a screw pump, which is a high-precision volumetric dispensing pump. Another type of dispensing coater is a pressure-driven dispensing system. In another example, the adhesive 28 can be applied using an inkjet printer or other similar printer.

[0284] The temperature and pressure used during bonding can be selected to be higher than the conditions used during operation of the flow cell 20A, 20C, 20D so that the bond does not weaken during use. The adhesive 28 is cured, which secures the cover 30 to the patterned substrate 10 to form the flow cell 20A, 20C, 20D. In one example, the bonding temperature can be up to 80°C and the bonding pressure can be up to 20 kN.

[0285] Another example of the method includes forming a patterned substrate 10' by: defining an active area 12' within a layer 18 by defining a first column 34 at a first predetermined position within a predetermined area of ​​the layer 18, the predetermined area being surrounded by a second predetermined area of ​​the layer; and introducing a surface chemical substance into each first column 34; defining a bonding area 14' of the layer by defining a second column 34' at a second predetermined position within the second predetermined area of ​​the layer 18; introducing an adhesive 28 into the bonding area 14 at least around each second column 34'; and positioning a cover 30 in contact with the adhesive 28, thereby securing the cover 30 to the bonding area 14' and forming a flow channel 32 between a portion of the cover 30 and the active area 12'.

[0286] When the pillars 34, 34' have the same geometry, they may be formed simultaneously using the same process.

[0287] To produce identical posts 34, 34' in a single layer substrate, embossing or etching may be used. When layer 18 is an etchable single layer substrate, defining first and second posts 34, 34' having identical geometries involves etching through a portion of the etchable single layer substrate around the first and second predetermined locations.

[0288] To produce identical posts 34, 34' in the layers 18 of the multilayer substrate, several different techniques may be used. In one example, an inorganic oxide may be selectively applied to the base support 36 in the desired pattern of posts 34, 34', such as via vapor deposition, aerosol printing, or inkjet printing. In another example, a resin matrix material may be applied to the base support 36 and then patterned to form the posts 34, 34'. Any suitable deposition and patterning techniques may be used.

[0289] When the pillars 34, 34' have different geometric shapes, they can be formed sequentially using different processes. Since the pillars 34 are cylindrical or elliptical cylindrical, they can be formed using any of the techniques disclosed herein, including photolithography, nanoimprint lithography (NIL), stamping technology, embossing technology, molding technology, micro-etching technology, or printing technology disclosed herein. Fig.13 The inclined cylindrical post 34' shown in Figure 3 can also be formed using any of these techniques.

[0290] Fig.11 and Fig.12 The pillars 34, 34' shown in FIG. 1 may be formed using different etching techniques to define narrow portions P in layer 38. N and the wide portion P in layer 18 W . These processes begin with a stack of layers where a first layer 18 is positioned above at least one additional layer 38, which is positioned above a base support 36. In these examples, layer 18 and the at least one additional layer 38 have different etch rates, and base support 36 is non-etchable. Second pillar 34' is formed by sequentially etching through layer 18 at a second predetermined location and then etching through at least one additional layer 38 to leave pillar 34'. In this example, first pillar 34 can be formed by etching through layer 18 or by sequentially etching through layer 18 and then etching through at least one additional layer 38 at a first predetermined location to leave pillar 34.

[0291] Once the pillars 34 , 34 ′ are formed, surface chemistry is introduced onto the pillars 34 .

[0292] One example of a suitable technique for introducing surface chemicals may include a selective deposition technique (e.g., a controlled printing technique, etc.). In one example, a pre-grafted polymer hydrogel 22 (i.e., a hydrogel 22 grafted with primers 24A, 24B) may be deposited onto the pillars 34, rather than being deposited on the gap regions 26, 26' or on the pillars 34'. In another example, the polymer hydrogel 22 may be selectively deposited onto the pillars 34, rather than being deposited on the gap regions 26, 26' or on the pillars 34', and then the primers 24A, 24B may be grafted onto the polymer hydrogel 22 on the pillars 34. In the latter example, it should be understood that the layer 18 does not include functional groups for attaching the primers 24A, 24B, and therefore the primers 24A, 24B will be grafted onto the polymer hydrogel 22 on the pillars 34, rather than being grafted onto the gap regions 26, 26' or on the pillars 34'. The primers 24A, 24B may be grafted as described herein.

[0293] Another example of a suitable technique for introducing surface chemistry may include the use of a photoresist. In this example, the photoresist is developed to mask the bonding region 14' and the gap region 26 surrounding the pillars 34 in the active region 12', while the surface chemistry (e.g., polymer hydrogel 22 and primers 24A, 24B) is added to the pillars 34 active region 12'.

[0294] After placing the photoresist over the bonding area 14' and the gap area 26, a mixture of the polymer hydrogel 22 can be created and applied to the pillars 34 in the active area 12'. In one example, any of the examples of the polymer hydrogel 22 disclosed herein can be present in a mixture (e.g., a mixture with water or a mixture with ethanol and water). The mixture can then be applied to the exposed pillars 34 in the active area 12' using spin coating or dipping or dip coating or a material flow under positive or negative pressure or another suitable technique. These types of techniques deposit the polymer hydrogel 22 in a blanket manner. Depending on the chemical properties of the polymer hydrogel 22, the applied mixture can be exposed to a curing process as described herein.

[0295] The photoresist is then removed from the bonding regions 14' and gap regions 26 using a suitable remover. This process will also remove the polymer hydrogel 22 covering the photoresist. This again exposes the posts 34' and gap regions 26, 26'.

[0296] Primers 24A, 24B can then be grafted onto polymer hydrogel 22 on pillar 34, as described herein. It should be understood that pillar 34' and interstitial regions 26, 26' do not include functional groups for attaching primers 24A, 24B, and thus primers 24A, 24B will be grafted onto polymer hydrogel 22 on pillar 34, rather than onto interstitial regions 26, 26' or pillar 34'.

[0297] Once the surface chemistry is in place in the active areas 12', adhesive 28 may be selectively applied to the bonding areas 14', and cover 30 may be placed in contact with adhesive 28. The bonding process may be performed as described herein to form flow cell 20B.

[0298] In order to further illustrate the present disclosure, examples are given herein. It should be understood that the examples are provided for illustrative purposes and should not be construed as limiting the scope of the present disclosure.

[0299] Non-limiting working examples

[0300] Three different types of flow cells were used in this example.

[0301] The flow cell of the first type comprises two active areas, and these two active areas are patterned to have cylindrical recessed parts and are surrounded by bonding area.The example flow cell of the first type comprises a recessed part in the bonding area, and this recessed part has a small cylindrical shape, or a larger cylindrical shape, or an elliptical cylindrical shape.The comparison flow cell of the first type does not comprise a recessed part in the bonding area.Prepare and test 103 example flow cells of the first type, and prepare and test 34 comparison flow cells of the first type.

[0302] The flow cell of the second type is similar to the first type, but has a wider active area and a narrower bonding area. The example flow cell of the second type includes a recessed portion in the bonding area, and the recessed portion has a small cylindrical shape, or a larger cylindrical shape, or an elliptical cylindrical shape. The comparison flow cell of the second type does not include a recessed portion in the bonding area. Prepared and tested 17 example flow cells of the second type, and prepared and tested 13 comparison flow cells of the second type.

[0303] The flow cell of the third type includes eight active areas, which are patterned with cylindrical recesses and surrounded by bonding areas patterned with larger cylindrical recesses. The comparison flow cell of the third type does not include recesses in the bonding area. 13 example flow cells of the third type were prepared and tested, and 16 comparison flow cells of the third type were prepared and tested.

[0304] The first, second and third types of embodiments and comparative flow cells were subjected to cyclic pressure tests. Each flow cell was filled with air and kept for 30 seconds to measure air leakage. Once a leak was detected, the flow cell was considered to be ruptured.

[0305] Fig.19A The average results of the first type of example and comparative example flow cells are shown in . Fig.19B The average results of the second type of example and comparative example flow cells are shown in . Fig.19CThe average results of the third type of embodiment and comparative example flow cells are shown in FIG. Fig.19A , Fig.19B and Fig.19C In each of the examples, the example flow cells are labeled “patterned” and the comparative flow cells are labeled “unpatterned.” The results for each type of flow cell show that the flow cells with patterned bonding areas last longer than the flow cells without patterned bonding areas.

[0306] Additional Notes

[0307] It should be understood that all combinations of the foregoing concepts and additional concepts discussed in more detail below (assuming such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. Specifically, all combinations of the claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be understood that terms explicitly adopted herein that may also appear in any disclosure incorporated by reference should be given a meaning most consistent with the specific concepts disclosed herein.

[0308] The references to "one example", "another example", "an example", etc. throughout this specification mean that the specific elements (e.g., features, structures, and / or characteristics) described in conjunction with the example are included in at least one example described herein, and may or may not be present in other examples. In addition, it should be understood that the elements used in any example may be combined in various examples in any suitable manner, unless the context clearly indicates otherwise.

[0309] While several examples have been described in detail, it is to be understood that modifications may be made to the disclosed examples. Therefore, the above description should be considered non-limiting.

Claims

1. A circulation cell, comprising: A patterned substrate having an active area and a bonding area at least partially surrounding the active area, wherein the active area comprises: a first recess defined in a layer of the patterned substrate; a surface chemistry positioned in the first recess; and a first gap region surrounding the first recessed portion; and wherein the bonding region comprises: a second recess defined in the layer; and a second gap region surrounding the second recessed portion; an adhesive positioned in the second recess and over the second gap region; and A cover is attached to the adhesive such that a flow channel is defined between a portion of the cover and the active area.

2. A flow cell according to claim 1, wherein the geometric shapes of each of the first recessed portions and each of the second recessed portions are the same.

3. The flow cell of claim 2, wherein the geometric shape is selected from the group consisting of a cylinder, an elliptical cylinder, a sphere, a cube, a cuboid, a cone, a lanceolate, a polygonal prism, and combinations thereof.

4. A flow cell according to claim 1, wherein a geometry of each of the first recessed portions is different from a geometry of each of the second recessed portions.

5. The flow cell according to claim 4, wherein: The geometric shape of each of the first recessed portions is selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a cuboid, a polygonal prism, and combinations thereof; said geometry of each said second recessed portion comprises a narrow portion opening to a wide portion; and For the geometry of each of the second recessed portions, a dimension across the opening of the narrow portion is smaller than at least one dimension of the wide portion parallel to the dimension across the opening.

6. The flow cell according to claim 5, wherein: The narrow portion has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, and a cuboid; and The wide portion has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a cuboid, a lanceolate, a sphere, a polygonal prism, and a cone.

7. A flow cell according to one of claims 5 or 6, wherein: The patterned substrate includes at least one additional layer beneath the layer and a base support beneath the at least one additional layer; and For each of the geometric shapes of the second recessed portions: The narrow portion is defined in and passes through the layer; said wide portion being defined in and passing through said at least one additional layer; The base support defines a bottom of the wide portion; and The layer defines an overhang over a portion of the wide portion.

8. The flow cell of claim 4, wherein: The geometric shape of each of the first recessed portions is selected from the group consisting of a cylinder, an elliptical cylinder, a sphere, a cube, a cuboid, a cone, a lanceolate, a polygonal prism, and combinations thereof; The geometric shape of each of the second recessed portions is selected from the group consisting of an inclined cylinder, an inclined elliptical cylinder, an inclined cube, an inclined rectangular parallelepiped, and an inclined polygonal prism; and The geometry of each of the second recessed portions has a central axis that is at a non-ninety degree angle relative to a plane at a bottom of the second recessed portion.

9. A circulation pool according to claim 1, wherein the circulation pool also includes a plurality of features, each of which extends above a portion of a corresponding one of the second recesses and is supported by the second gap area surrounding the corresponding one of the second recesses, wherein the adhesive is wrapped around each feature.

10. The flow cell of claim 9, wherein each feature extends partially into the depth of the corresponding one of the second recesses. 11 . The flow cell according to claim 1 , wherein the adhesive fills each of the second recesses.

12. A flow cell according to one of claims 1 or 11, wherein: The patterned substrate includes a plurality of additional layers beneath the layer and a base support beneath the plurality of additional layers; an etch rate of the layer and each of the plurality of additional layers that increases as one moves toward the base support; The base support is non-etchable; and The geometry of each of the second recesses increases moving toward the base support.

13. A flow cell according to one of claims 1 or 11, wherein: The patterned substrate includes a plurality of additional layers beneath the layer and a base support beneath the plurality of additional layers; The layer has a first etch rate; an etch rate for each of the plurality of additional layers alternating between a second etch rate and the first etch rate as moving toward the base support; The base support is non-etchable; and The geometry of each of the second recesses varies between a first size and a second size as one moves toward the base support.

14. A circulation cell, comprising: A patterned substrate having an active area and a bonding area at least partially surrounding the active area, wherein the active area comprises: defining a first pillar in a layer of the patterned substrate; a surface chemistry positioned above the first column; and a first gap region surrounding the first column; and wherein the bonding area comprises: a second column defined in the layer; and a second gap region surrounding the second column; an adhesive positioned over the second gap region and over the second post; and A cover is attached to the adhesive such that a flow channel is defined between a portion of the cover and the active area.

15. The flow cell of claim 14, wherein: Each of the first pillars and each of the second pillars have the same geometric shape; and The geometric shape is selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a cuboid, a cone, a polygonal prism, and combinations thereof.

16. A flow cell according to claim 14, wherein the geometry of each of the first columns is different from the geometry of each of the second columns.

17. A flow cell according to claim 16, wherein: The geometric shape of each of the first pillars is selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a cuboid, a cone, a polygonal prism, and combinations thereof; said geometry of each said second post comprises a narrow portion extending outwardly to a wide portion; and For the geometry of each of the second posts, a dimension across the base of the narrow portion is smaller than at least one dimension of the wide portion parallel to the dimension across the base.

18. A flow cell according to claim 17, wherein: The narrow portion has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a cuboid, a cone, and a polygonal prism; and the wide portion has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a cuboid, and a polygonal prism.

19. The flow cell of claim 17, wherein: The substrate comprises the layer, at least one additional layer below the layer, and a base support below the at least one additional layer; and For each of the geometries of the second column: The wide portion is defined in the layer; and The narrow portion is defined in the at least one additional layer.

20. The flow cell of claim 16, wherein: The geometric shape of each of the first pillars is selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a cuboid, a cone, a polygonal prism, and combinations thereof; The geometric shape of each of the second pillars is selected from the group consisting of an inclined cylinder, an inclined elliptical cylinder, an inclined cube, an inclined cuboid, and an inclined polygonal prism; and The geometry of each of the second posts has a central axis that is at a non-ninety degree angle relative to a plane at a base of the second post.

21. The flow cell of one of claims 14 to 20, wherein the adhesive fills the second interstitial region.

22. A flow cell according to one of claims 14 or 21, wherein: The patterned substrate includes a plurality of additional layers beneath the layer and a base support beneath the plurality of additional layers; an etch rate of the layer and each of the plurality of additional layers that increases as one moves toward the base support; The base support is non-etchable; and The geometry of each of the second posts decreases moving toward the base support.

23. A flow cell according to one of claims 14 or 21, wherein: The patterned substrate includes a plurality of additional layers beneath the layer and a base support beneath the plurality of additional layers; The layer has a first etch rate; an etch rate for each of the plurality of additional layers alternating between a second etch rate and the first etch rate as moving toward the base support; The base support is non-etchable; and The geometry of each of the second posts varies between a first size and a second size as one moves toward the base support.

24. A method comprising: The patterned substrate is formed by the following process: The active area within a layer is defined by: defining a first recessed portion at a first predetermined position within a first predetermined region of the layer surrounded by a second predetermined region of the layer; as well as introducing a surface chemical into each of said first recesses; defining a patterned bonding area in the layer by defining a second recessed portion at a second predetermined location within the second predetermined area of ​​the layer; introducing an adhesive into the patterned bonding area, including each of the second recessed portions; as well as A cover is positioned in contact with the adhesive, thereby securing the cover to the patterned bond area and forming a flow channel between a portion of the cover and the active area.

25. The method of claim 24, wherein: The patterned substrate is a multi-layer substrate including the layer above at least one additional layer positioned above a base support; each of said first recessed portions is defined through said layer and said at least one additional layer, wherein portions of said layer define first gap regions separating said first recessed portions from one another; and Each of the second recessed portions is defined through the layer and the at least one additional layer, wherein portions of the layer define second gap regions separating the second recessed portions from one another.

26. The method of claim 25, wherein: said layer and said at least one additional layer having different etch rates; The base support is non-etchable; defining the first recess involves sequentially etching through the layer at the first predetermined location and then through the at least one additional layer; and Defining the second recess involves sequentially etching through the layer at the second predetermined location and then through the at least one additional layer.

27. The method of claim 26, wherein: The geometric shape of each of the first recesses extends through the layer and the at least one additional layer and is selected from the group consisting of a cylinder, an elliptical cylinder, a sphere, a cube, a cuboid, a cone, a lanceolate, a polygonal prism, and combinations thereof; The geometry of each of said second recesses comprises a narrow portion extending through said layer and opening into a wide portion extending through said at least one additional layer; and For the geometry of each of the second recessed portions, a dimension across the opening of the narrow portion is smaller than at least one dimension of the wide portion parallel to the dimension across the opening.

28. The method of claim 27, wherein: The narrow portion has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a cuboid, and a polygonal prism; and The wide portion has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a cuboid, a lanceolate, a sphere, a cone, a polygonal prism, and combinations thereof.

29. The method of claim 27, wherein each of the second recessed portions is inclined such that a central axis thereof is at a non-ninety degree angle relative to a plane at a bottom of the second recessed portion.

30. The method of claim 25, wherein: said geometric shape of each said first recessed portion extends through said layer and said at least one additional layer and is selected from the group consisting of a cylinder, an elliptical cylinder, a sphere, a cube, a cuboid, a cone, a lanceolate, a polygonal prism, and combinations thereof; The geometric shape of each of the second recessed portions is selected from the group consisting of an inclined cylinder, an inclined elliptical cylinder, an inclined cube, an inclined cuboid, and an inclined polygonal prism, extending through the layer and the at least one additional layer; and The geometry of each of the second recessed portions has a central axis that is at a non-ninety degree angle relative to a plane at a bottom of the second recessed portion.

31. The method of claim 24, wherein: The patterned substrate is a multi-layer substrate including the layer above a plurality of additional layers positioned above a base support; an etch rate of the layer and each of the plurality of additional layers that increases as one moves toward the base support; The base support is non-etchable; Defining the second recess involves sequentially etching through the layer, and then etching through each of the plurality of additional layers; and The geometry of each of the second recesses increases moving toward the base support.

32. The method of claim 24, wherein: The patterned substrate is a multi-layer substrate including the layer above a plurality of additional layers positioned above a base support; The layer has a first etch rate; an etch rate for each of the plurality of additional layers alternating between a second etch rate and the first etch rate as moving toward the base support; The base support is non-etchable; Defining the second recess involves sequentially etching through the layer, and then etching through each of the plurality of additional layers; and The geometry of each of the second recesses varies between a first size and a second size as one moves toward the base support.

33. The method of claim 24, wherein: The layer is an etchable material positioned over a non-etchable base support; and Defining the first recess involves etching through the etchable material at the first predetermined location.

34. The method of claim 33, wherein: positioning a non-etchable material over the etchable material at a portion of each of the second predetermined locations; and Defining each of the second recessed portions involves etching through a portion of the etchable material around and beneath the non-etchable material at the second predetermined location, whereby the non-etchable material forms a respective feature extending over a portion of each of the second recessed portions.

35. The method of claim 24, wherein: The patterned substrate is a multi-layer substrate including the layer above the second layer positioned above the base support; the layer having a first etch rate and the second layer having a second etch rate greater than the first etch rate; and Defining the first recess involves etching through the layer and the second layer at the first predetermined location.

36. The method of claim 35, further comprising: patterning a photoresist over the layer to i) define an insoluble photoresist feature over a portion of each of the second predetermined locations, and ii) define an insoluble photoresist region over a gap region of the second predetermined area surrounding each of the second predetermined locations, thereby exposing a region of the layer at each of the second predetermined locations; and Defining the second recessed portion involves: etching an exposed region of the layer at each of the second predetermined locations, thereby exposing a region of the second layer at each of the second predetermined locations and forming a layer feature beneath each of the insoluble photoresist features; and then etching an exposed region of the second layer at each of the second predetermined locations, At least a portion of the second layer beneath each of the layer features is thereby removed.

37. The method of claim 36, wherein each insoluble photoresist feature has a cross-sectional shape relative to a surface plane of the layer selected from the group consisting of a rectangle, a cross, an X, and a plurality of intersecting spokes.

38. The method of claim 24, wherein each of the first recessed portions and each of the second recessed portions are of the same geometric shape.

39. The method of claim 24, wherein: The second predetermined region of the layer includes etchable particles mixed therein; and Defining the second recessed portion involves etching the etchable particles from the layer.

40. A method comprising: The patterned substrate is formed by the following process: The active area within a layer is defined by: defining a first post at a first predetermined location within a predetermined area of ​​the layer surrounded by a second predetermined area of ​​the layer; as well as introducing a surface chemical into each of said first columns; defining a bonding area of ​​the layer by defining a second post at a second predetermined location within the second predetermined area of ​​the layer; introducing adhesive into at least said bonding area surrounding each of said second posts; as well as A cover is positioned in contact with the adhesive, thereby securing the cover to the bonding area and forming a flow channel between a portion of the cover and the active area.

Images