Method for assembling sgRNA in-vitro transcription template by using short primer and application of sgRNA in-vitro transcription template

Abstract

The invention belongs to the technical field of gene editing, and discloses a method for assembling an sgRNA in-vitro transcription template by using a short primer and an application of the sgRNA in-vitro transcription template, and the method comprises the following steps: a) selecting a target gene target site; b) designing a target site sequence primer pair according to a target site sequence of a target gene, and then matching with a specific terminal primer pair and an sgRNA skeleton primer pair, and rapidly assembling through a PCR (Polymerase Chain Reaction) method to obtain an sgRNA in-vitro transcription template; the sequences of the specific terminal primer pair are as shown in SEQ ID NO. 3 and SEQ ID NO. 4; the sequences of the sgRNA skeleton primer pair are as shown in SEQ ID NO. 5 and SEQ ID NO. 6. According to the invention, the sgRNA in-vitro transcription template is assembled by using a short primer (less than 59nt), so that the method has the characteristics of low cost and high efficiency; a kit product developed according to the method can adapt to sgRNA synthesis of different target sites, the synthesized sgRNA is high in specificity, and CRISPR / Cas9 editing efficiency is high.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing and relates to a method and application of assembling a sgRNA in vitro transcription template using a short primer. Background Art

[0002] CRISPR / Cas9-mediated gene editing technology is an important research method in the fields of biology, medicine, and breeding research. This technology system only requires two components, Cas9 protein and sgRNA, to edit specific genes. Cas9 protein is a universal component (no modification is required), and sgRNA needs to be designed and transcribed according to different target sites. Therefore, quickly and efficiently obtaining a large number of biologically active sgRNAs is a key step in CRISPR / Cas9 gene editing technology. However, the sgRNA synthesis kits currently used generally use plasmids or long primers to obtain the in vitro transcription template of sgRNA, and then purify sgRNA through in vitro transcription. The synthesis time is long, the efficiency is low, and the cost is high. Summary of the invention

[0003] The present invention aims to solve the technical problems of low efficiency and high cost of existing sgRNA in vitro transcription, and provides a method for assembling sgRNA in vitro transcription templates using short primers. The sgRNA in vitro transcription templates are assembled using short primers (less than 59 nt), which has the characteristics of low cost and high efficiency. The kit product developed thereby can be applied to the synthesis of sgRNAs of different target sites, the synthesized sgRNAs have strong specificity, and the CRISPR / Cas9 editing efficiency is high.

[0004] To achieve the above object, the present invention adopts the following technical solutions:

[0005] In a first aspect, the present invention provides a method for assembling an sgRNA in vitro transcription template using a short primer, comprising the following steps:

[0006] a) selecting a target gene target site; b) designing a target site sequence primer pair according to the target gene target site sequence, and then combining a specific terminal primer pair and an sgRNA backbone primer pair to quickly assemble an sgRNA in vitro transcription template by a PCR method; the specific terminal primer pair sequence is shown in SEQ ID NO.3 and SEQ ID NO.4; the sgRNA backbone primer pair sequence is shown in SEQ ID NO.5 and SEQ ID NO.6.

[0007] In a second aspect, the present invention provides a kit for in vitro transcription of sgRNA, the kit comprising the above-mentioned specific terminal primer pair, the above-mentioned sgRNA backbone primer pair and the target site sequence primer pair. The sgRNA is transcribed in vitro according to the kit, and purified by precipitation or the like to obtain a biologically active sgRNA. The purification method of sgRNA includes but is not limited to a precipitation method, a glass fiber membrane or a magnetic bead adsorption method.

[0008] In a third aspect, the present invention provides the use of the above-mentioned kit for in vitro transcription of sgRNA in CRISPR / Cas9-mediated gene editing.

[0009] Furthermore, the present invention provides the use of the above-mentioned kit for in vitro transcription of sgRNA in CRISPR / Cas9-mediated locust gene editing.

[0010] In the above technical solution, the sequence of the target gene target site LmCrz T1 of the migratory locust is shown as SEQ ID NO.1.

[0011] In the above technical solution, the sequence of the target gene target site LmCrz T2 of the migratory locust is shown as SEQ ID NO.9.

[0012] In the above technical solution, the target gene target site LmVgA T6 sequence of the migratory locust is shown in SEQ ID NO.13.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] The present invention mainly utilizes short primers (less than 59 nt) to assemble sgRNA in vitro transcription templates, which is low-cost and high-efficiency compared to other methods (obtaining in vitro transcription templates using plasmids or long primers).

[0015] When synthesizing sgRNA using the kit product of the present invention, it is only necessary to design the target site sequence primer pair according to the target gene target site sequence, and use it in conjunction with the specific terminal primer pair and sgRNA backbone primer pair designed by the present invention, and quickly assemble the sgRNA in vitro transcription template by the PCR method, and then obtain sgRNA by in vitro transcription and purification. This scheme can adapt to CRISPR / Cas9 gene editing of different target sites, with fast experimental efficiency and low cost.

[0016] The present invention uses a specific terminal primer pair, a target site sequence primer pair and an sgRNA backbone primer pair to quickly assemble an sgRNA in vitro transcription template by PCR; after purification, the template can be used to perform in vitro transcription of sgRNA using a T7 in vitro transcription kit, and purified by precipitation and other methods to obtain a biologically active sgRNA; finally, the CRISPR / Cas9 technology is used to detect its editing efficiency and specificity by microinjection. The results show that the sgRNA synthesized by in vitro transcription of the present invention has strong specificity and high activity, and successfully cuts the DNA double strand at the target site. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the selection of the LmCrz T1 target site in Example 1 of the present invention.

[0018] Figure 2 The figure is a schematic diagram of the assembly process of the sgRNA in vitro transcription template in Example 1 of the present invention.

[0019] Figure 3 This is the electrophoresis detection result of the sgRNA in vitro transcription template in Example 1 of the present invention.

[0020] Figure 4 This is the electrophoresis detection result of LmCrz T1-sgRNA in Example 1 of the present invention.

[0021] Figure 5 This is the comparison result of the egg stage sequencing result and the wild-type gene sequence in Example 1 of the present invention.

[0022] Figure 6 This is the selection of the LmCrz T2 target site in Example 2 of the present invention.

[0023] Figure 7 The results of egg stage sequencing in Example 2 of the present invention are compared with the wild-type gene sequence.

[0024] Figure 8 This is the selection of the LmVgA T6 target site in Example 3 of the present invention.

[0025] Fig. 9 The results of egg stage sequencing in Example 3 of the present invention are compared with the wild-type gene sequence. DETAILED DESCRIPTION

[0026] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified.

[0027] Embodiment 1

[0028] 1.1 Materials

[0029] Test insects: The migratory locusts used in the experiment are a gregarious strain that has been raised stably for a long time in the insect room of the Key Laboratory of Cotton Biology of Henan University. The migratory locusts were raised in metal cages with good air permeability and light transmittance, at a room temperature of 30±2℃, 14h of light per day, and a relative humidity of 15%-25%. They were fed with fresh wheat seedlings and their feces and other garbage were cleaned up in time.

[0030] Main reagent: TrueCut TM Cas9 Protein v2 (Invitrogen), HiScribe TM T7 High Yield RNA Synthesis Kit (NEB Overview), Gold Mix (Qingke Biotech), Animal Genomic DNA Extraction Kit (Magen Biotech), etc.

[0031] Main instruments: micromanipulation system (Eppendorf), P-97 microelectrode needle puller (SUTTER), glass capillary needle grinder (Microgrinder) / EG-401 (NARISHIGE), PCR instrument (Eppendorf), micro-spectrophotometer / Nanodrop2000 (Thermo), IPP55 semiconductor low-temperature incubator (Memmert), electric tissue grinder (Tian Gen), fully automatic nucleic acid extractor (Magen Biotech), etc.

[0032] 1.2sgRNA target site selection

[0033] A potential target site of CRISPR / Cas9 system was selected on the second exon of Locusta migratoria melanization-inducing neuropeptide (Corazonin, Crz), named LmCrz T1. Figure 1 As shown, the sequence of LmCrz T1 is as follows: GAGCGTGGCGCTGCTGGCGGTGG (SEQ ID NO. 1).

[0034] 1.3 PCR amplification and purification of sgRNA in vitro transcribed template

[0035] (1) Assembling DNA templates for in vitro transcription of sgRNA by PCR

[0036] According to the target site sequence, the relevant primers of sgRNA were designed (Table 1), and the primers were used to perform PCR assembly on the in vitro transcribed DNA template of sgRNA. The DNA template sequence is as follows: 5'-TGCTAATACGACTCACTATAGGAGCGT GGCGCTGCTGGCGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT TATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' (SEQ ID NO.2). The assembly process is shown in the figure below. Figure 2 shown.

[0037] Table 1 sgRNA related primer sequences

[0038]

[0039]

[0040] The PCR reaction system of the sgRNA in vitro transcription template is shown in Table 2.

[0041] Table 2 PCR reaction system of sgRNA template

[0042] Reagents Volume (μL) 1μM sgRNA constant.F 0.5 1μM sgRNA constant.R 0.5 1μM LmCrz T1.F 0.5 1μM LmCrz T1.R 0.5 10μΜ UniT7pro.F 1 10μM Uni.R 1 Gold Medal Mix 21 Total Reaction Volume 25

[0043] The above system was thoroughly mixed and centrifuged instantaneously, and then the template for sgRNA in vitro transcription was assembled by PCR according to the following procedure: 98°C, 2min; 98°C, 10s, 58°C, 10s, a total of 32 cycles; 72°C, 1min; 4°C, forever. After the PCR reaction was completed, the PCR amplification product was detected by 2% agarose gel electrophoresis. The results were as follows Figure 3 shown.

[0044] (2) Purification of sgRNA in vitro transcription template (optional)

[0045] Place the gel block after electrophoresis under a gel cutter, find and cut the gel block with the target band (121bp), and perform gel recovery. The steps are as follows:

[0046] ① Compare the marker bands under the gel imaging instrument, quickly find and cut the target band containing DNA fragments, absorb all the water on the surface of the gel and chop it, try to remove the excess gel, weigh the remaining gel, and take 100 mg of gel as 100 μL volume as a gel volume.

[0047] ②Put the recovered gel into a 2mL centrifuge tube and add an equal volume of Buffer GDP. Place in a 54℃ water bath for 8 minutes to ensure that the gel is completely dissolved. Invert and mix during the water bath to accelerate the dissolution of the gel.

[0048] ③ After a brief centrifugation, collect the droplets on the tube wall, place the adsorption column in a 2 mL collection tube, transfer the sol solution to the adsorption column, and centrifuge at 12000 rpm for 60 seconds.

[0049] ④Discard the filtrate and place the adsorption column in a collection tube. Add 300 μL of Buffer GDP to the adsorption column and let it stand for 1 minute. Centrifuge at 12000 rpm for 60 seconds.

[0050] ⑤Discard the filtrate and place the adsorption column in a collection tube. Add 700 μL Buffer GW (with anhydrous ethanol) to the adsorption column. Centrifuge at 12000 rpm for 60 seconds.

[0051] ⑥Repeat step ⑤ to ensure that the salt is completely removed to eliminate the impact on subsequent experiments.

[0052] ⑦Discard the filtrate and put the adsorption column back into the collection tube. Centrifuge at 12000rpm for 2min.

[0053] ⑧Place the adsorption column in a 1.5mL sterilized centrifuge tube, add 20μL H2O to the center of the adsorption column, and place it for 2 minutes. Centrifuge at 12000rpm for 1 minute. Discard the adsorption column and store the DNA at -20℃.

[0054] 1.4 In vitro transcription and purification of LmCrz T1-sgRNA

[0055] (1) Set up the following in vitro transcription reaction and configure the reaction system according to Table 3.

[0056] Table 3 sgRNA in vitro transcription reaction system

[0057]

[0058]

[0059] The system was thoroughly mixed and centrifuged instantaneously, and reacted at 37°C for 4 hours. After the reaction was completed, 1 μL DNaseI was added to the reaction mixture, and the reaction was continued at 37°C for another 15 minutes.

[0060] (2) Purification of LmCrz T1-sgRNA

[0061] ① Add 400 μL Trizol to the in vitro transcribed solution and let it stand at room temperature for 5 minutes.

[0062] ② Add 500 μL of chloroform (CHCl3), shake by hand for 2 minutes, place on ice for 5 minutes, and centrifuge at 4°C, 12,000 rpm for 15 minutes.

[0063] ③ Transfer the aqueous phase to a new 1.5mL EP tube, add 500μL isopropanol, and place at -20℃ for precipitation for 2h or overnight.

[0064] ④ Centrifuge, 4℃, 12000rpm, 15min, and discard the supernatant.

[0065] ⑤ Wash, add 500 μL pre-cooled 75% anhydrous ethanol. Centrifuge, 4°C, 12000 rpm, 5 min, and discard the supernatant.

[0066] ⑥Repeat step ⑤.

[0067] ⑦ Centrifuge, 4℃, 12000rpm, empty for 2min.

[0068] ⑧ After centrifugation, place in a clean bench for ventilation (to exclude alcohol disturbance) for 15 minutes, blow at an angle. Add 20 μL ddH2O to dissolve, mix well, place at 4°C, and dissolve for 20 minutes.

[0069] ⑨After dissolution, take 1 μL sgRNA + 9 uL ddH2O, detect the concentration and purity using NanoDrop 2000 ultra-micro spectrophotometer, divide and freeze at -80℃.

[0070] LmCrz T1-sgRNA was detected by 2% agarose gel electrophoresis. Figure 4 shown.

[0071] 1.5 Activity Detection

[0072] The obtained LmCrz T1-sgRNA and Cas9 protein were mixed (sgRNA final concentration 300 ng / μL, Cas9 protein final concentration 400 ng / μL), incubated at 37°C for 40 min, placed on ice, and microinjected into locust fertilized eggs.

[0073] On the second day of fertilized egg culture, 16 eggs were randomly sampled, the genome was extracted, and the LmCrz gene fragment was amplified. The PCR stock solution after amplifying the LmCrz gene fragment was sent to the company for sequencing. The results are as follows Figure 5 As shown, WT is the wild-type genotype, and Samples 1 to 3 are the sequencing results of the egg stage. From the gene sequence comparison results, it can be seen that there is a hybrid peak near the target site of the LmCrz gene, indicating that the LmCrz gene editing is successful. Through sequencing, 15 out of 16 fertilized eggs have hybrid peaks in the sequence, and the editing success rate is 93.75%.

[0074] Embodiment 2

[0075] In this example, a potential target site of the CRISPR / Cas9 system was selected on the second exon of the melanization-inducing neuropeptide (Corazonin, Crz) of locust (Locusta migratoria), and was named LmCrz T2. Figure 6 As shown, the sequence of LmCrz T2 is as follows: GCAGCCTGAGGCAGCGCACGCGG (SEQ ID NO. 9).

[0076] The relevant primers of sgRNA were designed according to the target site sequence (Table 4), and the primers were used to PCR assemble the DNA template of sgRNA. The DNA template sequence is as follows: 5'-TGCTAATACGACTCACTATAGGCAGCCTGAGGC AGCGCACGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC TTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' (SEQ ID NO.10). The PCR reaction system and procedure, purification of sgRNA in vitro transcription template, and sgRNA in vitro transcription and purification steps are the same as in Example 1.

[0077] Table 4 sgRNA related primer sequences

[0078]

[0079] The obtained LmCrz T2-sgRNA and Cas9 protein were mixed (sgRNA final concentration 300 ng / μL, Cas9 protein final concentration 400 ng / μL), incubated at 37°C for 40 min, placed on ice, and microinjected into locust fertilized eggs.

[0080] On the second day of fertilized egg culture, 16 eggs were randomly sampled, the genome was extracted, and the LmCrz gene fragment was amplified. The PCR stock solution after amplifying the LmCrz gene fragment was sent to the company for sequencing. The results are as follows Figure 7 As shown, WT is the wild-type genotype, and Samples 1 to 3 are the sequencing results of the egg stage. From the gene sequence comparison results, it can be seen that there is a hybrid peak near the target site of the LmCrz gene, indicating that the LmCrz gene editing is successful. Through sequencing, 12 out of 16 fertilized eggs have hybrid peaks in the sequence, and the editing success rate is 75%.

[0081] Embodiment 3

[0082] In this example, a potential target site of the CRISPR / Cas9 system was selected from the coding sequence of the vitellogenin gene VgA of Locusta migratoria, and was named LmVgA T6. Figure 8As shown, the LmVgA T6 sequence is as follows: AGTATGGTTGCTTGCATGACAGG (SEQ ID NO. 13).

[0083] The relevant primers of sgRNA were designed according to the target site sequence (Table 5), and the primers were used to PCR assemble the DNA template of sgRNA. The DNA template sequence is as follows: 5'-TGCTAATACGACTCACTATAGAGTATGGTTGCT TGCATGACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC TTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' (SEQ ID NO.14). The PCR reaction system and procedure, purification of sgRNA in vitro transcription template, and sgRNA in vitro transcription and purification steps are the same as in Example 1.

[0084] Table 5 sgRNA related primer sequences

[0085]

[0086] The obtained LmVgA T6-sgRNA and Cas9 protein were mixed (sgRNA final concentration 300 ng / μL, Cas9 protein final concentration 400 ng / μL), incubated at 37°C for 40 min, placed on ice, and microinjected into locust fertilized eggs.

[0087] On the second day of fertilized egg culture, 16 eggs were randomly sampled, the genome was extracted, and the LmVgA gene fragment was amplified. The PCR stock solution after amplifying the LmVgA gene fragment was sent to the company for sequencing. The results are as follows Fig. 9 As shown, WT is the wild-type genotype, and Samples 1 to 3 are the sequencing results of the egg stage. From the gene sequence comparison results, it can be seen that a hybrid peak appears near the target site of the LmVgA gene, indicating that the LmVgA gene editing is successful. Through sequencing, 14 out of 16 fertilized eggs have hybrid peaks in their sequences, and the editing success rate is 87.5%.

[0088] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, other implementation methods can certainly be easily made by replacement or modification based on the technical contents disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. A method for assembling an sgRNA in vitro transcription template using a short primer, characterized in that: The following steps are involved: a) selecting a target gene target site; b) designing a target site sequence primer pair based on the target gene target site sequence, and then combining a specific terminal primer pair and an sgRNA backbone primer pair to quickly assemble an sgRNA in vitro transcription template by a PCR method; the specific terminal primer pair sequence is shown in SEQ ID NO.3 and SEQ ID NO.4; the sgRNA backbone primer pair sequence is shown in SEQ ID NO.5 and SEQ ID NO.

6.

2. A kit for in vitro transcription of sgRNA, characterized in that: Contains the specific end primer pair according to claim 1, the sgRNA backbone primer pair according to claim 1, and a target site sequence primer pair.

3. Use of the kit for in vitro transcription of sgRNA according to claim 2 in CRISPR / Cas9-mediated gene editing.

4. Use of the kit for in vitro transcription of sgRNA according to claim 2 in CRISPR / Cas9-mediated gene editing of locusts.

5. The use according to claim 4, characterized in that: The target gene target site LmCrz T1 sequence of the migratory locust is shown as SEQ ID NO.

1.

6. The use according to claim 4, characterized in that: The target gene target site LmCrz T2 sequence of the migratory locust is shown in SEQ ID NO.

9.

7. The use according to claim 4, characterized in that: The target gene target site LmVgA T6 sequence of the migratory locust is shown in SEQ ID NO.13.

Images