Sea buckthorn sex identification specific primer, identification method and application
By developing specific primers for gender identification of Gymph sea buckthorn, using whole genome resequencing and bioinformatics analysis, rapid and accurate gender identification of Gymph sea buckthorn was achieved, solving the problem of difficult gender identification in the existing technology, and improving gender identification Accuracy and applicability.
Patent Information
- Application Number
- CN202411592095.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-06
- Publication Date
- 2025-02-11
AI Technical Summary
The difficulty in identifying the gender of Gymph sea buckthorn quickly and accurately limits the in-depth study of its gender determination mechanism and gender ratio.
A specific primer for gender identification of gypsum sea buckthorn was developed. Through whole-genome resequencing and bioinformatics analysis, gender-specific sites were screened out, and two specific primers, Higy_04 and Higy_06 were designed, and PCR amplification and agarose coagulation were used. Glue electrophoresis analysis achieves gender identification.
The rapid and accurate gender identification of Jiangzi sea buckthorn was achieved, with an accuracy rate of 100%, strong applicability, and able to reliably distinguish male and female plants under different genetic backgrounds, simplifying the breeding and cultivation process.
Smart Images
Figure CN119410815A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of biological identification, and in particular to a specific primer for sex identification of Jiangzi seabuckthorn, an identification method and application. Background Art
[0002] Gyangze Seabuckthorn Hippophae gyantsensis ) belongs to the genus Hippophae rhamnoides of the family Elaeagnaceae ( Hippophae ), is a species endemic to the Qinghai-Tibet Plateau, mainly distributed in the Yarlung Zangbo River Basin of the Qinghai-Tibet Plateau, riverbed gravel and river floodplain areas at an altitude of 3,500 to 5,000 meters. As one of the important plants on the Qinghai-Tibet Plateau, Jiangzi Seabuckthorn plays an irreplaceable role in the extreme ecological environment of Qinghai-Tibet. It is a dioecious deciduous tree with strong environmental adaptability. It can survive in extreme conditions such as high cold, drought, and saline-alkali, and is highly adaptable to a variety of soil types. This strong adaptability makes it a key species for ecological restoration, vegetation reconstruction, and windbreak and sand fixation. For example, it is planted in large quantities in the greening project of the North and South Mountains in Lhasa. As a non-leguminous woody nitrogen-fixing plant, Jiangzi Seabuckthorn coexists with Frankia bacteria, can form nodules, fix nitrogen in the atmosphere, and thus significantly improve soil fertility and enhance the productivity of the ecosystem. Its rapid growth and strong asexual reproduction ability make it of great value in restoring degraded land and improving the ecological environment. In addition, the roots, stems, leaves, flowers and fruits of Jiangzi Seabuckthorn are rich in flavonoids, vitamin C, superoxide dismutase (SOD) and other bioactive substances, and have significant nutritional and medicinal value. These ingredients have shown good therapeutic effects in the prevention and treatment of coronary heart disease, tumors and other diseases, making it have broad development prospects in the fields of medicine, health products and functional foods.
[0003] Although Jiangzi seabuckthorn has important ecological and economic value, research on its sex determination mechanism and sex identification technology is relatively scarce. Among angiosperms, about 6% of species are dioecious plants. These species are widely distributed in different plant lineages, and their sex evolution and determination mechanism have always been an important topic in botanical research. Studies have shown that all seabuckthorn plants are diploid and use an XY sex determination system, that is, males are XY and females are XX. However, in natural populations, seabuckthorn plants often show a phenomenon of sex imbalance, especially in Tibetan seabuckthorn ( Hippophae tibetana ) and Hippophae rhamnoides L. ( Hippophae rhamnoides subsp. turkestanica), the proportion of male plants was significantly higher than that of female plants. This gender bias may be related to the difference in environmental adaptability between male and female plants. Male plants usually show stronger survival ability when facing extreme environmental conditions (such as low temperature, drought, and poor soil); while female plants may be more sensitive to environmental pressure and have relatively weaker adaptability due to their higher energy and resource requirements during the reproductive process. However, the specific cause of this gender imbalance is still unclear. Whether it is determined by the genetic factors of the seeds or caused by the environmental adaptability of the seeds after germination, further research is needed.
[0004] At present, the study of the sex determination mechanism and sex ratio of Jiangzi seabuckthorn is still in its infancy, partly due to the lack of effective sex identification methods. Since the male and female plants of Jiangzi seabuckthorn cannot be distinguished by morphological characteristics before flowering, and it usually takes 3 to 4 years for the seedlings to grow to sexual maturity, coupled with its small inflorescence and short flowering period, it is difficult to identify its sex in a timely and accurate manner even during the flowering period. These factors limit the in-depth study of the adaptive differences and sex determination mechanisms of male and female plants of Jiangzi seabuckthorn. Therefore, it is particularly important to develop a rapid and accurate molecular marker technology to identify the sex of Jiangzi seabuckthorn at an early stage.
[0005] In recent years, with the development of molecular biology technology, molecular marker technology has been widely used in early sex identification of dioecious plants. Actinidia chinensis ),spinach( Spinacia oleracea ),papaya( Carica papaya ) and other plants, researchers have successfully developed sex-specific molecular markers by screening genetic differences in sex-specific gene regions, achieving sex identification at the seedling stage. In Hippophae rhamnoides, some molecular markers for sex identification have been developed, but their applicability is usually limited to specific species or geographical regions, lacking broad versatility and reliability. For example, Zeng et al. developed three pairs of sex-specific molecular markers by whole-genome resequencing of male and female individuals of Tibetan Hippophae rhamnoides in my country, which can accurately distinguish male and female plants of Tibetan Hippophae rhamnoides by PCR. However, preliminary experimental results showed that these markers are only effective in Tibetan Hippophae rhamnoides and cannot be used in other Hippophae rhamnoides species such as Gyantse Hippophae rhamnoides, reflecting the complexity of the sex determination mechanism of Hippophae rhamnoides plants. Summary of the invention
[0006] The purpose of the present invention is to provide a specific primer for sex identification of Hippophae rhamnoides L., an identification method and application thereof, so as to solve the problems raised in the above-mentioned background technology.
[0007] To achieve the above object, the present invention provides the following technical solutions: A specific primer for sex identification of Jiangzi seabuckthorn, comprising a Higy_04 primer pair or a Higy_06 primer pair, wherein the Higy_04 primer pair comprises: Forward primer Higy_04F: 5'-CCCCCTTAGTCACTACCAACAC-3', Reverse primer Higy_04R: 5′-ATCCCATCGATCATCACCATCC-3′; Higy_06 primer pair includes: Forward primer Higy_06F: TAATCTGGTGCCTCTCGATCAATT, Reverse primer Higy_06R: TCTGTACAATTTATGCAGCACCAC.
[0008] A method for sex identification of Gyantse seabuckthorn, using the Gyantse seabuckthorn sex identification specific primers, the identification steps are: S1. Extracting genomic DNA from the tested Gyantse seabuckthorn plants; S2, PCR amplification: using the genomic DNA extracted in step S1 as an amplification template and Higy_04 primer pair or Higy_06 primer pair as amplification primers, PCR amplification is performed; S3. Result analysis: The amplified product of step S2 is analyzed by agarose gel electrophoresis. If two bands are generated, the tested seabuckthorn plant in Gyantse is a male plant; if one band is generated, the tested seabuckthorn plant in Gyantse is a female plant.
[0009] Preferably, the total volume of the reaction system for PCR amplification in step S2 is 30 μL, and the reaction system comprises: Taq enzyme premix: 15 μL, DNA template: 1 μL, 10 μM forward primer: 1 μL, 10 μM reverse primer: 1 μL, Deionized water: 12 μL.
[0010] Preferably, the reaction conditions for PCR amplification in step S2 are: Pre-denaturation at 95°C for 3 minutes; 35 cycles: denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, and extension at 72°C for 30 seconds; Final extension at 72°C for 5 min; Store at 4°C.
[0011] The construction method of specific primers for sex identification of Jiangzi seabuckthorn is as follows: E1. Sample collection and DNA extraction: Gender-identified plant samples were collected from different populations of Hippophae rhamnoides L. in Gyangze, and tender leaves of female and male plants were collected respectively. To ensure the representativeness of the samples and avoid repeated sampling, appropriate distances were maintained between sampling points. Genomic DNA was extracted using the modified CTAB method, and the quality and concentration of DNA were evaluated to ensure that it met the requirements of subsequent experiments. E2. Whole genome resequencing and data processing: The qualified DNA samples were sent to professional sequencing institutions for whole genome resequencing using a high-throughput sequencing platform, with a target sequencing depth of 30×. The original sequencing data were quality controlled and filtered to ensure data quality. Then, the filtered sequences were aligned to the reference genome of Hippophae rhamnoides L. in Gyangze for variant detection and analysis. E3. Sex-specific site screening: Compare the genomic differences between male and female plants, focus on male-specific insertion / deletion (InDel) variation sites, and screen out sex-specific sites that exist only in male samples as candidate markers; E4. Sex-specific primer design Design specific primers based on the screened sex-specific loci; design primer pairs that can distinguish male and female plants through PCR amplification, taking into account the length differences of the variable regions; primer design must ensure specificity, efficiency and reliability; E5. Primer verification and sex identification: Use the designed primers to perform PCR amplification on samples of Jiangzi seabuckthorn of known gender to verify the specificity and accuracy of the primers; analyze the PCR products by gel electrophoresis to determine whether the primers can effectively distinguish between male and female plants; E6. Primer suitability test: The screened sex-specific primers will be applied to more samples of Jiangzi seabuckthorn to verify their applicability and reliability in different populations; ensuring that the primers can accurately identify the sex of plants under different genetic backgrounds.
[0012] Application of specific primers for sex identification of Hippophae rhamnoides L. in identifying the sex of Hippophae rhamnoides L. in Gyantse.
[0013] Compared with the prior art, the present invention has the following beneficial effects: (1) The method is simpler: Compared with the sex identification method that requires complex equipment and high-cost sequencing technology, the method of the present invention is simple to operate, low-cost, and easy to promote and apply in actual production; (2) Higher accuracy: With the support of whole genome resequencing data, the developed molecular markers are significantly superior to traditional molecular marker technology in terms of the accuracy of sex identification; (3) High accuracy: When verifying samples from different populations of sea buckthorn in Jiangzi (a total of 48 samples, 24 males and 24 females), the accuracy rate of sex identification reached 100%, and male and female plants can be reliably distinguished; (4) Strong universality: The developed molecular markers have shown good applicability in multiple geographical populations of sea buckthorn in Jiangzi, proving that they have high reliability under different genetic backgrounds.
[0014] In summary, the present invention has made an important breakthrough in the development of sex-specific molecular markers of Jiangzi seabuckthorn, and has significant advantages in high efficiency, reliability and practicality. It can meet the urgent needs of Jiangzi seabuckthorn breeding, cultivation and research, and is of great significance to promoting the research and industrial development of seabuckthorn plants. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 The two primer pairs Higy_04 and Higy_06 in the present invention were used to verify the gender differentiation of male and female individuals from different regions. DETAILED DESCRIPTION
[0016] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0017] The construction method of specific primers for sex identification of Jiangzi seabuckthorn is as follows: 1. Sample collection and DNA extraction Field sampling was conducted in three different populations of Hippophae rhamnoides L. in Gyangze, Tibet. Plant sex was identified based on floral morphology, and tender leaf samples were randomly collected from eight female and eight male plants in each population. To avoid collecting tillers from the same mother plant, the linear distance between each sample was at least 50 meters. The collected leaf samples were placed in a sealed container containing silica gel for drying and then stored in a -20°C refrigerator for later use.
[0018] The improved CTAB method was used to extract the genomic DNA of Hippophae rhamnoides L. from Gyangze. The specific steps are as follows: (1) Tissue grinding: Take an appropriate amount of dried leaf samples, place them in a mortar, add liquid nitrogen and grind them into fine powder; (2) Cell lysis: Transfer the ground sample to a centrifuge tube, add preheated CTAB extraction buffer, mix well, and incubate in a 65°C water bath for 30 minutes, gently inverting and mixing every 5 minutes; (3) Removal of proteins and impurities: Add an equal volume of chloroform-isoamyl alcohol (24:1), mix thoroughly, centrifuge at 12,000 rpm for 10 minutes, and collect the supernatant; (4) DNA precipitation: Add 0.6 volumes of ice-cold isopropanol to the supernatant, mix gently, and let stand at 4°C for 30 minutes to precipitate the DNA. (5) DNA collection and washing: Centrifuge at 12,000 rpm for 10 minutes, discard the supernatant and retain the precipitate; wash the precipitate with 70% ice-cold ethanol, discard the ethanol after centrifugation, and air dry; (6) DNA dissolution: Dissolve the dried DNA precipitate in an appropriate amount of TE buffer and store at 4°C for later use; (7) Use NanoDrop 2000 spectrophotometer to assess the quality and concentration of DNA, ensuring that the OD260 / 280 ratio is between 1.8 and 2.0 and that the concentration meets the requirements for subsequent sequencing.
[0019] 2. Whole genome resequencing and data processing DNA samples with qualified quality were sent to professional sequencing companies (such as Beijing Novogene Technology Co., Ltd.) for library construction. Paired-end sequencing was performed using the Illumina NovaSeq X Plus PE150 platform, with a target sequencing depth of 30× to ensure the accuracy of subsequent analysis. The obtained raw sequencing data were first quality controlled using Fastp v0.21 software to remove low-quality reads and adapter sequences. The quality control parameters were set by default. The quality-controlled data were evaluated using FastQCv0.11.9 to ensure that the data quality met the requirements of subsequent analysis.
[0020] 3. Population variation detection and sex-specific locus screening The quality-controlled reads were aligned to the reference genome of Hippophae rhamnoides L. (the reference genome was derived from female plants) using BWA v2.2.1 software. The default values were used for alignment parameters. The alignment results were converted and sorted using Samtools v1.19 to generate BAM format files.
[0021] GATK4 v4.2 was used for detection and preliminary filtering of insertion / deletion (InDel) variations. The specific steps included: (1) Remove PCR duplicates: Use the MarkDuplicates tool to mark and remove PCR duplicate sequences; (2) Single sample variation detection: Use HaplotypeCaller to perform variation detection on a single sample and generate a GVCF file; (3) Population variation detection: Use GenotypeGVCFs to perform joint variation detection on the GVCF files of all samples to generate a population variation set; (4) Variant site filtering: Mark and filter low-quality InDel sites according to this standard: QD<2.0 || FS>200.0 || SOR>10.0 || MQRankSum<-12.5 || ReadPosRankSum<-8.0; Plink v1.9 was used to further filter the variant sites, excluding sites with a minor allele frequency (MAF) lower than 0.01 and more than 50% missing genotype data; ultimately, a high-quality set of variant sites was obtained for subsequent sex-specific site screening.
[0022] Given that Hippophae rhamnoides L. is a diploid XY sex determination system and the reference genome is derived from female plants, the focus is on the alignment differences between male and female plants at the same sites in the reference genome. The Python script written by Zeng et al. (2024) was used to screen sites with long insertion or deletion (InDel) variations only in male samples.
[0023] 4. Verification of sex-specific loci and primer design The Integrative Genomics Viewer (IGV) was used to manually verify the selected candidate sex-specific loci. The specific steps are as follows: (1) Visualize the comparison results: Load the BAM files of male and female samples and the reference genome in IGV and locate the candidate variant sites; (2) Verify the type of variation: confirm whether there is a clear long-segment insertion or deletion in male samples, but no such variation in female samples, to ensure that the site is sex-specific; (3) Select candidate regions: Select sites with obvious variation and high coverage in male samples as candidate regions for primer design.
[0024] SeqKit v2.6.1 was used to extract 1,000 bp sequences on both sides of the candidate variation site from the reference genome for primer design; since the length difference between male and female individuals in the candidate region was mostly 30-60 bp, in order to design specific primers that can distinguish between male and female plants, the target PCR product length was set to 200-300 bp.
[0025] Primer3 v2.3.7 software was used for primer design. The design principles include: Primer length: 18-25 bases; GC content: 40%-60%; Annealing temperature (Tm value): 58-62°C, the difference between the Tm values of the front and rear primers should not exceed 1°C; Avoid secondary structures: Avoid the formation of hairpin structures and dimers between primers and themselves.
[0026] The designed primers were compared with the reference genome using BLASTn v2.5.0 to ensure the specificity of the primers and avoid nonspecific amplification.
[0027] 5. Validation of sex-specific primers Firstly, DNA samples of Jiangzi seabuckthorn with known sex (including 2 females and 2 males) were selected, and PCR amplification was performed using the designed primers to preliminarily screen specific primers that can accurately distinguish between male and female plants.
[0028] The total volume of the PCR amplification reaction system is 30 μL and is prepared as follows: Taq enzyme premix: 15 μL, DNA template: 1 μL, Forward primer (10 μM): 1 μL, Reverse primer (10 μM): 1 μL, Deionized water: 12 μL.
[0029] The PCR amplification program was set as follows: Pre-denaturation at 95°C for 3 minutes; 35 cycles: denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, and extension at 72°C for 30 seconds; Final extension at 72°C for 5 min; Store at 4°C.
[0030] The PCR products were analyzed by 2% agarose gel electrophoresis at 120 V for 30 min, and the bands were visualized using a gel imaging system.
[0031] Based on the electrophoresis results, primers that present specific bands in male samples but no such bands in female samples or have significantly different band lengths are screened out as sex-specific molecular markers.
[0032] 6. Universality verification of primers The screened sex-specific primers were applied to more Gyantse seabuckthorn samples, including sex-identified plants from different geographical populations, to verify the applicability and accuracy of the primers in different genetic backgrounds.
[0033] Specific steps: Sample selection: Randomly select a certain number of male and female plants (e.g. 24 plants each) from different populations and extract DNA; PCR amplification: Amplify according to the above PCR conditions; Result analysis: The amplification of primers in different samples was statistically analyzed and the accuracy of gender identification was calculated.
[0034] as follows Figure 1 The screened primers were then used to verify the accuracy of 48 samples (24 females and 24 males) collected from three populations of Gyantse seabuckthorn in Linzhi (LZ), Lhasa (LS) and Shannan (CN) in Tibet. The results showed that both pairs of primers could accurately distinguish between the female and male samples involved in the test: two bands were produced in all male samples, while one band was produced in female samples.
[0035] The construction method of the embodiment of the present invention can efficiently identify sex-specific fragments. By adopting the method of whole genome resequencing combined with bioinformatics analysis, the construction method of the embodiment of the present invention greatly improves the efficiency of identifying sex-specific fragments. Specifically: (1) High-throughput data support: Using high-depth (30×) whole-genome resequencing data to ensure the accuracy and comprehensiveness of detecting variant sites; (2) Accurate variant screening: Using advanced data analysis tools and methods, we screened out male-specific long insertion / deletion (InDel) variant sites and effectively identified sex-specific fragments; (3) Reliable manual verification: The selected candidate loci are manually verified through visualization tools such as IGV to ensure the authenticity and reliability of the sex-specific loci.
[0036] Compared with traditional methods such as random amplified polymorphic DNA (RAPD) and amplified fragment length polymorphism (AFLP), the construction method of the embodiment of the present invention has higher efficiency and accuracy in identifying sex-specific fragments, avoiding misjudgment caused by poor randomness and repeatability.
[0037] The present invention successfully designed and verified two pairs of specific primers (Higy_04 and Higy_06) for sex identification, which have the following advantages: (1) High accuracy: When verifying samples from different populations of Hippophae rhamnoides L. in Gyangze (a total of 48 samples, 24 males and 24 females), the accuracy of sex identification reached 100%, and it was able to reliably distinguish between male and female plants; (2) Strong universality: The developed molecular markers have shown good applicability in multiple geographical populations of Hippophae rhamnoides L. in Gyangze, proving that they are highly reliable in different genetic backgrounds; (3) Easy operation: Gender identification can be completed using conventional PCR technology combined with agarose gel electrophoresis. The experimental steps are simple and easy to operate, and do not require expensive equipment and complex experimental conditions.
[0038] The sex-specific primers of the present invention can realize rapid and accurate sex identification at the seedling stage of Jiangzi seabuckthorn, and have the following positive effects: (1) Shorten the identification cycle: It avoids the long cycle of waiting 3-4 years for the plants to bloom before identifying their sex, significantly speeding up the breeding and cultivation process; (2) Reduce costs: The required male and female plants can be selected during the seedling stage, which reduces resource waste and management costs and improves economic benefits; (3) Optimizing planting strategies: Breeders and growers can adjust the ratio of male and female plants according to production needs, such as increasing the proportion of female plants to increase fruit yield, or adjusting the proportion of male plants to enhance the ecological adaptability of the population.
[0039] At present, there is no relevant report on sex-specific primers for Hippophae rhamnoides L. in Jiangzi. The present invention fills this technical gap: (1) Highly innovative: For the first time, sex-specific molecular markers were developed in Hippophae rhamnoides L., enriching the research content of sex identification of Hippophae rhamnoides L. plants; (2) Scientific research value: It provides important molecular tools for further studying the sex determination mechanism and sex chromosome evolution of Hippophae rhamnoides L. in Gyangze, and has important scientific research significance; (3) Promoting industrial development: It will help promote the development of industries related to seabuckthorn in Gyantse, such as ecological restoration, development of medicinal resources and production of functional foods, and bring good social and economic benefits.
[0040] Compared with the prior art, the main advantages of the present invention are embodied in the following two aspects: (1) The method is simpler: Compared with the sex identification method that requires complex equipment and high-cost sequencing technology, the method of the present invention is simple to operate, low-cost, and easy to promote and apply in actual production; (2) Higher accuracy: Supported by whole genome resequencing data, the developed molecular markers are significantly superior to traditional molecular marker technology in terms of the accuracy of sex identification.
[0041] In summary, the present invention has made an important breakthrough in the development of sex-specific molecular markers of Jiangzi seabuckthorn, and has significant advantages in high efficiency, reliability and practicality. It can meet the urgent needs of Jiangzi seabuckthorn breeding, cultivation and research, and is of great significance to promoting the research and industrial development of seabuckthorn plants.
[0042] Through the above analysis, the two pairs of sex-specific molecular markers designed by the present invention for distinguishing male and female plants of Gyangze seabuckthorn can be used to accurately identify the sex of Tibetan seabuckthorn (the specific information of the two pairs of primers is shown in Table 1).
[0043] Table 1: Sequence information of two pairs of sex-specific primers of Hippophae rhamnoides L. in Gyangze
Claims
1. A specific primer for sex identification of Hippophae rhamnoides L., characterized in that: It includes a Higy_04 primer pair or a Higy_06 primer pair, wherein the Higy_04 primer pair includes: Forward primer Higy_04F: 5'-CCCCCTTAGTCACTACCAACAC-3', Reverse primer Higy_04R: 5′-ATCCCATCGATCATCACCATCC-3′; Higy_06 primer pair includes: Forward primer Higy_06F: TAATCTGGTGCCTCTCGATCAATT, Reverse primer Higy_06R: TCTGTACAATTTATGCAGCACCAC.
2. A method for identifying the sex of seabuckthorn in Gyangze, characterized in that: Using the Gyantse seabuckthorn sex identification specific primers described in claim 1, the identification steps are: S1. Extracting genomic DNA from the tested Gyantse seabuckthorn plants; S2, PCR amplification: using the genomic DNA extracted in step S1 as an amplification template and Higy_04 primer pair or Higy_06 primer pair as amplification primers, PCR amplification is performed; S3. Result analysis: The amplified product of step S2 is analyzed by agarose gel electrophoresis. If two bands are generated, the tested seabuckthorn plant in Gyantse is a male plant; if one band is generated, the tested seabuckthorn plant in Gyantse is a female plant.
3. A method for identifying sex of Gyantse seabuckthorn according to claim 2, characterized in that: The total volume of the reaction system for PCR amplification in step S2 is 30 μL, and the reaction system includes: Taq enzyme premix: 15 μL, DNA template: 1 μL, 10 μM forward primer: 1 μL, 10 μM reverse primer: 1 μL, Deionized water: 12 μL.
4. A method for identifying sex of Gyantse seabuckthorn according to claim 3, characterized in that: The reaction conditions for PCR amplification in step S2 are: Pre-denaturation at 95°C for 3 minutes; 35 cycles: denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, and extension at 72°C for 30 seconds; Final extension at 72°C for 5 min; Store at 4℃.
5. Use of the Gyantse seabuckthorn sex identification specific primers according to claim 1 in identifying the sex of Gyantse seabuckthorn.