Application of TRIM3 gene or protein as target spot in screening medicines for inhibiting foot-and-mouth disease virus replication

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to application of a TRIM3 gene or protein serving as a target spot in screening of drugs for inhibiting foot and mouth disease virus replication. The method specifically comprises the following steps: firstly, constructing a TRIM3 knockout cell line by utilizing a CRISPR / Cas9 system, wherein the cell line obviously inhibits the replication of FMDV; secondly, according to the invention, a TRIM3 stable expression cell line is constructed by using a lentivirus packaging system, and the cell line promotes the replication of FMDV. Therefore, the inhibition or silencing of the TRIM3 gene / protein can inhibit the replication of the foot-and-mouth disease virus, can be used as a target spot for screening drugs for inhibiting the replication of the foot-and-mouth disease virus, provides some theoretical bases for preventing or inhibiting FMDV infection in the future, and has a wide application prospect.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and specifically relates to an application of a TRIM3 gene or protein as a target in screening a drug for inhibiting the replication of foot-and-mouth disease virus. Background Art

[0002] Foot-and-mouth disease (FMD) is an acute febrile animal disease caused by foot-and-mouth disease virus (FMDV). It mainly affects even-toed ungulates, such as cattle, pigs, sheep and some wild animals, seriously threatening their life and health and endangering the development of animal husbandry. The World Organization for Animal Health (WOAH) classifies it as a Class A animal disease. The disease is mainly transmitted between animals in close contact in the form of aerosols. At present, the overall epidemic of foot-and-mouth disease in my country remains stable, but there are still sporadic cases in some local areas, among which O-type and A-type foot-and-mouth disease viruses are the main epidemic strains. The typical characteristics of the disease are a short incubation period. Animals infected with foot-and-mouth disease have rapid clinical symptoms, manifested as mental depression, decreased appetite, and increased body temperature. At the same time, blisters appear in the mouth and hoofs, and the ulcer surface will be exposed after the blisters rupture. In particular, sick pigs will have symptoms such as lameness, refusal to stand and difficulty eating.

[0003] FMDV belongs to the genus Aphthaovirus of the family Picornaviridae. There are 7 different serotypes, namely O, A, C, Asia 1, SAT1, SAT2 and SAT3. Among the above 7 serotypes, O is the most prevalent strain in the world, and each serotype contains multiple subtypes. The FMDV genome is about 8.5kb in length and contains an open reading frame that encodes a polyprotein sequence. This polyprotein encodes two proteases, the leader (L pro ) and 3C protease (3C pro ) will be cut and processed into a series of precursor proteins and independent structural proteins and non-structural proteins. Among them, the structural proteins include VP1, VP2, VP3 and VP4. In addition, the virus also contains 8 non-structural proteins, namely L, 2A, 2B, 2C, 3A, 3B, 3C and 3D. Among these viral proteins, VP1, VP2 and VP3 together constitute the outer capsid surface of the virus, while VP4 plays a key role in the structural integrity of the inner capsid.

[0004] The CRISPR / Cas9 system is a type II adaptive immune system derived from Streptococcus pyogenes. It is mainly found in bacteria and archaea and is their unique mechanism to resist the invasion of foreign substances (such as viruses). The CRISPR / Cas9 system is mainly composed of crRNA and Cas9 proteins. The working principle of the system is to target and identify the target genome sequence through artificially synthesized sgRNA, thereby guiding the Cas9 protease to cut the DNA double strand in the recognition area to break it, activating the self-repair pathway of the cell genome, mainly based on end-linking and homologous recombination repair. However, the repair process is often accompanied by many phenomena such as insertion, deletion, mutation, and frameshift of bases, which cause earth-shaking changes in the subsequent transcription and translation processes. Therefore, the function of the target gene changes, and the knockout of the target gene is achieved. The CRISPR / Cas9 system is simple to operate, has a short cycle, and is highly efficient. It is one of the most widely used gene editing technologies.

[0005] Tripartite motif-containing protein (TRIM) is a class of proteins with extensive E3 ubiquitin ligase activity. Currently, more than 80 human TRIM family members are known. The structure of members of this family has similar characteristics, mainly composed of four key structures, namely the Ring zinc finger domain, the helical domain, the B-Box region and a variable C-terminus. The Ring zinc finger domain is the key domain for this type of protein to exert E3 ubiquitin ligase activity. TRIM family members are involved in a variety of biological processes in cells, such as cell signal transduction, cell apoptosis, carcinogenesis and autophagy. Literature reports that TRIM29 reduces P53 acetylation by degrading Tip60, leading to the proliferation of cancer cells and accelerating cell carcinogenesis. Overexpression of TRIM28 promotes the proliferation of cervical cancer cells.

[0006] As a member of the tripartite motif protein family, TRIM3 has a common structure of the TRIM family, as well as an immunoglobulin-like Filamin domain and an NHL domain. Currently, there are few reports on the role of TRIM3 in viral infection. Therefore, the present invention intends to analyze the TRIM3 genome sequence, establish knockout and overexpression cell lines, explore the role of TRIM3 in FMDV infection, and lay the foundation for further explaining the molecular mechanism of TRIM3 regulating FMDV replication. Summary of the invention

[0007] In response to the above technical problems, the invention first determines that TRIM3 is a key host factor for the replication of foot-and-mouth disease virus. Secondly, it is proved through experiments that the monoclonal cell line with TRIM3 gene deletion can significantly inhibit the expression of FMDV at the mRNA level and protein level, and effectively reduce the viral titer of the progeny virus; the TRIM3 overexpression cell line can significantly promote the expression of FMDV at the mRNA level and protein level and effectively increase the viral titer of the progeny virus. It shows that the present invention successfully constructed a knockout cell line and an overexpression cell line of the TRIM3 gene by utilizing the CRISPR / Cas9 system, and for the first time proved that TRIM3 plays a positive regulatory role in the replication process of FMDV, laying the foundation for the subsequent functional study of TRIM3 and the replication mechanism of FMDV regulated by TRIM3. Specifically including the following contents:

[0008] In a first aspect, the present invention provides an application of a TRIM3 gene / protein as a target in the preparation or screening of a drug for preventing or treating foot-and-mouth disease virus infection; the drug targets the TRIM3 gene / protein and inhibits or silences the expression of the TRIM3 gene / protein.

[0009] In a second aspect, the present invention provides a use of a TRIM3 gene / protein expression inhibitor in the preparation of a medicament for preventing or treating foot-and-mouth disease virus infection.

[0010] Preferably, the drug comprises a small interfering RNA designed to target the TRIM3 gene / protein; or the TRIM3 gene / protein expression inhibitor comprises a sgRNA targeted to knock out the TRIM3 gene / protein.

[0011] Preferably, the sequence of the sgRNA is as follows:

[0012] hamTRIM3-KO#F: CACCGATGTGTGTGTGAGTGCCGCGC;

[0013] hamTRIM3-KO#R:AAACGCGCGGCACTCACCACACATC.

[0014] In a third aspect, the present invention provides the use of a TRIM3 gene / protein knockout cell line in breeding for resistance to foot-and-mouth disease virus.

[0015] Preferably, the method for constructing the TRIM3 gene / protein knockout cell line comprises the following steps:

[0016] (1) Prepare sgRNA that specifically targets TRIM3 gene / protein;

[0017] (2) inserting the double-stranded fragment of the sgRNA oligonucleotide prepared in step (1) into the multiple cloning site of the lentiviral vector expressing Cas9, and transfecting cells to obtain a recombinant lentivirus that simultaneously expresses the Cas9 protein / gene and the targeting sgRNA sequence;

[0018] (3) Transducing the recombinant lentivirus prepared in step (2) into host cells, picking single cells, inoculating and culturing, and obtaining a TRIM3 gene / protein knockout cell line.

[0019] In a fourth aspect, the present invention provides an application of a TRIM3 gene / protein as a target in the preparation or screening of a foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production enhancer; the drug targets the TRIM3 gene / protein and promotes the expression of the TRIM3 gene / protein.

[0020] In a fifth aspect, the present invention provides an application of a TRIM3 protein in the preparation of a foot-and-mouth disease virus or a foot-and-mouth disease virus vaccine production enhancer.

[0021] In a sixth aspect, the present invention provides an application of a TRIM3 gene / protein overexpressing cell line in the preparation of a foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production cell line.

[0022] Preferably, the method for constructing the TRIM3 gene / protein overexpressing cell line comprises the following steps:

[0023] (1) Preparing a TRIM3 overexpression plasmid;

[0024] (2) constructing a recombinant lentivirus containing the TRIM3 overexpression plasmid described in step (1);

[0025] (3) Transducing the recombinant lentivirus prepared in step (2) into host cells, picking out single cells, inoculating and culturing, and obtaining a TRIM3 overexpressing cell line.

[0026] The beneficial effects of the present invention are as follows: ① The present invention finds that the replication of FMDV can be inhibited by inhibiting or silencing the host TRIM3 gene / protein, which can be used as a target for preparing a drug for inhibiting the replication of FMDV; ② The present invention provides an sgRNA targeting the TRIM3 gene, which can specifically target the TRIM3 gene, and can achieve the knockout of the TRIM3 gene in the host cell by combining with CRISPR-Cas9 technology, with accurate targeting and high knockout efficiency; ③ The present invention provides a sgRNA targeting the TRIM3 gene / protein through CRISPR The PR-Cas9 technology is used to transfect the sgRNA into host cells to construct a TRIM3 gene / protein function-lost cell line. By making the TRIM3 gene / protein function-lost, a cell line with an FMDV-resistant phenotype is obtained, which can significantly inhibit the replication of FMDV, and provide research tools and materials for further studying the molecular mechanism of TRIM3 gene / protein regulating the replication of pathogenic microorganisms in cells. It can also be used for breeding animals resistant to FMDV, and provide some theoretical basis for preventing or inhibiting FMDV infection in the future; ④ The present invention uses a lentiviral packaging system to construct a TRIM3 stable expression cell line, which promotes the replication of FMDV. As a production cell line of foot-and-mouth disease virus vaccine, it is used for the production of foot-and-mouth disease virus vaccine and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 TRIM3 gene targeted knockout strategy based on CRISPR / Cas9 method;

[0028] Figure 2 TRIM3-KO monoclonal cell selection and sequencing identification;

[0029] Figure 3 Determination of cell viability of TRIM3 knockout cell lines;

[0030] Figure 4 qPCR detection showed that knocking out TRIM3 inhibited the replication of FMDV in BHK-21 cells;

[0031] Figure 5 WB detection showed that knocking out TRIM3 inhibited the replication of FMDV in BHK-21 cells;

[0032] Figure 6 TCID 50 Detection of knockout of TRIM3 inhibits the replication of FMDV in BHK-21 cells;

[0033] Figure 7 qPCR detected that overexpression of TRIM3 promoted the replication of FMDV in BHK-21 cells;

[0034] Figure 8WB detection showed that overexpression of TRIM3 promoted the replication of FMDV in BHK-21 cells;

[0035] Fig. 9 TCID 50 Detection: Overexpression of TRIM3 promotes the replication of FMDV in BHK-21 cells. DETAILED DESCRIPTION

[0036] In order to make the purpose, technical scheme and advantages of the present invention clearer, the embodiments of the present invention will be described in detail below in conjunction with the accompanying drawings. However, it will be appreciated by those skilled in the art that in the embodiments of the present invention, many technical details are provided to enable the reader to better understand the present application. However, even without these technical details and various changes and modifications based on the following embodiments, the technical scheme claimed in the present application can be implemented.

[0037] The experimental methods in the following examples are conventional methods unless otherwise specified; the experimental materials used in the following examples are purchased from conventional biochemical reagent companies unless otherwise specified.

[0038] 293T, BHK-21 cells and vectors plov-Flag and lentiCRISPR V2 were all deposited by the Foot-and-Mouth Disease and Emerging Disease Epidemiology Team of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences. FMDV (O / BY / CHA / 2010) was deposited by the National Foot-and-Mouth Disease Reference Laboratory.

[0039] CCK8 cell viability detection kit was purchased from Shanghai Biotech Co., Ltd. PBS (pH = 7.4) and β-Actin rabbit polyclonal antibody were purchased from Wuhan Saiwei Biotechnology Co., Ltd. ChamQ Universal SYBR qPCR Master Mix, 5×HiScriptⅡqRT Super MixⅡ, ExnaseⅡ, and 5×CEⅡBuffer were purchased from Novazon Biotech Co., Ltd. Plasmid extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. Gel recovery kit was purchased from Omega Therapeutics, USA. T4 DNA ligase was purchased from New England Biolabs. Protein pre-stained markers and endonucleases (BamHⅠ, NheⅠ, Esp3I) were purchased from Thermo Fisher Scientific, USA. Trizol reagent and PrimeSTAR Max high-fidelity DNA polymerase were purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd. Puromycin powder was purchased from Beijing Solebold Technology Co., Ltd. DMEM cell culture medium was purchased from Invitrogen (Shanghai) Trading Co., Ltd. Fetal bovine serum (FBS) was purchased from Biological Industries (BI). 0.05% EDTA trypsin was purchased from Gibco. O-type FMDV-VP1 monoclonal antibody was prepared and stored in our laboratory. TRIM3 rabbit antibody was purchased from Proteintech.

[0040] All data involved in statistical analysis were repeated at least 3 times. The data were expressed as "mean ± standard deviation" and the statistical differences between the mean values ​​were analyzed by t-test, *: P < 0.05; **: P < 0.01; ***: P < 0.001.

[0041] Example 1 Design and synthesis of sgRNA and primers

[0042] First, the TRIM3 gene sequence of golden hamster (Mesocricetus auratus) was queried on NCBI, and sgRNA was designed in the overlapping region of the third exon segment of the TRIM3 gene. CACC was added to the 5' end of the coding strand of the sgRNA sequence, and AAAC was added to the 3' end of the template strand to form a sticky end. In order to promote the transcription of sgRNA, G was added after CACC at the 5' end of the coding strand, and C was added to the 5' end of the template strand. According to this method, two 25bp sgRNAs were designed and named hamTRIM3-KO#F and hamTRIM3-KO#R, respectively. The overexpression TRIM3 primers were designed and named Plov-TRIM3-F / R. The above primer sequences are shown in Table 1. All primers in this experiment were synthesized by Qingke Biotechnology Co., Ltd.

[0043] Table 1 Hamster TRIM3 sgRNA sequence and TRIM3 primer sequence

[0044]

[0045] Example 2 Construction of recombinant plasmid

[0046] 1. Construction of lentiviral recombinant plasmid lentiCRISPR-TRIM3-sgRNA

[0047] (1) Enzyme digestion of lentiCRISPR V2 vector plasmid: Esp3I single enzyme digestion of lentiCRISPR V2 plasmid. Prepare a total of 30 μL reaction system: Esp3I enzyme 1 μL; 10×Fast buffer 3 μL; lentiCRISPR V2 1.5 μL; ddH2O 24.5 μL. After enzyme digestion at 37℃ for 2 hours, gel recovery and purification.

[0048] (2) Annealing to obtain the target fragment: Add 10 μL ddH2O to each of the dry powder primers F and R, vortex and mix evenly, then take 1 μL of each of the upstream and downstream primers and add them to 48 μL ddH2O to prepare a total of 50 μL of reaction system. PCR annealing program: 75℃5min, 65℃5min, 55℃5min, 45℃5min, 35℃5min, 25℃5min, so that the upstream and downstream primers form double strands to obtain the target fragment.

[0049] (3) T4 ligation method to construct lentiCRISPR recombinant plasmid: 1 μL T4 DNA ligase, 1 μL 10×T4 DNA ligase buffer, 1 μL lentiCRISPR vector, 2 μL annealed sgRNA target fragment, 5 μL ddH2O, a total of 10 μL system was prepared. After thorough mixing, let stand at room temperature for 2 h or overnight for ligation.

[0050] The construction information of lentiCRISPR-sgRNA-TRIM3 recombinant plasmid is as follows Figure 1 After the construction was completed, transformation, plating, and single clone selection were performed, and then sent to Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were consistent with the target gene.

[0051] 2. Construction of lentiviral recombinant plasmid plov-TRIM3

[0052] (1) Obtaining plov vector by double restriction digestion: Double restriction digest the plov-stop vector plasmid with nucleases BamHI and NheⅠ, and prepare a 50μL reaction system: BamHI 2μL, NheⅠ 2μL, 10×Fast Buffer 5μL, plov-stop vector 3.3μL, ddH2O 37.7μL. Digest at 37℃ for 2h and then purify by gel recovery.

[0053] (2) PCR of target fragment: Take 2 μL of dissolved F and R from Qingke Biotechnology Co., Ltd., 10 μL of template cDNA, 25 μL of 2× PrimeSTAR Max high-fidelity DNA polymerase, and 6 μL of ddH2O to prepare a 50 μL reaction system. PCR amplification program: 95℃5min; 95℃15s, 58℃15s, 72℃3min 30s, 30 cycles in total; 72℃5min.

[0054] (3) Homologous recombination method to connect the vector and the target fragment: prepare a total of 10 μL reaction system, 5 μL homologous recombination enzyme, 1 μL plov vector, 1 μL target fragment, and 3 μL ddH2O. Place the above system in a 50℃ water bath and let it stand for 30 minutes.

[0055] Example 3 Construction of cell lines

[0056] 1. Establishment of TRIM3 knockout cell line

[0057] (1) Cell recovery: Take out one 293T cell and one BHK-21 cell to be established from liquid nitrogen, place them in a 37°C constant temperature water bath until the solid in the cryopreservation tube is completely thawed, transfer them to a 1.5 mL centrifuge tube, and centrifuge at 1000 rpm for 5 min. After centrifugation, discard the supernatant, add 1 ml of DMEM medium containing 10% FBS and 1% penicillin-streptomycin double antibody, pipet and mix evenly, transfer to a T25 cell culture flask containing DMEM medium containing 10% FBS and 1% penicillin-streptomycin double antibody, and culture in a 37°C, 5% CO2 incubator.

[0058] (2) 293T cell plating: After taking the cells out of the incubator, discard the original culture medium, wash the cells with PBS 2 to 3 times, add 0.05% trypsin to digest the cells, then add 10% FBS and 1% penicillin-streptomycin dual antibody DMEM culture medium to the cell culture flask, mix well, and then plate in a six-well plate.

[0059] (3) Lentivirus packaging: When the cell density is about 80%, add the auxiliary plasmids LH1 and LH2 for packaging lentivirus, the constructed sgRNA plasmid and the transfection reagent polyethylenimine (PEI) (at a ratio of 1μɡ:2μL) to the buffer Opti-MEM, mix thoroughly, let stand for ten minutes, and evenly and slowly drip into a six-well plate. Place it in a 37℃ 5% CO2 incubator and culture for 12 hours. After that, discard the original culture medium and replace it with DMEM medium containing 10% FBS. After continuing to culture for 48 hours, collect the virus supernatant.

[0060] (4) Lentivirus infection: The collected viral supernatant was filtered with a 0.45 μm filter and then infected with BHK-21 cells plated in a six-well plate within 24 h. After culturing for 48 h, the cells were screened for three consecutive generations using DMEM medium containing puromycin (at a ratio of 1:250 to the total culture medium), 10% FBS serum, and 2% penicillin-streptomycin double antibody to kill sgRNA-negative cells.

[0061] (5) Monoclonal cell screening: After the positive cells have grown normally for 1 day, the cells are diluted to 10 cells / mL using the limiting dilution method and inoculated into a 96-well plate with 100 μL per well, i.e., 1 cell per well, and screened for 7-10 days. The wells with monoclonal cells in good condition are marked, digested with 0.05% trypsin, mixed, and subcultured to a 48-well plate for continued culture. When the cells are fully grown, the wells with good cell conditions are selected and subcultured to a 24-well plate for subsequent sequencing identification. The TRIM3 identification primer is used to amplify the fragment containing the sg RNA target site. After sequencing, snapgene is used for comparison analysis. The sequencing results are as follows: Figure 2 The sequencing results showed that the BHK-21 cells with TRIM3 knockout had a 5-base deletion compared to the wild-type cells, resulting in a frameshift in the target gene. In short, the sequencing results showed that the BHK-21 cell line TRIM3-KO with TRIM3 knockout was successfully constructed.

[0062] 2. Establishment of TRIM3 overexpression cell line

[0063] The method for establishing TRIM3 overexpressing BHK-21 cell line was the same as described in 1 above.

[0064] Example 4 Effect of cell lines on foot-and-mouth disease virus replication

[0065] 1.CCK8 cell viability assay

[0066] Wild-type BHK-21 cells (TRIM3-WT) and TRIM3 knockout BHK-21 cells (TRIM3-KO) were co-cultured, and the cell density of the digested cells was adjusted to 1×10 5 – 2×105 / mL, 100μL per well was inoculated into a 96-well plate, and cultured in a cell culture incubator for 12h and 24h; CCK8 solution was added at 10μL / well, and care was taken not to introduce bubbles into the wells. The cells were placed in a cell culture incubator and cultured for 2h. The absorbance was measured at 450nm using an ELISA reader to determine the cell number and analyze cell viability.

[0067] The results are as follows Figure 3 As shown, there was basically no difference in the viability of the TRIM3 knockout BHK-21 cell line and the wild-type BHK-21 at 12h and 24h, indicating that the knockout of TRIM3 in BHK-21 cells did not affect cell viability.

[0068] 2. Real-time fluorescence quantitative PCR (qPCR)

[0069] (1) RNA extraction: Wild-type BHK-21 cells, TRIM3 knockout BHK-21 cells, and TRIM3 overexpressing BHK-21 cells (TRIM3) were plated in 12-well plates and infected with FMDV after the cells were fully grown. The cells were collected at 0 h, 8 h, and 12 h, and the total cellular RNA was extracted using the Trizol lysis method.

[0070] (2) RNA reverse transcription to cDNA: reaction system 20 μL, 10 μL RNA, 4 μL 5×HiScriptⅡqRT SuperMixⅡ and 6 μL DEPC water. PCR program settings: 50℃20min, 85℃10s.

[0071] (3) Real-time fluorescence quantitative PCR: The quantitative PCR reaction system was 10 μL: 4 μL cDNA, 5 μL 2×SYBR, and 0.5 μL each of upstream and downstream primers. GAPDH was used as the internal reference gene to perform relative quantification of the mRNA levels of FMDV and TRIM3. Fluorescence quantitative PCR was performed according to the CFX96 real-time system operation procedure at 95°C for 3 min; 95°C for 3 s, and 60°C for 1 s, for a total of 55 cycles.

[0072] TRIM3 knockout cells and control cells were plated in 12-well plates, and cells were collected after infection with FMDV (MOI = 1), total cell RNA was extracted, and the FMDV mRNA levels at different time points were detected by qPCR. The results are shown in Figure 4 As shown, the results showed that at 8h and 12h after infection, the FMDV transcription level in wild-type cells was significantly higher than that in TRIM3 knockout BHK-21 cells.

[0073] TRIM3 overexpressing cells and control cells were plated in 12-well plates, and cells were collected after infection with FMDV (MOI = 1), total cell RNA was extracted, and the FMDV mRNA levels at different time points were detected by qPCR. The results are shown in Figure 7 As shown, the results showed that at 6h and 12h after infection, the FMDV transcription level in TRIM3-overexpressing cells was significantly higher than that in wild-type cells.

[0074] 3. Western-blot detection of proteins

[0075] In order to study the effects of knockout and overexpression of TRIM3 gene on FMDV protein level, TRIM3 gene knockout BHK-21 cells, TRIM3 overexpressing BHK-21 cells and wild-type BHK-21 cells were plated in 12-well plates and infected with FMDV after the cells were fully grown. The cells were collected at 0h, 8h, 12h and 16h after infection, and 2×SDS cell lysis buffer was added. The cells were exposed to metal bath at 100℃ for 10 min and then detected by Western-blot.

[0076] (1) SDS-PAGE electrophoresis: add an equal amount of protein sample to each well and incubate at 80 V for 30 min or 120 V for 60 min.

[0077] (2) Transfer: 100 V for 1 hour.

[0078] (3) Blocking: Place the membrane in 5% blocking solution at room temperature for 1-2 hours.

[0079] (4) Incubation with primary antibody: overnight at 4°C; wash three times with 1× TBST, 5-10 min each time.

[0080] (5) Incubation with secondary antibody: incubate at room temperature for 1 h; wash the membrane three times with 1× TBST, each time for 5-10 min.

[0081] (6) Exposure: Add the 1:1 prepared ECL chemiluminescent solution to the membrane for development.

[0082] TRIM3 knockout cells and control cells were plated in 12-well plates, and then infected with FMDV (MOI = 1) and collected. The expression levels of viral protein VP1 and the knockout of host protein TRIM3 in the two cells after infection with FMDV were detected by western-blot. The results are shown in Figure 5 As shown, the results showed that with the extension of virus infection time, the expression level of FMDV-VP1 protein in wild-type cells was significantly higher than that in TRIM3 knockout cells at 12h and 16h, and no expression of TRIM3 was detected in knockout BHK-21 cells.

[0083] TRIM3-overexpressing cells and control cells were plated in 12-well plates, and then infected with FMDV (MOI=1) and collected. The expression levels of viral protein VP1 and host protein TRIM3 of the two cells after infection with FMDV were detected by western-blot. The results are shown in Table 1. Figure 8 As shown, the results showed that with the extension of virus infection time, the FMDV-VP1 protein expression level in TRIM3 overexpressing cells was significantly higher than that in wild-type cells at 8h and 16h, indicating that the overexpression of TRIM3 can significantly promote the protein expression level of FMDV-VP1.

[0084] 4. Virus titer (TCID 50 )

[0085] TRIM3 knockout BHK-21 cells, TRIM3 overexpressing BHK-21 cells and wild-type BHK-21 cells were plated in 12-well plates and infected with FMDV after the cells were fully grown. The cell supernatant was collected after 12 h and repeatedly frozen and thawed 2-3 times in a -80°C refrigerator. The obtained cell supernatant was then cultured with blank DMEM medium for 10 -3 –10 -7 The venom was diluted 100 μL at 37 °C and 5% CO2 for 72 h, and the TCID of the amplified virus was calculated according to the Reed-Muench method. 50 .

[0086] TRIM3 knockout cells and control cells were plated in 12-well plates, infected with FMDV (MOI = 1), and the cell supernatant was collected to detect the progeny virus content in the supernatant. The results are as follows: Figure 6 As shown, the results showed that the titer of progeny virus produced by wild-type BHK-21 cells was significantly higher than that of TRIM3 knockout BHK-21 cells.

[0087] TRIM3-overexpressing cells and control cells were plated in 12-well plates and infected with FMDV (MOI = 1). The cell supernatant was collected and the progeny virus content in the supernatant was detected. The results are as follows: Fig. 9 As shown, the results showed that the progeny virus titer produced by TRIM3-overexpressing cells was significantly higher than that of wild-type BHK-21 cells.

[0088] The above results show that the monoclonal cell line with TRIM3 gene deletion can significantly inhibit the expression of FMDV at the mRNA level and protein level, and can effectively reduce the viral titer of progeny viruses; while TRIM3 overexpression significantly promotes the expression of FMDV at the mRNA level and protein level, and can effectively increase the viral titer of progeny viruses.

[0089] The present invention constructs a BHK-21 cell line with TRIM3 knockout by CRISPR / Cas9 gene editing system, and explores the effect of BHK-21 cells with TRIM3 knockout on FMDV replication and proliferation. In order to further study the phenotypic function of TRIM3, a cell line with stable overexpression of TRIM3 was constructed by packaging recombinant plasmids with lentivirus. It is found that after TRIM3 is knocked out, the replication and proliferation of FMDV can be significantly inhibited without affecting cell viability, and vice versa. The above experimental data can corroborate each other, and TRIM3 plays an important regulatory role in the replication process of FMDV. And in the process of constructing the knockout and overexpression system, the design method of sgRNA, the transfection dose of the recombinant plasmid, and the most effective working concentration of puromycin were explored and adjusted, which provides a more comprehensive method reference for the construction of knockout cell lines of other genes in the future for this research group. At the same time, it provides a reference for further studying the replication of other viruses regulated by TRIM3, and provides ideas for the production of vaccines for RNA viruses, which has a broad application prospect.

Claims

1. Use of TRIM3 gene / protein as a target in the preparation or screening of drugs for preventing or treating foot-and-mouth disease virus infection; the drug targets TRIM3 gene / protein and inhibits or silences the expression of TRIM3 gene / protein.

2. Use of TRIM3 gene / protein expression inhibitors in the preparation of drugs for preventing or treating foot-and-mouth disease virus infection.

3. The use according to claim 2, characterized in that The drug includes a small interfering RNA designed with the TRIM3 gene / protein as a target; or the TRIM3 gene / protein expression inhibitor includes an sg RNA that targets and knocks out the TRIM3 gene / protein.

4. The use according to claim 3, characterized in that The sequence of the sgRNA is as follows: hamTRIM3-KO#F: CACCGATGTGTGTGTGAGTGCCGCGC; hamTRIM3-KO#R:AAACGCGCGGCACTCACCACACATC.

5. Application of TRIM3 gene / protein knockout cell lines in breeding for resistance to foot-and-mouth disease virus.

6. The use according to claim 5, characterized in that The method for constructing the TRIM3 gene / protein knockout cell line comprises the following steps: (1) Prepare sgRNA that specifically targets TRIM3 gene / protein; (2) inserting the double-stranded fragment of the sgRNA oligonucleotide prepared in step (1) into the multiple cloning site of the lentiviral vector expressing Cas9, and transfecting cells to obtain a recombinant lentivirus that simultaneously expresses the Cas9 protein gene and the targeting sgRNA sequence; (3) Transducing the recombinant lentivirus prepared in step (2) into host cells, picking single cells, inoculating and culturing, and obtaining a TRIM3 gene / protein knockout cell line.

7. Use of TRIM3 gene / protein as a target in the preparation or screening of foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production enhancers; the drug targets TRIM3 gene / protein and promotes the expression of TRIM3 gene / protein.

8. Application of TRIM3 protein in the preparation of foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production enhancer.

9. Application of TRIM3 gene / protein overexpressing cell line in the preparation of foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production cell line.

10. The use according to claim 9, characterized in that The method for constructing the TRIM3 gene / protein overexpression cell line comprises the following steps: (1) Preparing a TRIM3 overexpression plasmid; (2) constructing a recombinant lentivirus containing the TRIM3 overexpression plasmid described in step (1); (3) Transducing the recombinant lentivirus prepared in step (2) into host cells, picking out single cells, inoculating and culturing, and obtaining a TRIM3 overexpressing cell line.

Images