Application of LULL1 gene or protein as target spot in screening medicines for inhibiting foot-and-mouth disease virus replication

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to application of LULL1 gene / protein as a target spot in screening of drugs for inhibiting foot and mouth disease virus replication. The method specifically comprises the following steps: firstly, constructing an LULL1 knockout cell line by utilizing a CRISPR / Cas9 system, wherein the cell line remarkably inhibits the replication of FMDV; secondly, a lentivirus packaging system is utilized to construct an LULL1 stable expression cell line, and the cell line promotes the replication of FMDV. Therefore, the inhibition or silencing of the LULL1 gene / protein can inhibit the replication of the foot-and-mouth disease virus, can be used as a target spot for screening drugs for inhibiting the replication of the foot-and-mouth disease virus, provides some theoretical bases for preventing or inhibiting FMDV infection in the future, and has a wide application prospect.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and specifically relates to an application of a LULL1 gene or protein as a target in screening a drug for inhibiting the replication of foot-and-mouth disease virus. Background Art

[0002] Adenosine triphosphate (ATP), also known as ATP, is hydrolyzed into adenosine diphosphate and phosphate ions by ATPase, and releases energy, which is the main energy source for cell metabolism. LULL1 (TOR1AIP2) is an ATPase (AAA) associated with various cell activities. + The ATPase superfamily is a member of the Torsin family. When any of these ATPases does not work properly, serious consequences may occur. For example, the deletion of a single glutamic acid residue in the ATPase gene called TorsinA (TorsinA△E) will lead to the autosomal dominant movement disorder DYT1 dystonia.

[0003] LULL1 is a transmembrane protein that is mainly localized in the endoplasmic reticulum (ER) and has no clear functional motifs. LULL1 and LAP1 (membrane-associated polypeptide 1) are known to be activators of TorsinA. Both LULL1 and LAP1 are type II integral membrane proteins with a luminal domain of approximately 30 kDa. The two have 62% homology, and the activities of TorsinA and TorsinB are strictly dependent on LAP1 and LULL1. The luminal domains of these proteins adopt an AAA-like structure, which enables them to be integrated into the Torsin ATPase ring as subunits in heterohexameric assembly. By doing so, LAP1 and LULL1 contribute a key catalytic arginine residue to the nucleotide binding pocket of the adjacent Torsin subunit, supplement the fragment's Torsin active site, and cause ATP hydrolysis, thereby participating in many processes, including protein folding and degradation, cytoskeleton dynamics, membrane trafficking, vesicle fusion, and stress response. This activation mechanism and biological assembly are essential for generating a catalytically functional Torsin ATPase machine, highlighting the importance of LAP1 and LULL1 for Torsin cellular function. Importantly, this activation mechanism is defective in the presence of the disease-causing Torsin A△E mutation, providing the first link between reduced enzyme activity and disease etiology.

[0004] Foot-and-mouth disease virus (FMDV) causes a highly contagious disease in even-toed ungulates such as cattle and sheep. Clinically, it manifests as blisters and ulcers on the oral mucosa, hooves, udders and other skin or hairless parts of even-toed ungulates, leading to a loss of productivity. As a member of the Picornaviridae family, FMDV has a single-stranded positive-sense RNA genome of approximately 8,500 nucleotides, containing a large open reading frame. The open reading frame encodes a large polyprotein that is expressed by the viral protease L pro and 3C pro The proteins are cut together to produce four structural proteins (VP1, VP2, VP3 and VP4) and eight non-structural proteins (L, 2A, 2B, 2C, 3A, 3B, 3C and 3D). Picornavirus infection causes the intracellular membrane to rearrange into characteristic vesicles, providing a platform for the assembly of the viral RNA replication complex. Viral RNA, proteins and host factors are recruited into these vesicles to assemble the viral replication complex. Therefore, exploring the interaction between viral proteins and host factors is of great significance to the pathogenicity of the virus and the prevention and control of the disease.

[0005] This invention mainly uses gene editing technology to explore the effect of LULL1 on FMDV. Genome editing refers to the precise modification of the genome by methods such as site-specific deletion, modification, or site-specific integration of exogenous genes. Currently, CRISPR / Cas9 has been widely used in scientific research and gene editing. The working principle is that the guide RNA (sgRNA) first identifies the target gene through the principle of base complementary pairing, induces the nuclease Cas9 to cut this site to break the double bond, and then activates the cell genome's own repair mechanism. Due to mutations such as nucleotide deletion or insertion, the gene's reading frame changes and a stop codon appears, and the gene loses its function of encoding the target protein, achieving the purpose of gene knockout. Summary of the invention

[0006] In response to the above technical problems, the invention first determined that LULL1 is a key host factor for the replication of foot-and-mouth disease virus. Secondly, the recombinant plasmids CRISPR V2-LULL1-sgRNA and plov-LULL1 were constructed. After the virus liquid was infected with PK-15 cells through the lentiviral packaging system, puromycin was used for screening to eliminate a large number of negative cells, thereby obtaining the PK-15-LULL1-KO cell line and the PK-15 cell line with stable expression of LULL1. By infecting FMDV, the effects of LULL1 on FMDV replication were explored from three aspects: transcription level, protein level, and viral titer. LULL1 can significantly promote the replication of FMDV, indicating that LULL1 has an important regulatory effect on the replication of FMDV. Further exploration provides new insights into the mechanism of virus-host interaction and provides a theoretical basis for further clarifying the mechanism of LULL1 regulating FMDV replication. Specifically including the following contents:

[0007] In a first aspect, the present invention provides an application of a LULL1 gene / protein as a target in the preparation or screening of a drug for preventing or treating foot-and-mouth disease virus infection; the drug targets the LULL1 gene / protein and inhibits or silences the expression of the LULL1 gene / protein.

[0008] In a second aspect, the present invention provides a use of a LULL1 gene / protein expression inhibitor in the preparation of a medicament for preventing or treating foot-and-mouth disease virus infection.

[0009] Preferably, the drug comprises a small interfering RNA designed to target the LULL1 gene / protein; or the LULL1 gene / protein expression inhibitor comprises an sgRNA targeted to knock out the LULL1 gene / protein.

[0010] Preferably, the sgRNA is selected from any one or a combination of pLULL1-KO-#1-3; the sequence of the sgRNA is as follows:

[0011] pLULL1-KO-#1-F: CACCGGTCCCGCTGAAACAAATTATG;

[0012] pLULL1-KO-#1-R:AAACCATAATTTGTTTCAGCGGGACC;

[0013] pLULL1-KO-#2-F: CACCGTAAGACCAGAGGCAGGGTCTG;

[0014] pLULL1-KO-#2-R: AAACCAGACCCTGCCTCTGGTCTTAC;

[0015] pLULL1-KO-#3-F:CACCGTGTAGGCATCTGCGACGTGGG;

[0016] pLULL1-KO-#3-R:AAACCCCACGTCGCAGATGCCTACAC.

[0017] In a third aspect, the present invention provides the use of a LULL1 gene / protein knockout cell line in breeding for resistance to foot-and-mouth disease virus.

[0018] Preferably, the method for constructing the LULL1 gene / protein knockout cell line comprises the following steps:

[0019] (1) Prepare sgRNA that specifically targets the LULL1 gene / protein;

[0020] (2) inserting the double-stranded fragment of the sgRNA oligonucleotide prepared in step (1) into the multiple cloning site of the lentiviral vector expressing Cas9, and transfecting cells to obtain a recombinant lentivirus that simultaneously expresses the Cas9 protein / gene and the targeting sgRNA sequence;

[0021] (3) Transducing the recombinant lentivirus prepared in step (2) into host cells, picking single cells, inoculating and culturing, and obtaining a LULL1 gene / protein knockout cell line.

[0022] In a fourth aspect, the present invention provides an application of a LULL1 gene / protein as a target in the preparation or screening of a foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production enhancer; the drug targets the LULL1 gene / protein and promotes the expression of the LULL1 gene / protein.

[0023] In a fifth aspect, the present invention provides an application of a LULL1 protein in the preparation of a foot-and-mouth disease virus or a foot-and-mouth disease virus vaccine production enhancer.

[0024] In a sixth aspect, the present invention provides an application of a LULL1 gene / protein overexpressing cell line in preparing a foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production cell line.

[0025] Preferably, the method for constructing the LULL1 gene / protein overexpression cell line comprises the following steps:

[0026] (1) Preparation of LULL1 overexpression plasmid;

[0027] (2) constructing a recombinant lentivirus containing the LULL1 overexpression plasmid described in step (1);

[0028] (3) Transducing the recombinant lentivirus prepared in step (2) into host cells, picking out single cells, inoculating and culturing, and obtaining a LULL1 overexpressing cell line.

[0029] The beneficial effects of the present invention are as follows: ① The present invention finds that the replication of FMDV can be inhibited by inhibiting or silencing the host LULL1 gene / protein, which can be used as a target for preparing a drug for inhibiting the replication of FMDV; ② The present invention provides an sgRNA targeting the LULL1 gene, which can specifically target the LULL1 gene, and can achieve the knockout of the LULL1 gene in the host cell by combining with CRISPR-Cas9 technology, with accurate targeting and high knockout efficiency; ③ The present invention provides a method for The PR-Cas9 technology is used to transfect the sgRNA into host cells to construct a LULL1 gene / protein function-lost cell line. By making the LULL1 gene / protein function-lost, a cell line with an FMDV-resistant phenotype is obtained, which can significantly inhibit the replication of FMDV, and provide research tools and materials for further studying the molecular mechanism of LULL1 gene / protein regulating the replication of pathogenic microorganisms in cells. It can also be used for breeding animals resistant to FMDV, and provide some theoretical basis for preventing or inhibiting FMDV infection in the future; ④ The present invention uses a lentiviral packaging system to construct a LULL1 stable expression cell line, which promotes the replication of FMDV. As a production cell line of foot-and-mouth disease virus vaccine, it is used for the production of foot-and-mouth disease virus vaccine and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 LentiCRISPR-sgRNA and plov-LULL1 plasmid construction strategy;

[0031] Figure 2 LentiCRISPR-sgRNA sequencing results;

[0032] Figure 3 Determination of cell viability of LULL1 knockout cell lines;

[0033] Figure 4 qPCR detection showed that knocking out LULL1 inhibited the replication of FMDV in PK-15 cells;

[0034] Figure 5 WB detection showed that knocking out LULL1 inhibited the replication of FMDV in PK-15 cells;

[0035] Figure 6 TCID 50 Detection of knockout of LULL1 inhibits the replication of FMDV in PK-15 cells;

[0036] Figure 7 qPCR detected that overexpression of LULL1 promoted the replication of FMDV in PK-15 cells;

[0037] Figure 8WB detection showed that overexpression of LULL1 promoted the replication of FMDV in PK-15 cells;

[0038] Fig. 9 TCID 50 Overexpression of LULL1 promoted the replication of FMDV in PK-15 cells. DETAILED DESCRIPTION

[0039] In order to make the purpose, technical scheme and advantages of the present invention clearer, the embodiments of the present invention will be described in detail below in conjunction with the accompanying drawings. However, it will be appreciated by those skilled in the art that in the embodiments of the present invention, many technical details are provided to enable the reader to better understand the present application. However, even without these technical details and various changes and modifications based on the following embodiments, the technical scheme claimed in the present application can be implemented.

[0040] The experimental methods in the following examples are conventional methods unless otherwise specified; the experimental materials used in the following examples are purchased from conventional biochemical reagent companies unless otherwise specified.

[0041] 293T, PK-15 cells, BHK-21 cells, and vectors plov-Flag and lentiCRISPR V2 were all deposited by the Foot-and-Mouth Disease and Emerging Disease Epidemiology Team of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences. FMDV (O / BY / CHA / 2010) was deposited by the National Foot-and-Mouth Disease Reference Laboratory.

[0042] Escherichia coli competent DH5α was purchased from Shenzhen Kangti Life Science Co., Ltd. Plasmid extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. Gel recovery kit was purchased from Omega Therapeutics, USA. PEI transfection reagent was purchased from Polysciences. ChamQ Universal SYBR qPCR Master Mix, 5×HiScriptⅡqRTSuper MixⅡ, ExnaseⅡ, and 5×CEⅡBuffer were all purchased from Novozymes Biotech Co., Ltd. T4 DNA ligase was purchased from New England Biolabs. Protein pre-stained markers and endonucleases (BamHI, NheⅠ, and Esp3I) were all purchased from Thermo Fisher Scientific, USA. Trizol reagent and PrimeSTAR Max high-fidelity DNA polymerase were purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd. Puromycin was purchased from Beijing Solebow Technology Co., Ltd. DMEM cell culture medium was purchased from Invitrogen (Shanghai) Trading Co., Ltd. Fetal bovine serum (FBS) was purchased from Biological Industries (BI). 0.05% EDTA trypsin was purchased from Gibco. PBS (pH 7.4) and β-Actin rabbit polyclonal antibody were purchased from Wuhan Saiweier Biotechnology Co., Ltd. Anti rabbit IgG (HRP) and anti mouse IgG (HRP) antibodies were purchased from Jackson. Rabbit anti-O-type FMDV 2C polyclonal antibody and rabbit anti-LULL1 polyclonal antibody were prepared and stored in our laboratory.

[0043] All data involved in statistical analysis were repeated at least 3 times. The data were expressed as "mean ± standard deviation" and the statistical differences between the mean values ​​were analyzed by t-test, *: P < 0.05; **: P < 0.01; ***: P < 0.001.

[0044] Example 1 Design and synthesis of sgRNA and primers

[0045] The NCBI database was used to query the LULL1 gene sequence (Gene ID: 100627970), and the CHOPCHOP website (https: / / chopchop.cbu.uib.no) was used for recommendation. According to the CRISPR / Cas9 design principle, the CG content was about 50-60%, and the sgRNA with higher effectiveness was selected. Three sgRNA sequences were designed in the coding region of the LULL1 gene. In order to promote the transcription of sgRNA, CACCG was added to the 5' end of the coding strand of the sgRNA sequence, and AAAC was added to the 3' end of the template strand to form a sticky end. According to this method, three 26bp sgRNAs were designed and named pLULL1-KO#1, pLULL1-KO#2, and pLULL1-KO#3 respectively. The overexpression primers were named Plov-LULL1-F / R according to the homologous recombination primer design principle and were synthesized uniformly by Qingke Biotechnology Co., Ltd. The sgRNA and primers are shown in Table 1.

[0046] Table 1LULL1-sgRNA sequence and primer sequence

[0047]

[0048] Example 2 Construction of CRISPR V2-LULL1 plasmid and Plov-LULL1 overexpression plasmid

[0049] The CRISPR V2 vector was digested with restriction endonuclease Esp3I for 2 hours to obtain a linearized vector and recovered by running on a gel. The synthesized upstream and downstream primers were annealed and connected to the linearized CRISPR V2 vector using T4 DNA ligase for 1 hour, transformed into DH5α competent cells, and coated with A + Incubate the agar plate at 37°C overnight and select a single colony in 5 ml A + Culture in LB, extract the plasmid, use U6 as the upstream primer to test and identify the plasmid, and identify the correct plasmid for use.

[0050] Double-digest the Plov vector with restriction endonucleases BamHI and NheI for 2 hours to obtain the linearized vector and run gel recovery. Amplify the LULL1 target gene with PrimeSTAR high-fidelity DNA polymerase and run gel recovery. Connect the target gene with the double-digested vector for homologous recombination, transform, plate, and send for testing. Identify the correct extracted plasmid for use.

[0051] The vector information of lentiCRISPR V2 is as follows Figure 1 As shown in the left figure, the Esp3I double restriction site is shown in the figure. According to the CRISPR / Cas9 design principles, three sgRNA primer sequences were designed in the exon region of the LULL1 gene.

[0052] The upstream and downstream primers were annealed to form double-stranded fragments, which were constructed into the vector lentiCRISPR V2, and the plasmids were extracted and sent for sequencing. Figure 2 As shown, gene sequencing results showed that recombinant plasmids with sgRNA targeting different exons of the LULL1 gene were successfully constructed, and the recombinant plasmids were named CRISPR V2-LULL1-1, CRISPR V2-LULL1-2, and CRISPR V2-LULL1-3, respectively.

[0053] plov-LULL1 plasmid information and cloning location are as follows Figure 1 As shown in the right figure. After the construction was completed, transformation, plating, and single clone selection were performed, and then sent to Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with BioEdit 7.0.9.0 software, and the results showed that the above recombinant plasmid was successfully constructed.

[0054] Example 3 Construction of cell lines

[0055] When the density of 293T cells in a 6-well plate is 60-70%, the auxiliary plasmids LH1, LH2 and three sgRNA plasmids for packaging lentivirus are co-transfected. After 12 hours, the original culture medium is discarded and replaced with DMEM culture medium containing 10% FBS for 36 hours. The virus solution is filtered with a 0.45μm filter, and infected to a density of 80-90% PK-15 cells and polybrene is added at 1:1000 to increase the infection efficiency. PK-15 cells are cultured in an incubator for 24 hours, and cells are screened with a final concentration of 1μg / mL of puromycin DMEM culture medium, and wild-type cells are eliminated. When the surviving cells are full, they are subcultured again. After 4-5 subcultures, they are frozen or plated for experiments to obtain the LULL1 knockout PK-15-LULL1-KO cell line, referred to as LULL1-KO.

[0056] Example 4 Effect of cell lines on foot-and-mouth disease virus replication

[0057] 1. Cell Viability Assay

[0058] Comparison of cell viability between PK-15-WT (Control) and PK-15-LULL1-KO (LULL1-KO) cell lines. The cells were digested and counted to a cell density of approximately 1 × 10 5 Each well of a 96-well plate was inoculated with 100 μl of CCK8 solution and incubated in the incubator for 12 h and 24 h, respectively. Then, 10 μl of CCK8 solution was added to each well and the cells were incubated in the incubator for 1-2 h. The absorbance was measured at 450 nm using an ELISA reader. Each experiment was repeated at least 3 times. Figure 3As shown, there was no significant difference in the absorbance values ​​at 450nm between PK-15-WT cells and PK-15-LULL1-KO cells. The results showed that the knockout of the LULL1 gene had no effect on cell activity and had good safety.

[0059] 2. Real-time fluorescence quantitative PCR (qPCR)

[0060] Cell RNA was extracted by Trizol reagent. The cell culture supernatant was discarded, 500 μl of Trizol reagent was added to each well of the 6-well plate, and the plate was allowed to stand for 30 minutes. The cell lysate was collected in a sterile EP tube without RNAse, and 100 μl of chloroform was added to each well. The plate was inverted about 30 times, and centrifuged at 12000 rpm for 15 minutes at 4°C. 160 μl of the upper clear liquid was collected in a new EP tube without RNAse, and 200 μl of isopropanol was added to each well. The plate was allowed to stand for 10 minutes at 4°C after mixing, and centrifuged at 12000 rpm for 10 minutes at 4°C. The supernatant was discarded, 500 μl of 75% ethanol solution was added, and the plate was centrifuged at 12000 rpm for 5 minutes at 4°C after shaking, and the supernatant was discarded. The plate was centrifuged at 12000 rpm for 2 minutes at 4°C again, and the ethanol solution was aspirated. When the ethanol was completely evaporated and the RNA was transparent, appropriate DEPC water was added to dissolve the RNA, and the plate was allowed to stand for 30 minutes, and vortexed and centrifuged. cDNA can be obtained by reverse transcription of RNA. The cDNA was diluted 1:20, and the reaction system was: 0.5 μl of upstream primers and downstream primers, 5 μl of ChamQ Universal SYBR qPCR Master Mix, 5 μl of cDNA, a total of 10.5 μl. Fluorescence quantitative PCR reaction program: 95°C for 3 min; 95°C for 3 s, 60°C for 10 s, a total of 40 cycles; GAPDH was used as an internal reference gene to quantify the relative expression levels of LULL1 and FMDV mRNA. All experiments were repeated 3 times, using 2 -△△CT Method to analyze data.

[0061] PK-15-WT cells and PK-15-LULL1-KO cell lines were infected with FMDV at 0h, 8h and 12h, respectively, and the knockout efficiency of PK-15-LULL1-KO cell lines and the effect on FMDV mRNA transcription levels were detected by qPCR. Figure 4 As shown, compared with the wild-type cells, the LULL1 mRNA level in LULL1 knockout cells decreased by 80%, proving that the PK-15-LULL1-KO cell line was successfully constructed. At 8h and 12h of FMDV infection, knockout of LULL1 significantly inhibited FMDV replication compared with wild-type cells.

[0062] The PK-15 cell line overexpressing LULL1 (LULL1-Flag) and the PK-15 control (Vector) cells were infected with FMDV for 24 h, and the cellular RNA was extracted and reverse transcribed. The relative expression level of FMDV was quantified using GAPDH as the internal reference gene. Figure 7 As shown, the replication level of FMDV was significantly increased in the PK-15 cell line overexpressing LULL1.

[0063] 3. Western-blot

[0064] In order to study the effect of LULL1 knockout or overexpression on FMDV replication, cells were plated in 6-well plates. When the cell density reached 80-90%, the cells were infected with FMDV at 0, 6, 12 and 16 hours, and the supernatant was discarded. 150 μl of SDS loading was added to lyse the cell samples, and the metal bath was 100℃ for 15 minutes to completely denature the protein. The sample volume was about 10 μl, and proteins of different molecular weights were separated by electrophoresis. The membrane was transferred to the membrane in an ice water bath at 100V for 1.5 hours, blocked with 5% skim milk powder for 1 hour, and then incubated with primary antibodies at room temperature for 2 hours, Actin antibody was diluted 1:3000, LULL1 antibody was diluted 1:2000, and FMDV 2C antibody was diluted 1:3000. Wash with TBST 4 times, 10 minutes / time. Then incubate with secondary antibodies at room temperature for 1 hour, and the corresponding secondary antibodies labeled with horseradish peroxidase (HRP) were diluted 1:4000. Wash with TBST 4 times, 10 min / time, and use TIANGEN's common color development kit in a 1:1 ratio, and scan and image using BIO-RAD developer.

[0065] The results are as follows Figure 5 As shown, at 6, 12, and 16 h of infection, the expression level of FMDV 2C protein in PK-15-LULL1-KO cells was significantly lower than that in wild-type PK-15 cells.

[0066] In the PK-15 cell line overexpressing LULL1 and the PK-15 control cells, samples were collected at 0, 8, and 16 hours after infection with FMDV and analyzed by Western blotting. Figure 8 As shown in the figure, in the samples collected after FMDV infection, LULL1 overexpression can significantly promote the replication of FMDV. After 16 hours of virus infection, the cells were severely cytopathic and detached, and the amount of cells collected was small, resulting in a significant decrease in the expression of the internal reference protein.

[0067] 4. Virus titer (TCID 50 )

[0068] To further investigate the effect of LULL1 on FMDV replication, the infectivity of the progeny virus in the supernatant after infection of the two cells was evaluated. PK-15WT cells, PK-15-LULL1-KO cells, and PK-15 cell lines with LULL1 overexpression were plated in 6-well plates and infected with FMDV for 16 h when the cell density reached 80-90%. The supernatant was collected and the cell debris was centrifuged and discarded. The virus solution was diluted with DMEM medium in a gradient of 10 -3 -10 -8 The virus solutions of each dilution gradient were inoculated into the BHK-21 cells in a 96-well plate monolayer, 100 μl per well, and placed in a 37°C incubator. The cytopathic effects were observed and recorded at 48 h and 72 h, and the TCID was calculated according to the Reed-Muench method. 50 The results are as follows Figure 6 and Fig. 9 As shown, the progeny virus replication level in the LULL1-KO supernatant was significantly lower than that in the control cells 16 hours after FMDV infection; compared with WT cells, overexpression of the LULL1 gene caused an increase in viral titer, indicating that the LULL1 gene can significantly promote the replication of FMDV.

[0069] The present invention uses CRISPR / Cas9 technology to construct a PK-15 cell line with LULL1 gene knockout, and constructs a PK-15 cell line with LULL1 overexpression by a lentiviral packaging system. Through fluorescence quantification and protein immunoblotting identification, LULL1 gene knockout cell line and LULL1 overexpression cell line were successfully obtained, and CCK8 cell viability detection showed that the knockout cell line had growth characteristics similar to those of wild-type cells, laying the foundation for further research such as virus infection in LULL1 gene knockout cell line. Subsequently, FMDV infection experiments were carried out using LULL1 gene knockout and overexpression cell lines, and the effects of LULL1 on FMDV replication were described from aspects such as mRNA transcription, protein expression, and viral titer. The results all showed that the PK-15-LULL1-KO cell line had a significant inhibitory effect on FMDV, while the PK-15 cell line with LULL1 overexpression had a significant promoting effect on FMDV. The above experiments all showed that LULL1 was a host factor required for FMDV replication. This also shows that LULL1 plays an important role in the entire FMDV infection. It helps to reveal the interaction between host factors and viruses, and provides ideas for the prevention of FMDV and the development of antiviral drugs.

Claims

1. Use of LULL1 gene / protein as a target in the preparation or screening of drugs for preventing or treating foot-and-mouth disease virus infection; the drug targets LULL1 gene / protein and inhibits or silences the expression of LULL1 gene / protein.

2. Use of LULL1 gene / protein expression inhibitors in the preparation of drugs for preventing or treating foot-and-mouth disease virus infection.

3. The use according to claim 2, characterized in that The drug includes a small interfering RNA designed with the LULL1 gene / protein as a target; or the LULL1 gene / protein expression inhibitor includes an sg RNA that targets and knocks out the LULL1 gene / protein.

4. The use according to claim 3, characterized in that The sgRNA is selected from any one or a combination of pLULL1-KO-#1-3; the sequence of the sgRNA is as follows: pLULL1-KO-#1-F: CACCGGTCCCGCTGAAACAAATTATG; pLULL1-KO-#1-R:AAACCATAATTTGTTTCAGCGGGACC; pLULL1-KO-#2-F: CACCGTAAGACCAGAGGCAGGGTCTG; pLULL1-KO-#2-R: AAACCAGACCCTGCCTCTGGTCTTAC; pLULL1-KO-#3-F:CACCGTGTAGGCATCTGCGACGTGGG; pLULL1-KO-#3-R:AAACCCCACGTCGCAGATGCCTACAC.

5. Application of LULL1 gene / protein knockout cell line in breeding for resistance to foot-and-mouth disease virus.

6. The use according to claim 5, characterized in that The method for constructing the LULL1 gene / protein knockout cell line comprises the following steps: (1) Prepare sgRNA that specifically targets the LULL1 gene / protein; (2) inserting the double-stranded fragment of the sgRNA oligonucleotide prepared in step (1) into the multiple cloning site of the lentiviral vector expressing Cas9, and transfecting cells to obtain a recombinant lentivirus that simultaneously expresses the Cas9 protein gene and the targeting sgRNA sequence; (3) Transducing the recombinant lentivirus prepared in step (2) into host cells, picking single cells, inoculating and culturing, and obtaining a LULL1 gene / protein knockout cell line.

7. Use of LULL1 gene / protein as a target in the preparation or screening of foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production enhancers; the drug targets LULL1 gene / protein and promotes the expression of LULL1 gene / protein.

8. Application of LULL1 protein in the preparation of foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production enhancer.

9. Application of LULL1 gene / protein overexpressing cell line in the preparation of foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production cell line.

10. The use according to claim 9, characterized in that The method for constructing the LULL1 gene / protein overexpression cell line comprises the following steps: (1) Preparation of LULL1 overexpression plasmid; (2) constructing a recombinant lentivirus containing the LULL1 overexpression plasmid described in step (1); (3) Transducing the recombinant lentivirus prepared in step (2) into host cells, picking out single cells, inoculating and culturing, and obtaining a LULL1 overexpressing cell line.

Images