Method for assembling DNA circuit by using DNA ribozyme hairpin allosteric structure

Abstract

The invention discloses a method for assembling a DNA circuit by using a DNA ribozyme hairpin allosteric structure, which utilizes the double characteristics of information storage and information processing of DNA ribozyme, and realizes the controllable assembly of the DNA ribozyme by controlling the on-off of a DNA ribozyme fragment hairpin structure, thereby realizing the regulation and control of the DNA ribozyme function. Based on the method, various DNA logic gates are constructed, a four-bit binary square root opening DNA circuit is successfully realized, a feasible scheme is provided for constructing a large-scale DNA circuit, and the method has good practical application value in the aspects of DNA calculation, molecular diagnosis and biosensors.

Description

Technical Field

[0001] The invention relates to the field of biological computing technology, and in particular provides a method for assembling a DNA circuit by utilizing DNA ribozyme hairpin conformational changes. Background Art

[0002] The complementary nature of bases makes DNA molecules naturally programmable, and the base arrangement of DNA molecules themselves also provides a basic way to store information. By utilizing the programmability and information storage capacity of DNA molecules, combined with molecular biology techniques, DNA molecules are used as a medium to achieve information transmission and processing, providing a new way to construct biocompatible DNA circuits at the nano level. Similar to the assembly of basic information processing units in electronic computers to achieve complex computing functions, DNA circuits that can be used for complex computing can also be constructed in DNA circuits by assembling DNA logic gates. In the construction of DNA logic gates, the use of base complementary properties to achieve information storage and processing is a common method. In recent years, more and more scholars have also used the configuration / conformation of DNA molecules as a way to store and process molecular information, and have used the conformational changes of DNA molecules to construct DNA circuits with multiple signal processing capabilities, greatly enriching the molecular information processing toolbox that can be used for complex computing.

[0003] DNA ribozymes are a special class of DNA molecules with complete DNA molecule manipulation functions. In particular, DNA ribozymes can directly participate in DNA chain displacement to form DNA ribozyme displacement. Due to the dual characteristics of information processing and information storage, DNA ribozymes have been widely used in the construction of DNA logic gates and DNA circuits. DNA ribozymes are composed of recognition arms at both ends, a highly conserved catalytic core and a stem-loop structure. Under the action of metal ions, the conserved domain of DNA ribozymes undergoes conformational changes to form a catalytic core, and then recognizes the substrate through the substrate binding arm to complete the cutting. In recent years, more and more researchers have constructed DNA logic gates, DNA circuits and biosensors based on DNA ribozymes.

[0004] Therefore, it is very meaningful to construct circuits using DNA ribozymes that have the dual characteristics of information storage and information processing. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a method for assembling a DNA circuit using a DNA ribozyme hairpin allosteric structure, so as to realize the structural assembly of the DNA ribozyme by controlling the opening and closing of the DNA ribozyme hairpin stem-loop structure, thereby controlling the activation and inactivation of the DNA ribozyme function and realizing the DNA ribozyme hairpin allosteric assembly.

[0006] The technical solution provided by the present invention is: a method for assembling a DNA circuit by using a DNA ribozyme hairpin conformational change, comprising:

[0007] Step 1: Design the DNA sequence of the hairpin allosteric regulation DNA ribozyme assembly strategy;

[0008] Wherein, the DNA sequence includes DNA single strand Z1, DNA single strand Z2, substrate R and trigger strand I;

[0009] The structural domains designed on the DNA single strand Z1 include: a self-complementary domain s0, a DNA ribozyme conserved domain c1, a partial c11 domain of the c1 domain, and a toehold domain t0 set on the hairpin loop of the single strand Z1;

[0010] The structural domains designed on the DNA single strand Z2 include: substrate binding domain b2*, DNA ribozyme conserved domain c2, complementary domain s0*, wherein the complementary domain s0* serves as a binding domain with the DNA strand Z1 and forms a hairpin structure with the self-complementary domain s0;

[0011] The structural domains designed on the trigger chain I include: a toehold domain t0*, a binding domain S0, and a reverse complement sequence c11* of c11;

[0012] The structural domains designed on the substrate chain R include: substrate binding domains b1 and b2*;

[0013] The foothold domain t0 provided on the hairpin ring Z1 serves as a binding domain for the preset domain t0* on the trigger chain I;

[0014] Step 2: Mix the DNA single strands Z1 and Z2 with the substrate R to obtain a mixed solution. In the initial state, Z1 and Z2 cannot form a complete DNA ribozyme structure through base complementarity. At this time, the DNA ribozyme is in an inactive state and cannot cut the substrate R and generate a signal.

[0015] Step 3: When the trigger chain I is added to the mixed solution, the toehold domain t0* of I binds to the toehold domain t0 on the hairpin structure loop, and the hairpin structure is opened through branch migration. At this time, the self-complementary domain s0 on Z1 is exposed, and binds to the complementary domain s0* on Z2. At this time, the DNA chain Z1 / Z2 / I forms a complete DNA ribozyme structure, and the DNA ribozyme Z1 / Z2 / I binds to the substrate R through the pre-set substrate binding domains b1 and b2*. Under the synergistic action of magnesium ions, the DNA ribozyme Z1 / Z2 / I cuts the substrate R to form DNA chains O1 and O2, generating a signal.

[0016] Preferably, the number of bases of the self-complementary domain s0 designed on the DNA single strand Z1 is not less than 10 bases.

[0017] Preferably, the 3' end of the DNA single strand Z1 extends to the DNA ribozyme conserved domain by no less than 3 bases.

[0018] Preferably, both ends of the substrate R are modified with a fluorescent group FAM and a quenching group BHQ1, respectively.

[0019] The present invention provides a method for assembling a DNA circuit by utilizing a DNA ribozyme hairpin conformational change. The method realizes the structural assembly of the DNA ribozyme by controlling the opening and closing of the DNA ribozyme hairpin stem-loop structure in a DNA chemical reaction, and can reduce the complexity of the DNA chain in the construction of a complex circuit; a new method for controllable assembly of DNA ribozymes is realized, and the method can be widely used in DNA computing, DNA circuits and DNA nanotechnology. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for the description of the embodiments of the present invention or the prior art are briefly introduced below. Obviously, the drawings described below are only part of the embodiments of the present invention, and for ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor.

[0021] Figure 1 A schematic diagram of the method for assembling a DNA circuit using a DNA ribozyme hairpin allosteric transformation provided by the present invention, as well as PAGE electrophoresis results and fluorescence detection results;

[0022] Figure 2 A schematic diagram of constructing an AND gate for the method provided by the present invention, as well as PAGE electrophoresis results and fluorescence detection results;

[0023] Figure 3 A schematic diagram of the process of constructing an OR gate according to the method provided by the present invention;

[0024] Figure 4 The PAGE electrophoresis results of constructing the OR gate for the method provided by the present invention;

[0025] Figure 5 Constructing the fluorescence detection result of OR gate for the method provided by the present invention;

[0026] Figure 6 A schematic diagram of the INHIBIT gate as well as PAGE electrophoresis results and fluorescence detection results were constructed based on the method of the present invention;

[0027] Figure 7 Schematic diagram of constructing an OR-INHIBIT gate based on the method of the present invention;

[0028] Figure 8 The PAGE electrophoresis results of constructing the OR-INHIBIT gate based on the method of the present invention;

[0029] Fig. 9 Constructing the fluorescence detection result of the OR-INHIBIT gate based on the method of the present invention;

[0030] Fig.10 A schematic diagram of a four-bit binary square root extraction circuit is constructed based on the method of the present invention;

[0031] Fig.11 Based on the method of the present invention, a four-bit binary square root extraction circuit fluorescence detection result is constructed;

[0032] In the above figure, the arrow end corresponds to the 3'-end of the DNA sequence, and the blunt end corresponds to the 5'-end of the DNA sequence.

[0033] In the above figures, DNA single strands or DNA complexes are marked above the lane numbers, wherein the DNA single strands that the DNA complex is composed of are connected by slashes, and the symbol "+" indicates that the reactants are mixed to perform the reaction process. DETAILED DESCRIPTION

[0034] Exemplary embodiments will be described in detail herein, examples of which are shown in the accompanying drawings. When the following description refers to the drawings, the same numbers in different drawings represent the same or similar elements unless otherwise indicated. The embodiments described in the following exemplary embodiments do not represent all embodiments consistent with the present invention. Instead, they are merely examples of systems consistent with some aspects of the present invention as detailed in the appended claims.

[0035] The technical solution of the present invention is further described in detail below.

[0036] In order to solve the problems existing in the prior art, such as Figure 1 As shown, the present invention provides a method for assembling a DNA circuit using a DNA ribozyme hairpin conformational change, characterized in that it includes:

[0037] Step 1: Design the DNA sequence of the hairpin allosteric regulation DNA ribozyme assembly strategy;

[0038] Wherein, the DNA sequence includes DNA single strand Z1, DNA single strand Z2, substrate R and trigger strand I;

[0039] The structural domains designed on the DNA single strand Z1 include: a self-complementary domain s0, a DNA ribozyme conserved domain c1 (corresponding to the base sequence "AGCGAT"), a partial c11 domain of the c1 domain (corresponding to the base sequence "GAT"), and a toehold domain t0 set on the hairpin loop of the single strand Z1;

[0040] The structural domains designed on the DNA single chain Z2 include: substrate binding domain b2*, DNA ribozyme conserved domain c2 (corresponding to the base sequence "CACCCATGT"), and complementary domain s0*, wherein the complementary domain s0* serves as a binding domain with the DNA chain Z1 and forms a hairpin structure with the self-complementary domain s0; the base number of the s0 domain is not less than 10 nt, the foothold domain t0 is used for the domain trigger chain binding to regulate the opening and closing of the hairpin structure, and the 3' end of Z1 extends to the DNA ribozyme conserved domain;

[0041] The structural domains designed on the trigger chain I include: a toehold domain t0*, a binding domain S0, and a reverse complement sequence c11* of c11;

[0042] The structural domains designed on the substrate chain R include: substrate binding domains b1 and b2*; and the fluorescent group FAM and the quenching group BHQ1 are modified at both ends of the substrate R respectively;

[0043] The foothold domain t0 provided on the hairpin ring Z1 serves as a binding domain for the preset domain t0* on the trigger chain I;

[0044] Step 2: Mix the DNA single strands Z1 and Z2 with the substrate R to obtain a mixed solution. In the initial state, Z1 and Z2 cannot form a complete DNA ribozyme structure through base complementarity. At this time, the DNA ribozyme is in an inactive state and cannot cut the substrate R and generate a signal.

[0045] Step 3: When the trigger chain I is added to the mixed solution, the toehold domain t0* of I binds to the toehold domain t0, and the hairpin structure is opened through branch migration. At this time, the self-complementary domain s0 on Z1 is exposed and binds to the complementary domain s0* on Z2. At this time, the DNA chain Z1 / Z2 / I forms a complete DNA ribozyme structure. Through the pre-set substrate binding domains b1 and b2*, the DNA ribozyme Z1 / Z2 / I binds to the substrate R, and under the synergistic action of magnesium ions, the DNA ribozyme Z1 / Z2 / I cuts the substrate R to form DNA chains O1 and O2, generating a signal.

[0046] The DNA sequence in the embodiment was purchased from Shanghai Bioengineering, wherein the DNA sequence was purified by PAGE, and the DNA single strand modified with RNA, FAM, HEX fluorescent group or BHQ quenching group was purified by high performance liquid chromatography HPLC. The DNA molecular sequence in the embodiment is shown in Table 1. The reagents used in the embodiment (reagents required for the PAGE gel electrophoresis experiment) are: EDTANa2 (disodium ethylenediaminetetraacetic acid), TRIS (tris(hydroxymethyl)aminomethane), glacial acetic acid, magnesium acetate, ammonium persulfate, polyacrylamide, N,N'-methylenebisacrylamide, tetramethylethylenediamine and Stains ALL. 1×TAE / Mg 2+Buffer: 40mmoL / L TRIS, 20mmoL / L acetic acid, 1mmoL / L EDTA Na2, 12.5mmoL / L magnesium acetate, pH = 8.0. 40% acrylamide stock solution: 190g acrylamide and 10g N,N'-methylenebisacrylamide, dissolved in water at 37℃, and then added with deionized water to 500mL. The concentration of all DNA chains was measured by Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific Inc.USA). The fluorescence signal was detected by real-time fluorescence PCR instrument, with the maximum absorption wavelength of 550nm and the maximum emission wavelength of 564nm. All the comparison and hairpin DNA single strands in the embodiment were generated by annealing (heating at 65 degrees for 5 minutes, heating at 61 degrees for 5 minutes, heating at 57 degrees for 5 minutes, heating at 53 degrees for 5 minutes, heating at 49 degrees for 5 minutes, heating at 45 degrees for 5 minutes, heating at 41 degrees for 5 minutes, heating at 37 degrees for 5 minutes, heating at 33 degrees for 5 minutes, heating at 29 degrees for 5 minutes, and storing at 25 degrees), and then the mixed reaction was subjected to a room temperature chain displacement reaction at 25°C for 2 hours.

[0047] The results of the examples were detected by PAGE gel electrophoresis and fluorescence detection.

[0048] Table 1 DNA sequences used in the examples

[0049] name Sequence (5'-3') Z1 TGTTCTAACAGCGATCGGTCACTCTAGACCAAATGCCACCAGAGTGACCGATC Z2 AGAGTGACCGCACCCATGTCTGAAGAG I GATCGGTCACTCTGGTGGCATTTGGTCT R CTCTTCAGT / rA / GGTTAGAACA Z5 TGTATGTTCAGCGATAGCGATCGTTCGTTACATACGAACGATCGCTATCTTAGGTCC Z6 GGTGAGCGATCGTTCTTCAGCTCCAACGATCGCTCACCCATGTCTCTTCTC I2 GGAGCTGAAGAACGATCGCTCACC I3 GGACCTAAGATAGCGATCGTTCGTATGTAACG R1 GAGAAGAGT / rA / GGAACATACA Z7 TGTTCTAACAGCGATAGCGATCGTTGATCGTTCTTCAGCTCCAACGATCGCTATCTTAGGTCC Z8 AACGATCGCTCACCCATGTCTGAAGAG DZ-Z7 TGTTCTAACAGCGATAGCGATCGTTGATCGTTCTTCAGCTCCTTTTTTTTTTCAGTTAGGTCC Z3 TGTATGTTCAGCGATCGTTCTTCAGCTCC Z4 CGTAGTTGGTGCGTTCTTCAGTATCCGATTATAAGCCTGAAGAACGCACCCATGTCTCTTCTC I0 GCTTATAATCGGATACTGAAGAACGCACC I1 CTGAAGAACGCACCAACTACG

[0050] Example 1

[0051] Figure 1 (a) is a method for assembling DNA circuits using DNA ribozyme hairpin conformational changes. Figure 1 (b) Give the PAGE detection results of this method. Figure 1 Lanes 1-4 in (b) are DNA single strands Z1, Z2, R, and I, corresponding to Figure 1 (a) DNA single strands Z1, Z2, R, I. First, as Figure 1 Lane 6 in (b) shows that when there is no trigger chain I, DNA single chains Z1 and Z2 exist in single-stranded form, cannot form a DNA ribozyme structure, and cannot cut the substrate chain R. When the trigger chain I is added to the solution (lane 7), chain I opens the hairpin structure of Z1 through DNA chain displacement, and the exposed domain s0 of Z1 complements the domain s0* of Z2 to form a double strand, forming an active DNA ribozyme structure. At this time, it can be clearly seen in lane 7 that the single-stranded forms of Z1, Z2, and R disappear, and Z1, Z2 and the input chain I together form a DNA complex Z1 / Z2 / I, indicating that the substrate R is cut to form two DNA fragments O1 and O2. The results of PAGE electrophoresis experiments show that this method is feasible.

[0052] Figure 1 (c) shows the fluorescence detection results of this method. Curve (1) shows almost no fluorescence signal when there is no input chain I. Curve (2) shows obvious fluorescence signal when input chain I is added to the solution. To further determine the sensitivity of this method, Figure 1 (d) The fluorescence signal detection under different reactant concentrations is given. Figure 1 (d) It can be seen that as the concentration increases, the reaction rate becomes faster and faster. Figure 1 (e) The fluorescence signal detection under the action of different concentrations of input chain I is given. Figure 1 (e) It can be seen that as the concentration of input chain I increases, the reaction rate also becomes faster and faster.

[0053] Example 2

[0054] Construction of AND gates using DNA ribozyme hairpin allosteric assembly

[0055] Based on Example 1, the versatility of this method was verified. Figure 2 (a) A schematic diagram of the construction of an AND gate based on this method is given. The AND gate is composed of three DNA chains: a hairpin DNA chain Z5 with a DNA ribozyme conserved domain fragment, a hairpin DNA chain Z6 with a DNA ribozyme conserved domain fragment, and a substrate R1 with RNA modification. The input of the AND gate consists of input chains I2 and I3. When there is no input, Z5 and Z6 cannot assemble into a DNA ribozyme structure due to the formation of a hairpin structure. At this time, Z5 and Z6 cannot bind to the substrate R1, and no signal is output. Only when input chains I2 and I3 exist at the same time can the hairpin structures of Z5 and Z6 be opened. Input chain I2 uses the combined domain (d1* and s11*) as a foothold to bind to Z6 to open the hairpin structure. Input chain I3 uses d3* as a foothold to bind to the Z5 overhang domain d3 to open the Z5 hairpin structure. The hairpin stems of Z5 and Z6 are exposed, and a double-stranded structure is formed through base complementarity. At this time, the DNA ribozyme structure is stably formed and binds to the substrate R1 to complete the cutting of R1 and generate signal output.

[0056] The feasibility of AND gate was verified by gel electrophoresis experiment. Figure 2 (b) The PAGE test results of the AND gate constructed by this method are given. Figure 2Lane 7 of (b), when there is no input chain, it can be seen from the band that the hairpin DNA chains Z5 and Z6 with the DNA ribozyme conserved domain sequence cannot bind to the substrate R1, and the bands of the three DNA chains are clearly visible, which can prove that Z5 and Z6 cannot bind, the substrate R1 is not cut, and no products O3 and O4 are produced. When the input chain I2 is added to the solution, from lane 8, it can be seen that the complex Z6 / I2 is formed, and the stem part with the hairpin Z6 is activated by the input chain I2, but at the same time, it can be clearly seen that Z5 presents a single band, so it proves that the complete DNA ribozyme structure cannot be formed. At the same time, it can be seen that the R1 band does not disappear, and no products O3 and O4 are produced, indicating that the AND gate has no signal output at this time. When the input chain I3 is added, from lane 9, it can be seen that the complex Z5 / I3 is formed, and the stem part of the hairpin Z5 is activated by the input chain I3, but at the same time, it can be clearly seen that the band of Z6 and the band of the substrate R1 do not disappear, proving that no signal is generated. When input chains I2 and I3 are added at the same time, it can be seen that a four-strand DNA complex Z5 / Z6 / I2 / I3 consisting of Z5, Z6, I2 and I3 is generated, forming a complete DNA ribozyme structure. At the same time, the band corresponding to substrate R1 disappears, indicating that the DNA ribozyme completes the cleavage of substrate R1. At the same time, there are relatively light bands below, which are products O3 and O4. PAGE results prove the feasibility of constructing AND gates based on this method.

[0057] Example 3

[0058] OR gate construction using DNA ribozyme hairpin allosteric assembly

[0059] Based on Example 1, the flexibility of this method was verified. Figure 3 The schematic diagram of the OR gate construction based on this method is given. The OR gate is composed of three DNA chains, including the hairpin DNA chain Z7 with the DNA ribozyme conserved domain sequence, the DNA chain Z8 containing the conserved domain sequence on the other side of the DNA ribozyme, and the substrate R with RNA modification. The DNA domain design on the chain and the OR gate reaction process are shown in Figure 3As shown. The input of the OR gate is DNA chains I2 and I3, and the output of the OR gate is detected by fluorescence signals. In the initial state, the stem-loop part of chain Z7 forms a hairpin structure, which makes Z7 and Z8 unable to bind, unable to cut substrate R, and unable to output signals. When I2 is input, I2 uses the combination domain (d1*, s11*, s12* and c11*) as a foothold to bind to the entire hairpin loop of DNA chain Z7 to trigger a DNA chain displacement reaction, forming a complex of Z7 and I2, and opening the hairpin structure of Z7. Since the part of I2 that binds to Z7 is only the part of its hairpin loop, the opened hairpin stem binds to another Z7 activated by the input chain I2, forming a four-chain complex composed of Z7 and I2, but does not affect the formation of the DNA ribozyme structure. The four-chain complex composed of Z7 and I2 can assemble with Z8 to form a complete DNA ribozyme structure, and binds and cuts the substrate chain R through the substrate recognition arm domain, producing short fragments of products O1 and O2, and generating signal output. Similarly, when I3 is input, the input chain I3 uses d3* as a foothold to bind to the 3'-end overhanging domain d3 of the DNA chain Z7 to trigger a DNA chain displacement reaction, and then binds to the top of the hairpin stem of Z7 (domain S11*), forming a complex of Z7 and I3. The hairpin structure is opened, thereby binding to Z8 to form a DNA ribozyme structure, cutting the substrate R to generate O1 and O2, and generating a signal output. When I2 and I3 are input at the same time, Z7 simultaneously binds to I2 and I3 to form a three-chain complex, and binds to Z8 to form a DNA ribozyme structure, cutting the substrate R into two fragments O1 and O2, generating a signal output.

[0060] Gel electrophoresis was performed to verify the feasibility of the OR gate. Figure 4 The PAGE detection results of the OR gate constructed by this method are given. Figure 4 (a) Lane 7 shows that when there is no input, Z7, Z8 and substrate R can be clearly seen from the band distribution, and substrate R is not cut, indicating that the OR gate can stably exist in the solution. When the input chain I2 is added, it can be seen from lane 8 that the complex Z7 / I2 is formed, but because the part of I2 that binds to Z7 is its cyclic part, the other half of the opened hairpin stem binds to Z7 activated by the input chain I2, so a four-chain complex composed of Z7 and I2 itself is formed. However, this four-chain complex does not affect the formation of the ribozyme structure, and it can still combine with Z8 to form a complete DNA ribozyme structure. When the input chain I3 is added to the solution, the complex Z7 / I2 is formed. Figure 4In lane 9 of (a), we can clearly see the formation of the complex Z7 / I3 structure and the Z8 / I3 complex band. This may be because the Z7 / Z8 / I3 structure was partially formed at the beginning of the reaction and combined with the substrate R to complete the cleavage. As can be seen from lane 9, the substrate R has disappeared and the products O1 and O2 have been produced. However, part of I3 may have directly undergone a strand displacement reaction with Z8. Figure 4 (b) It can be seen that it can also be inferred that the occurrence of this situation may affect the efficiency of the reaction. When the input chains I2 and I3 are added at the same time, it can be seen from lane 10 that a three-chain complex of Z7, I2 and I3 and a double-chain complex of Z8 and I3 are formed, and the substrate R band disappears, accompanied by products O1 and O2. This shows that the reaction forms a four-chain complex of Z7 / Z8 / I2 / I3, assembles the DNA ribozyme structure, and binds to substrate R, completing the cutting of substrate R. Similarly, part of I3 binds to Z8, but it does not affect the output of the signal.

[0061] For explanation Figure 4 In (a), we redesigned the DNA strand DZ-Z7 without the hairpin structure, which can bind to the input strand I2 for comparison with Z7. By determining the relative position of the double-stranded complex when DZ-Z7 binds to I2, the relative positions of the triple-stranded and quadruple-stranded DNA complexes can be confirmed.

[0062] like Figure 4 As shown in (b), from the comparison of the bands in lane 7 and lane 2, it can be seen that Z7 and I3 form a DNA complex Z7 / I3; from the comparison analysis of lane 2 and lane 3, it can be seen that Z7 can form a three-strand complex Z7 / I2 / I3 with the input chains I2 and I3; and by comparing lane 3 with lane 6, it can be seen that the top band in lane 6 is a four-strand complex; and from the comparison of lane 6 with lane 8, it can be seen that when only I2 is input, Z7 and I2 form a four-strand complex, but Figure 4 (a) The disappearance of substrate R in lane 8 indicates that the four-stranded complex does not affect the cleavage of the substrate by the DNA ribozyme and can form an effective signal output. Figure 4 (b) The results in lane 9 show that when only I3 is input, Z7 and I3 only form a double-stranded structure, while Z8 also partially forms a double-stranded structure with I3. Figure 4 The results of lane 9 in (a) show that the double-stranded Z8 / I3 does not affect the cleavage of substrate R by the DNA ribozyme structure. This can be seen from Figure 5 The middle curve (2) illustrates this.

[0063] In summary, when the hairpin structure of the Z7 chain is used to control the function of DNA ribozymes, the trigger chain can only bind to the hairpin ring or extend to the hairpin stem through the overhanging domain, and the hairpin structure can be switched on and off by DNA chain displacement. Different triggering methods will affect the efficiency of DNA ribozyme structure assembly and form complex three-stranded and four-stranded DNA complexes, but from the final gel electrophoresis results, these multi-stranded DNA complexes do not affect the cutting results of DNA ribozymes on substrate R. In order to verify the response of the OR gate to input under different input conditions, we continued to conduct further biochemical reaction experiments to verify the OR gate through fluorescence experiments.

[0064] Real-time fluorescence experiments were performed to verify the feasibility of the OR gate, and the two ends of the substrate R were modified with the fluorescent group FAM and the quenching group BHQ1 respectively. Figure 5 The fluorescence detection result diagram of the OR gate constructed based on this method is given. Figure 5 It can be seen that in the real-time fluorescence curve, corresponding to the case of no input, from curve (1), almost no significant fluorescence signal is generated. When the input chain I3 is added, from curve (2), it can be seen that a significant fluorescence signal is generated, but its rising rate is significantly lower than the other two cases. This is because part of the input chain I3 binds to Z8, which reduces the proportion of Z7 and Z8 forming a DNA ribozyme structure, resulting in a slower rising rate, which is consistent with the experimental results of PAGE electrophoresis. Curve (3) represents the case of adding input chain I2, and it can be seen that a significant fluorescence signal is generated. Curve (4) represents the case of adding input chains I2 and I3, and there is also a significant fluorescence signal generated, indicating that the substrate R is cut. The above experimental results show that the design of the OR gate is successful.

[0065] Example 4 Construction of INHIBIT gate using DNA ribozyme hairpin allosteric assembly

[0066] Based on Example 1, the applicability of this method was verified. Figure 6 (a) A schematic diagram of the INHIBIT gate constructed based on this method is given. Figure 6As can be seen in (a), the INHIBIT gate is composed of three DNA chains: a hairpin DNA chain Z4 with a conserved domain of a DNA ribozyme, a single-stranded DNA Z3 with a conserved domain of a DNA ribozyme, and a substrate R1 modified with RNA, wherein the two ends of the substrate R1 are modified with a fluorescent group HEX and a quencher group BHQ1, respectively; the inputs of the INHIBIT gate are DNA chains I0 and I2, respectively. In the initial state, the stem of the hairpin chain Z4 is in a closed state, resulting in the inability of Z3 and Z4 to bind, and unable to cut the substrate R1, so no signal can be output. When I0 is input, the input chain I0 uses the domain t1* as a foothold to bind to the hairpin ring of Z4 to undergo a chain displacement reaction, and I0 binds to the domain c2* of Z4, opening the hairpin structure to form a complex of Z4 and I0. The exposed stem of Z4 can bind to Z3 to form a DNA ribozyme structure, cut the substrate R1, and form products O3 and O4, thereby separating the fluorescent group HEX from the quencher group BHQ1, and generating a signal output. When I2 is input, the input chain I2 and the 3' end of Z3 bind to all the conserved domains of the DNA ribozyme to form a double-stranded complex of Z3 / I2, which prevents it from forming a DNA ribozyme with Z4. Therefore, no signal output will be obtained regardless of whether the input chain I0 is added. Here, the inhibitory effect of chain I2 is reflected in the combination of I2 with the components in the INHIBIT gate structure. By inhibiting the assembly of the DNA ribozyme structure, the logic gate is made non-responsive to the input I0, rather than directly complementing the input I0. The inhibitory effect formed in this way can ensure that the input I0 is not destroyed, and can then trigger other logic gates in the solution, which is conducive to the connection of the INHIBIT gate with other DNA logic gates and the assembly into a more complex DNA circuit.

[0067] Gel electrophoresis was performed to verify the feasibility of the INHIBIT gate. Figure 6 (b) The PAGE detection results of the INHIBIT gate constructed by this method are given. Figure 6 (b) Lane 7, when the INHIBIT gate is in the initial state, chain Z4 exists alone, part of Z3 binds to R1, but no products O3 and O4 are produced, so no signal is output. When the input chain I0 is added, it can be seen from lane 8 that the complex Z3 / Z4 / I0 is formed, and the substrate R1 disappears, and O3 and O4 products are produced. When the input chain I2 is added, the Z3 / I2 complex is produced in lanes 9 and 10, and the substrate R1 does not disappear. The above experimental results show that the INHIBIT gate can produce correct responses to different inputs.

[0068] Real-time fluorescence experiments were performed to verify the feasibility of the INHIBIT gate. The two ends of the substrate R1 were modified with the fluorescent group HEX and the quenching group BHQ1 respectively. Figure 6(c) The fluorescence detection result of the INHIBIT gate constructed based on this method is shown in the figure. When no input chain is added, the corresponding curve (1) has almost no significant fluorescence signal; when the input chain I2 is added, it can be seen from curve (2) that no obvious fluorescence signal is generated; when I0 and I2 are present in the solution at the same time, it can be seen from curve (3) that almost no fluorescence signal is generated, indicating that the binding of I2 to the Z3 chain in the INHIBIT gate is significantly better than the binding of input I0 to Z4, mainly because I0 needs to open the hairpin structure of Z4 through chain displacement before Z4 can bind to Z3; from curve (4), when there is only input chain I0, the INHIBIT gate gives a significant signal response, proving that the substrate R1 is cut. The above fluorescence experimental results are in line with the design expectations and prove the feasibility of the INHIBIT gate.

[0069] Example 5 Construction of OR-INHIBIT gate using DNA ribozyme hairpin allosteric assembly

[0070] Based on Example 1, the practicality of this method was verified. Figure 7 A schematic diagram of the construction of the OR-INHIBIT gate based on this method is given. The OR-INHIBIT circuit consists of three DNA chains, including a hairpin DNA chain Z4, a single DNA chain Z3, and a substrate R1 with RNA modification. The input of the circuit consists of input chains I0, I1, and I2. In the initial state, the hairpin structure of the Z4 chain is closed, resulting in the inability of Z3 and Z4 to assemble into a complete DNA ribozyme structure, and thus unable to cut the substrate R1, and no fluorescent signal output; when I0 is input, the input chain I0 uses the t1* domain as a foothold to bind to the hairpin ring domain t1 of the chain Z4 to induce a DNA chain displacement reaction, prompting the Z4 hairpin structure to open and form a complex of Z4 and I0. After being activated, Z4 binds to Z3 to form a complete DNA ribozyme, and binds to the substrate R1 to cut it, generating two short fragments O3 and O4, generating a signal output. Similarly, when I1 is input, I1 uses the 3'-end overhanging domain of Z4 as a foothold to undergo a chain displacement reaction and bind to the top of the hairpin stem (black area), opening the hairpin structure and generating a complex of Z4 and I1, which is assembled into a DNA ribozyme structure, binds to and cuts the substrate R1, and generates two short fragments O3 and O4, forming a signal output. When I2 is input, the input chain I2 binds to Z3 from the 3' end, and the bases are complementary to the entire DNA ribozyme conserved domain, forming a double-stranded complex of Z3 / I2, which is completely inhibited and cannot form a DNA ribozyme structure with Z4. Therefore, regardless of whether the input chain I0 or I1, or both, participates in the reaction, there will be no signal output, achieving the effect of inhibiting the reaction.

[0071] In the above reaction process, the circuit's response behavior to inputs I0 and I1 is the same as Figure 3 It is the same as the OR gate in the figure. It is also easy to see that the structure of the OR-INHIBIT circuit is exactly the same as the OR gate. When there is only input I2, the response behavior of the circuit is the same as Figure 6 The INHIBIT gates in (a) are the same, and the structure of the OR-INHIBIT circuit is exactly the same as that of the INHIBIT gate. If we further observe that the configuration of the DNA chain that constitutes the DNA logic gate is used as the standard, the OR gate and the INHIBIT gate can be regarded as isomorphic in structure. Both are composed of two linear DNA molecules (linear DNA molecules containing part of the conserved domain of the DNA ribozyme and linear RNA-modified substrate as signal output) and a nonlinear DNA molecule with a hairpin structure (also containing part of the conserved domain of the DNA ribozyme). The main reason for the different response behaviors of the OR gate and the INHIBIT gate is that the input DNA chain binds to different parts of the gate, such as the input of the OR gate (I0 and I1) binds to its nonlinear hairpin DNA chain, while the input of the INHIBIT gate (I2) binds to its linear DNA chain. Since the OR gate and the INHIBIT gate have the same structure, their inputs are only different in the function of the same logic gate, and they do not interfere with each other. Therefore, when constructing an OR-INHIBIT circuit, the OR gate and the INHIBIT gate can use the same gate structure and use the inputs of both as the input of the circuit. Figure 7 In the design of OR-INHIBIT circuit, the DNA chain of OR-INHIBIT circuit is Figure 6 The composition of the INHIBIT gate in (a) is exactly the same, except that I1 is introduced as a new input of the OR gate in the design of the input chain, which greatly simplifies the complexity of DNA circuit assembly.

[0072] Gel electrophoresis experiments were performed to verify the feasibility of the OR-INHIBIT circuit. Figure 8 The PAGE detection results of the OR-INHIBIT gate constructed by this method are given. Figure 8 (a) is the total response of the OR-INHIBIT circuit under all possible input conditions. Figure 8 (b) Design verification diagram Figure 8 The DNA complexes Z3 / Z4 / I0, Z3 / Z4 / I1, and Z3 / R1 that may appear during the reaction are shown. Figure 8 (c) To verify Figure 8 The DNA complexes Z4 / I1 and Z4 / I0 that may appear during the reaction, as well as the inhibitory effect of I2 on the OR-INHIBIT circuit during the reaction.

[0073] First, by Figure 8(a) Lane 3, when there is no input, the OR-INHIBIT circuit has no output. It should be noted that a DNA complex Z3 / R1 is formed in lane 3. Figure 8 (b) Figure 8 In lanes 4, 5, and 7 of (a), when I0 and I1 are used as inputs, the response behavior of the OR-INHIBIT circuit is the same as that of the OR gate. In lanes 6, 8-10, when the inhibitory chain I2 exists in the circuit, the OR-INHIBIT circuit has no output regardless of whether I0 and I1 exist in the circuit.

[0074] Secondly, by Figure 8 (b) Lanes 4-6, when I0 or I1 is input, the two DNA single strands bind to Z4, opening the hairpin structure of Z4, and the formed DNA complexes Z4 / I0 or Z4 / I1 bind to the DNA single strand Z3 to form DNA complexes Z3 / Z4 / I0 and Z3 / Z4 / I1; it is worth noting that Figure 8 In lane 3 of (b), Z3 can form a partial double strand with substrate R1 through complementary binding domains, which is consistent with Figure 8 The situation in lane 3 in (a) is the same; although Z3 binds to R1, Figure 8 (b) Lanes 7-10, the binding of Z3 to R1 does not affect the response of the OR-INHIBIT circuit to the input.

[0075] Finally, by Figure 8 (c) Lanes 4-6 clearly show the binding of input chains I0 and I1 to DNA chain Z4 to form DNA complexes Z4 / I1 and Z4 / I0, indicating that the input chain that triggers the OR function of the OR-INHIBIT circuit does indeed act only on chain Z4 as expected, thus verifying that the OR-INHIBIT circuit is isomorphic to the OR gate in realizing the OR operation; Figure 8 (c) Lane 7, when the inhibitory chain I2 is added, only chain Z3 in the OR-INHIBIT circuit hybridizes with I2 to form a double chain, while chain Z4 and substrate R1 still exist in the form of single chains. At this time, the response of the OR-INHIBIT circuit to the input chain I2 is the same as that of the INHIBIT gate, thus verifying that the OR-INHIBIT circuit is isomorphic to the aforementioned INHIBIT gate in realizing the INHIBIT operation. Figure 8 In lanes 8-10 in (c), when the inhibitory chain I2 is combined with the other two inputs I0 and I1, the inhibitory chain I2 still only binds to chain Z3, and I0 and I1 only bind to chain Z4, which shows that these two types of inputs act independently on the OR-INHIBIT circuit and do not interfere with each other. Figure 8(c) It can be seen that the OR-INHIBIT circuit can indeed be formed by simply assembling an OR gate and an INHIBIT gate.

[0076] Real-time fluorescence experiments were performed to verify the feasibility of the OR-INHIBIT gate. The two ends of the substrate R1 were modified with the fluorescent group HEX and the quenching group BHQ1 respectively. Fig. 9 The fluorescence detection result of the OR-INHIBIT gate constructed based on this method is given. When no input chain is added, it can be seen that no significant fluorescence signal is generated, indicating that although Z3 and R1 can form a DNA complex Z3 / R1 ( Figure 8 (a) Lane 3, Figure 8 (b) Lanes 3 and 7), but it has almost no effect on the structure of the circuit; Curve (2) represents the case where input chain I2 is added, and it can be seen that no obvious fluorescence signal is generated; Curves (3)-(5) represent the case where I0 or (and) I1 and I2 are combined for input, and it can be seen that no fluorescence signal is generated, indicating that I2 has a significant inhibitory effect on other inputs; Curves (6)-(8) represent the case where input chain I0 or (and) I1 is combined for input when there is no I2, and it can be seen that significant fluorescence signals are generated, proving that substrate R1 is cut and the circuit gives a correct response. Fig. 9 The fluorescence results in the paper verify the correctness and feasibility of the OR-INHIBIT circuit design.

[0077] Example 6 Construction of a four-bit binary square root circuit using DNA ribozyme hairpin conformational assembly

[0078] Based on Example 1, the practicality of this method was verified. Fig.10 (a) Given a four-bit binary square root logic circuit diagram, Fig.10 (b) Give the truth table corresponding to the four-bit binary square root logic circuit. Fig.10 (c) Schematic diagram of the construction of a four-bit binary square root extraction circuit based on this method. The DNA chains I0, I1, I2, and I3 represent the four-bit binary inputs of the circuit, and the substrates R and R1 are used as reporter chains for detecting the output of the circuit. R1 is modified with a HEX fluorescent group to detect the output signal A0, and R is modified with a FAM fluorescent group to detect the output signal A1. Fig.10 As shown in (c), the 4-bit binary square root DNA circuit consists of an OR-INHIBIT circuit, an AND gate and an OR gate in parallel, where the output results of the OR-INHIBIT gate and the AND gate represent the result of the two-bit binary A0 of the circuit, and the output result of the OR gate represents the result of the two-bit binary A1 of the circuit. Fig.10(c), when the input integer is in the interval [0,3], that is, there is only a combination of input chains I0 and I1 in the square root DNA circuit, at this time, the OR-INHIBIT circuit in the DNA circuit responds to the input; when the input integer is in the interval [4,7], that is, there is a combination of input chains I0, I1, and I2 in the square root DNA circuit, at this time, due to the existence of I2, the OR-INHIBIT circuit, AND gate, and OR gate in the DNA circuit are all triggered, among which the OR-INHIBIT circuit is inhibited due to the triggering of I2, and the AND gate also has no signal output; when the input integer is in the interval [8,15], that is, there is a combination of input chains I0, I1, I2, and I3 in the square root DNA circuit, at this time, due to the existence of I3, the OR-INHIBIT circuit, AND gate, and OR gate in the DNA circuit are all triggered, and when both I2 and I3 exist (at this time, the input integer is in the interval [12,15]), the AND gate generates a signal output. Therefore, Fig.10 The output signal of the DNA circuit in (c) is Fig.10 (b) The square root extraction circuit truth table is consistent. It is worth noting that this circuit only uses 6 DNA chains. Including the input chain and the output signal reporting chain, the circuit also has only 12 different DNA chains. Compared with the existing results, the signal processing of the circuit is more efficient and convenient, and the complexity of the DNA chain is greatly reduced.

[0079] Real-time fluorescence experiments are performed to verify the feasibility of a four-bit binary square root extraction circuit. Fig.11 The fluorescence detection result diagram of a four-bit binary square root extraction circuit constructed based on this method is given. Fig.11 (a)(Corresponding ), when no input chain is added, it can be seen that no significant fluorescence signal is generated by either FAM or HEX. Fig.11 (b)(Corresponding ), when input chain I0 is added, it can be seen that no FAM fluorescence signal is generated, but HEX signal is generated. When input chain I1 is added, it can be seen that no FAM fluorescence signal is generated, but there is HEX signal output. Fig.11 (e)(corresponding ), when input chain I2 is added, it can be seen that the FAM signal increases significantly, but the HEX signal does not increase significantly. Fig.11 (f)(corresponding ), when input chains I0 and I3 are added, the generation of FAM signal can be seen, and the HEX signal is also significant. Fig.11 (l)(corresponding ) is the case where input chains I0, I1, I2 and I3 are added. It can be seen that FAM signals are generated, and HEX signals are also generated. The fluorescence signal detection results of the square root circuit in the other 6 cases have similar analysis processes and will not be repeated here.

[0080] Real-time fluorescence experiments were performed to verify the feasibility of the AND gate. The two ends of the substrate R1 were modified with the fluorescent group HEX and the quenching group BHQ1 respectively. Figure 2 (c) shows the fluorescence detection result of the AND gate constructed based on this method. Figure 2 (c) It can be seen that: Curve (1) represents the case where no input chain is added, and it can be seen that almost no fluorescence signal is generated; Curve (2) represents the case where input chain I2 is added, and it can be seen that almost no fluorescence signal is generated; Curve (3) represents the case where input chain I3 is added, although the fluorescence signal increases compared to the case where only I2 is input, it can be seen that the fluorescence signal is still at a low level; and from the case corresponding to curve (4), when input chains I2 and I3 are added at the same time, the AND gate gives an obvious fluorescence signal, indicating that under the simultaneous action of I2 and I3, the DNA ribozyme structure is formed and the function is activated, thereby cutting the substrate R1 and forming an obvious fluorescence signal output.

[0081] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some or all of the technical features therein. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope defined by the claims of the present invention.

Claims

1. A method for assembling a DNA circuit using DNA ribozyme hairpin conformational transformation, characterized in that: include: Step 1: Design the DNA sequence of the hairpin allosteric regulation DNA ribozyme assembly strategy; Wherein, the DNA sequence includes DNA single strand Z1, DNA single strand Z2, substrate R and trigger strand I; The structural domains designed on the DNA single strand Z1 include: a self-complementary domain s0, a DNA ribozyme conserved domain c1, a partial c11 domain of the c1 domain, and a toehold domain t0 set on the hairpin loop of the single strand Z1; The structural domains designed on the DNA single strand Z2 include: substrate binding domain b2*, DNA ribozyme conserved domain c2, complementary domain s0*, wherein the complementary domain s0* serves as a binding domain with the DNA strand Z1 and forms a hairpin structure with the self-complementary domain s0; The structural domains designed on the trigger chain I include: a toehold domain t0*, a binding domain S0, and a reverse complement sequence c11* of c11; The structural domains designed on the substrate chain R include: substrate binding domains b1 and b2*; The foothold domain t0 provided on the hairpin ring Z1 serves as a binding domain for the preset domain t0* on the trigger chain I; Step 2: Mix the DNA single strands Z1 and Z2 with the substrate R to obtain a mixed solution. In the initial state, Z1 and Z2 cannot form a complete DNA ribozyme structure through base complementarity. At this time, the DNA ribozyme is in an inactive state and cannot cut the substrate R and generate a signal. Step 3: When the trigger chain I is added to the mixed solution, the toehold domain t0* of I binds to the toehold domain t0 on the hairpin structure loop, and the hairpin structure is opened through branch migration. At this time, the self-complementary domain s0 on Z1 is exposed, and binds to the complementary domain s0* on Z2. At this time, the DNA chain Z1 / Z2 / I forms a complete DNA ribozyme structure, and the DNA ribozyme Z1 / Z2 / I binds to the substrate R through the pre-set substrate binding domains b1 and b2*. Under the synergistic action of magnesium ions, the DNA ribozyme Z1 / Z2 / I cuts the substrate R to form DNA chains O1 and O2, generating a signal.

2. The method for assembling DNA circuits using DNA ribozyme hairpin conformational transformation according to claim 1, characterized in that: The number of bases of the self-complementary domain s0 designed on the DNA single-strand Z1 is not less than 10 bases.

3. The method for assembling DNA circuits using DNA ribozyme hairpin conformational transformation according to claim 1, characterized in that: The 3' end of the DNA single strand Z1 extends to the DNA ribozyme conserved domain by no less than 3 bases.

4. The method for assembling DNA circuits using DNA ribozyme hairpin conformational transformation according to claim 1, characterized in that: The two ends of the substrate R are modified with the fluorescent group FAM and the quenching group BHQ1 respectively.

5. Application of the method according to any one of claims 1 to 4, characterized in that: The method is applied to construct AND gate, OR gate, INHIBIT gate, OR-INHIBIT gate, and four-bit binary square root circuit.

Images