Application of inhibitor in regulation and control of proliferation, invasion and migration of endometrial cancer cells
By using inhibitors that reduce circ_0005692 and/or SDC3 expression levels, the proliferation, invasion and migration of endometrial cancer cells is regulated, and the problem of difficult to effectively regulate endometrial cancer cells in the prior art is solved, and a significant reduction in tumor growth is achieved and proliferation effects.
Patent Information
- Application Number
- CN202411633133.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-15
- Publication Date
- 2025-02-14
AI Technical Summary
The prior art is difficult to effectively regulate the proliferation, invasion and migration of endometrial cancer cells, resulting in a poor prognosis of advanced and recurrent endometrial cancer.
Proliferation, invasion and migration of endometrial cancer cells are regulated by using inhibitors containing inhibitors that reduce circ_0005692 and/or SDC3 expression levels, including circ_0005692 and sDC3 small interfering RNA and SDC3 small interfering RNA.
Reducing the expression levels of circ_0005692 and/or SDC3 can significantly reduce the growth rate, proliferation level and clonal formation ability of endometrial cancer cells, thereby slowing down the tumor formation speed and size of tumors.
Smart Images
Figure CN119424645A_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of genetic engineering, and in particular to the application of an inhibitor in regulating the proliferation, invasion and migration of endometrial cancer cells. Background Art
[0002] Endometrial cancer (EC) is a malignant tumor that occurs in the glandular epithelium of the female endometrium, and its incidence is on the rise worldwide. At present, surgery is still the main treatment method commonly used in clinical practice. Although certain progress has been made in early diagnosis and treatment, the prognosis of advanced and recurrent endometrial cancer is still poor, with a 5-year overall survival rate of no more than 17%. Therefore, in-depth research on the occurrence and development of endometrial cancer has extremely important basic theoretical value and clinical significance for further improving the molecular typing of endometrial cancer, accurately predicting patient prognosis, and finding potential therapeutic targets. Research on the molecular basis and regulatory mechanisms related to the proliferation and metastasis of endometrial cancer cells can provide an important theoretical basis and research basis for the treatment of endometrial cancer.
[0003] Circular RNA (circRNA) is a type of single-stranded covalently closed RNA molecule that has the sponge adsorption effect of microRNA (miRNA) and small molecule proteins. CircRNA regulates gene expression at the transcriptional and post-transcriptional levels, and plays an important role in cell proliferation and differentiation, cell cycle, cell metabolism, apoptosis and maintenance of pluripotency, and plays an important biological function in host cells. In recent years, circRNAs associated with various tumors, including endometrial cancer, have been identified one after another, such as the circ0000437 gene associated with endometrial cancer vascular endothelial cells. Summary of the invention
[0004] The purpose of the present application is to provide an inhibitor for use in regulating the proliferation, invasion and migration of endometrial cancer cells.
[0005] The present application provides an application of an inhibitor in regulating the proliferation, invasion and migration of endometrial cancer cells, wherein the inhibitor contains a substance that reduces the expression level of circ_0005692 and / or SDC3, and the application does not include disease treatment and diagnosis.
[0006] Furthermore, the invention includes the application of circ_0005692 and / or SDC3 as targets in regulating the proliferation, invasion and migration of endometrial cancer cells.
[0007] Furthermore, the inhibitor includes one or more of the small interfering RNA of circ_0005692 and the small interfering RNA of SDC3, but is not limited thereto.
[0008] Furthermore, the circ_0005692 small interfering RNA is one or more of si_circ_0005692-01, si_circ_0005692-02 and si_circ_0005692-03, and the siRNA sequence is as follows:
[0009] si_circ_0005692-01:
[0010] The positive strand is shown in SEQ ID No. 1: ACCUUCUCGGGGAACUUGGAG,
[0011] The antisense strand is shown in SEQ ID No. 2: CCAAGUUCCCCGAGAAGGUGG;
[0012] si_circ_0005692-02:
[0013] The positive strand is shown in SEQ ID No. 3: AGAUGGUGGUGACAGGCUGAG,
[0014] The antisense strand is shown in SEQ ID No. 4: CAGCCUGUCACCACCAUCUGG;
[0015] si_circ_0005692-03:
[0016] The positive strand is shown in SEQ ID No. 5: UCUUCACGCAGGAACCGAGGC,
[0017] The antisense strand is shown in SEQ ID No. 6: CUCGGUUCCUGCGUGAAGACC.
[0018] Furthermore, the small interfering RNA of SDC3 is one or more of si_SDC3-01, si_SDC3-02 and si_SDC3-03, and the RNA sequence is as follows:
[0019] si_SDC3-01:
[0020] The positive strand is shown in SEQ ID No.7: CGCAAACUGUACAGAUUUACA,
[0021] The antisense strand is shown in SEQ ID No. 8: UAAAUCUGUACAGUUUGCGGG;
[0022] si_SDC3-02:
[0023] The positive strand is shown in SEQ ID No.9: GACACGUACUGCAAUGCAAGU,
[0024] The antisense strand is shown in SEQ ID No. 10: UUGCAUUGCAGUACGUGUCUG;
[0025] si_SDC3-03:
[0026] The positive strand is shown in SEQ ID No. 11: CCUGUAACCUGUUUAUUAACC,
[0027] The antisense strand is shown in SEQ ID No. 12: UUAAUAAACAGGUUACAGGGG.
[0028] Furthermore, circ_0005692 regulates the proliferation, invasion and migration of endometrial cancer cells by targeting the miR-650 / SDC3 axis. circ_0005692 is negatively correlated with miR-650, and miR-650 is negatively correlated with SDC3.
[0029] Furthermore, reducing the expression level of circ_0005692 and / or SDC3 can reduce the growth rate, proliferation level and clone formation ability of endometrial cancer cells.
[0030] Furthermore, reducing the expression level of circ_0005692 and / or SDC3 can reduce the tumor formation rate, tumor size or Ki-67 expression level of endometrial cancer cells, and the application does not include disease treatment and diagnosis.
[0031] Furthermore, it includes the use of the inhibitor in a product or drug for treating endometrial cancer, or the use of the inhibitor in a product or drug for prognosis of endometrial cancer.
[0032] Furthermore, the administration of the inhibitor includes injection, oral administration or inhalation, such as intratumoral injection.
[0033] The present application also provides a biomaterial, including the above-mentioned inhibitor, wherein the biomaterial is RNA, DNA, an expression cassette, a transposon, a polypeptide, a plasmid vector, a phage vector, a viral vector, an engineered bacterium or a transgenic cell line.
[0034] This application has the following beneficial effects:
[0035] (1) The inhibitor provided in this application contains substances that reduce the expression level of circ_0005692 and / or SDC3, and can target and regulate the proliferation, invasion and migration of endometrial cancer cells. circ_0005692 regulates the proliferation, invasion and migration of endometrial cancer cells by targeting the miR-650 / SDC3 axis. The molecular mechanism by which the inhibitor regulates the progression of endometrial cancer through the circ_0005692 / miR-650 / SDC3 axis is systematically elucidated, and the target of action is provided, which provides a research basis for the expansion of endometrial cancer research and plays a key role in the development of technology and drug research and development in this field.
[0036] (2) The inhibitors provided in this application can act jointly on circ_0005692 and SDC3 genes, or act on circ_0005692 or SDC3 genes alone, with flexible regulation and obvious effects.
[0037] (3) The inhibitors of the present application, such as inhibitors comprising small interfering RNA si_circ_0005692-01, si_circ_0005692-02, si_circ_0005692-03, si_SDC3-01, si_SDC3-02 or si_SDC3-03, are independently designed and synthesized, and can effectively inhibit the expression of the corresponding genes with high interference efficiency. Among them, si_circ_0005692-03 and si_SDC3-03 have more significant interference effects.
[0038] (4) The application of the present application specifically includes that the inhibitor reduces the expression level of circ_0005692 and / or SDC3, can reduce the growth rate, proliferation level and clone formation ability of endometrial cancer cells, and can reduce the tumor formation rate, tumor size or Ki-67 expression level of endometrial cancer cells.
[0039] (5) The biomaterials provided in this application can target and regulate the proliferation, invasion and migration of endometrial cancer cells in various forms and have clinical medicinal value. BRIEF DESCRIPTION OF THE DRAWINGS
[0040] Figure 1 The efficiency of circ_0005692 small interfering RNA knockdown in endometrial cancer Ishikawa cells.
[0041] Figure 2 Inhibition of circ_0005692 significantly reduced the proliferation level of endometrial cancer cells.
[0042] Figure 3 The effect of circ_0005692 on the invasion of endometrial cancer cells.
[0043] Figure 4 The effect of circ_0005692 on the migration of endometrial cancer cells.
[0044] Figure 5 To inhibit the effect of circ_0005692 on endometrial cancer tumor growth in nude mice.
[0045] Figure 6 To inhibit circ_0005692 to suppress endometrial cancer tumor proliferation in nude mice.
[0046] Figure 7 The efficiency of SDC3 small interfering RNA knockdown in endometrial cancer Ishikawa cells.
[0047] Figure 8 The effect of SDC3 replenishment on the growth curve of endometrial cancer cells.
[0048] Fig. 9 The effect of SDC3 replenishment on the proliferation level of endometrial cancer cells.
[0049] Fig.10 Effect of SDC3 complementation on the clone formation of endometrial cancer cells.
[0050] Fig.11 Effect of SDC3 replenishment on the invasion of endometrial cancer cells.
[0051] Fig.12 Effect of SDC3 replenishment on the migration of endometrial cancer cells.
[0052] Fig.13 The figure shows the expression of SDC3 in clinical endometrial cancer tissues, the histological grade of endometrial cancer, and the expression of proliferation antigen protein Ki-67. DETAILED DESCRIPTION
[0053] The following embodiments are used to illustrate the present application, but are not used to limit the scope of the present application. It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other arbitrarily.
[0054] The present application provides an application of an inhibitor in regulating the proliferation, invasion and migration of endometrial cancer cells, wherein the inhibitor contains a substance that reduces the expression level of circ_0005692 and / or SDC3, and the application does not include disease treatment and diagnosis. It includes the application of circ_0005692 and / or SDC3 as a target in regulating the proliferation, invasion and migration of endometrial cancer cells.
[0055] Molecular mechanism of circ_0005692 regulating the progression of endometrial cancer: circ_0005692 regulates the proliferation, invasion and migration of endometrial cancer cells by targeting the miR-650 / SDC3 axis. circ_0005692 is negatively correlated with miR-650, and miR-650 is negatively correlated with SDC3. circ_0005692 acts as a molecular sponge for miR-650, which binds to the 3'UTR region of SDC3. The circ_0005692 / miR-650 / SDC3 axis regulates the proliferation, invasion and migration of endometrial cancer cells, which is a new regulatory mechanism for endometrial cancer.
[0056] After overexpression of circ_0005692, inhibition of miR-650 can significantly increase the expression of SDC3 and enhance the proliferation, invasion and migration of endometrial cancer cells. After interfering with the expression of circ_0005692, overexpression of miR-650 inhibits the expression of SDC3 and significantly inhibits the proliferation, invasion and migration of endometrial cancer cells.
[0057] Overexpression refers to the use of a gene expression vector to transfer an expression cassette containing a target gene into a target cell, and utilizing the cell's own gene expression-related tool enzymes to express the target gene in the expression cassette in the vector, resulting in the obtained cells expressing a higher amount of the target gene than the starting cells.
[0058] SDC3 regulation or role: SDC3 is a protein-coding gene that plays an important role in development, cell adhesion, migration, and inflammation.
[0059] Molecular mechanism of circ_0005692 and SDC3 jointly regulating the progression of endometrial cancer: circ_0005692 regulates the proliferation, invasion and migration of endometrial cancer cells by targeting the miR-650 / SDC3 axis. SDC3 can also regulate the proliferation, invasion and migration of endometrial cancer cells. It has been verified that when the two act together, the effects on the proliferation, invasion and migration of endometrial cancer cells are more significant, specifically, the growth rate of cancer cells is significantly reduced, the proliferation level of cancer cells is significantly reduced, and the number of cell clones is significantly reduced. It has been verified that when the two act together, the effect on endometrial cancer tumorigenesis is more significant, specifically, the tumor volume and weight are significantly reduced, the proliferation level of tumor tissue is significantly reduced, and the tumorigenesis rate of endometrial cancer cells is further reduced.
[0060] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Examples 1-5 are experiments using circ_0005692 small interfering RNA inhibitors, and Examples 6-10 are experiments using SDC3 small interfering RNA inhibitors.
[0061] Example 1: circ_0005692 small interfering RNA interference efficiency
[0062] Cell culture and foreign gene transfection:
[0063] Ishikawa cells (purchased from Jiangsu Keygen Biotechnology Co., Ltd.) and HEC-1A cells (purchased from Jiangsu Keygen Biotechnology Co., Ltd.) are endometrial cancer cell lines. They were cultured in high-glucose DMEM medium and RPMI-1640 medium, respectively. DMEM contains 1% streptomycin and penicillin, and RPMI-1640 medium contains 10% FBS. The conditions for maintaining cell culture are 5% CO2 and 37°C, and the medium is replaced every 24-48h. After the cells are digested and collected, the cell density is adjusted to 1×10 5 / mL, inoculate in a 6-well cell culture plate, and continue culturing in a 37°C, 5% CO2 incubator. Transfection begins when the cell density reaches about 80%.
[0064] The transfection steps are as follows: ① dilute the plasmid: dilute 2.5 μg of plasmid in 125 μL of serum-free Opti-MEM medium and incubate at room temperature for 5 min; ② dilute Lipo3000: dilute 5 μL of lipo3000 in the same volume of medium as above and incubate at room temperature for 5 min. Mix the products obtained in step ① and step ②, and incubate at room temperature for 20 min. Add the above mixture to the culture well containing 1750 μL of culture medium of cells, mix well, and place in a CO2 incubator at 37°C for culture. After 6 hours, replace with fresh culture medium.
[0065] The RT-qPCR method was used to detect the efficiency of circ_0005692 knockdown in endometrial cancer Ishikawa cells.
[0066] like Figure 1 As shown, after circ_0005692 interference primers (si-circ_0005692) were transfected into Ishikawa cells, compared with the random control group, each interference primer could reduce the expression level of circ_0005692, and the expression efficiency of the si-circ_0005692-03 group of Ishikawa cells transfected with circ_0005692 was reduced to 25.12% (P<0.05).
[0067] Example 2: Effect of si-circ_0005692-03 on the proliferation of endometrial cancer cells
[0068] To explore the effects of inhibitors on the proliferation of endometrial cancer cells, CCK-8 was used to quantitatively track the growth rate of cells, and EdU staining analysis and clone formation experiments were performed.
[0069] CCK-8 kit and EdU staining kit were both from Jiangsu KeyGen Biotech Co., Ltd.
[0070] 1. CCK-8 experiment
[0071] The proliferation of endometrial cancer cells was evaluated using the CCK-8 kit. Ishikawa cells and HEC-1A cells of the endometrial cancer cell line transfected with si-circ_0005692-03 were inoculated into a corning 96-well plate at a density of 5000 cells per well in 100 μL of culture medium and cultured in an incubator at 37°C and 5% CO2. 10 μL of CCK-8 detection reagent was added to each well at 24, 48, 72, and 96 h, respectively. After continuing to culture in the incubator for 4 h, the cells were taken out and placed on a shaker for 10 min to mix gently, and the OD was measured using an enzyme reader. 450 The cell growth curve was drawn based on the absorbance.
[0072] 2. EdU staining experiment
[0073] After collecting the digestion fluid, adjust the cell density to 1×10 4 / mL, add 2000 cells per well to a 96-well cell culture plate, culture in a 37°C, 5% CO2 incubator, and wait for the cells to adhere to the wall after 24 hours. Discard the culture medium and wash with sterile PBS. Then, add 50μL of PBS containing 4% paraformaldehyde, 50μL of 2mg / mL glycine, and 100μL of 1×Hoechst 33342 reaction solution in sequence. Then add PBS to each well for washing. Finally, add 100μL of PBS to each well and take photos under a fluorescence microscope for observation (200×).
[0074] 3. Clone formation experiment
[0075] Collect the cells, resuspend them in complete medium containing 10% fetal bovine serum, and then implant them into 12-well plates (50-100 cells per well). Move the cell culture plate into a CO2 incubator and place it at 37°C, 5% CO2 and saturated humidity for 24 hours. After it adheres to the wall, continue to culture for 10 days; stain with 0.1% crystal violet, fix with methanol at room temperature for 15 minutes, and then observe under a dissecting microscope. Count cell colonies consisting of >50 cells and use them to compare colony-forming ability.
[0076] The results showed that the use of inhibitors to interfere with the expression of circ_0005692 in Ishikawa cells significantly decreased the growth rate of the Ishikawa cells / si-circ_0005692 group compared with the control group (P<0.05)( Figure 2-a); The results of EdU proliferation assay showed that the proliferation level of Ishikawa cells / si-circ_0005692 group was significantly reduced (P<0.05) ( Figure 2 -b); The results of the plate cloning experiment showed that the number of cell clones in the Ishikawa cell / si-circ_0005692 group decreased significantly (P<0.05) ( Figure 2 -c). The above data show that circ_0005692 can significantly promote the proliferation of endometrial cancer cells in vitro. When circ_0005692 is interfered with, the proliferation ability and growth rate of endometrial cancer cells are significantly reduced. Reducing the expression level of circ_0005692 can reduce the growth rate, proliferation level and cloning ability of endometrial cancer cells.
[0077] Example 3: Effect of si-circ_0005692-03 on the invasion of endometrial cancer cells
[0078] Transwell assay was used to detect the effects of inhibitors on the invasion of endometrial cancer cells.
[0079] Before the experiment, Matrigel (from BD Biosciences) was melted overnight. The melted Matrigel was diluted by half with incomplete culture medium, and 30 μL of the diluted mixture was added to the upper chamber and incubated at 37°C for 120 min to make the gel. The density of endometrial cancer cells was adjusted, and approximately 10,000 cells transfected with si-circ_0005692-03 were suspended in 200 μL of serum-free culture medium and placed in the upper compartment of each Transwell chamber. Culture medium containing 10% FBS was added to the lower chamber as a chemical attractant. The cells were incubated at 37°C with 5% CO2 for 48 h for invasion experiments.
[0080] The results showed that compared with the control group, the invasion level was significantly reduced after the inhibitor interfered with the expression of circ_0005692 in Ishikawa cells (P<0.05) ( Figure 3 ).
[0081] Example 4: Effect of si-circ_0005692-03 on the migration level of endometrial cancer cells
[0082] The scratch assay was used to detect the effect of inhibiting circ_0005692 on the migration level of endometrial cancer cells.
[0083] Ishikawa cells and HEC-1A cells were infected with lentivirus carrying si-circ_0005692-03 and cultured separately. Ishikawa cells and HEC-1A cells of endometrial cancer cells in the logarithmic growth phase were digested and collected with 0.25% trypsin. When the intercellular spaces increased and the cells became round, serum-containing culture medium was added to terminate the digestion. After centrifugation at 1000rpm for 5 minutes at room temperature, the supernatant was discarded, and the cell density was adjusted to 5000 cells per milliliter with complete cell culture medium. 2mL of cell suspension was inoculated into Corning six-well cell culture plates and placed in a 37°C, 5% CO2 incubator for 24 hours to allow the cells to adhere to the wall. The cells were further cultured, and when the cell confluence reached about 80%, a sterile pipette tip was used to evenly draw lines in a six-well plate; the floating cells were then washed with 1× PBS, and then fresh culture medium was replaced and placed in a cell culture incubator at 37°C, 5% CO2 for another 48 h. The cells were removed, photographed under a bright field microscope (magnification 100×), and the cell migration distance was measured using Image J.
[0084] Figure 4 , a. Scratch test of the migration ability of endometrial cancer cell Ishikawa cells after inhibiting circ_0005692, 50μm ruler; b. Statistical analysis of the migration distance of endometrial cancer cell Ishikawa cells; all data were repeated three times independently and expressed as Mean±SD, *: P<0.05, ns: P>0.05. The results showed that Figure 4 As shown, compared with the control group, the cell migration level of Ishikawa cells was significantly reduced after circ_0005692 was inhibited (P<0.05).
[0085] Example 5: Effect of si-circ_0005692-03 on tumorigenesis of endometrial cancer in nude mice
[0086] Nude mouse tumor bearing experiment was used to evaluate the growth of endometrial cancer cells expressing circ_0005692 in nude mice.
[0087] Twelve 6-week-old BALB / c female nude mice were selected. After the Ishikawa cells with high expression of circ_0005692 formed tumors, the inhibitor containing si_circ_0005692-03 was injected peritumorally once every other day at 10 nmol / kg body weight. After 14 days of treatment, the nude mice were anesthetized and killed, photographed, and the tumors were removed and weighed. The specific groups were: (1) Ishikawa cells / NC, (2) Ishikawa cells / si-circ_0005692. There were 6 mice in each group, for a total of 2 groups.
[0088] Figure 5, a. Tumor morphology after Ishikawa cells inhibited circ_0005692 tumor cells from forming tumors in nude mice; b. Tumor volume; c. Tumor weight; All data were repeated 6 times independently and expressed as Mean±SD, *: P<0.05. Figure 6 , a. HE staining to detect the pathological changes of nude mouse tumor tissues after inhibition of circ_0005692 in endometrial cancer cells HEC-1A and Ishikawa cells, scale bar 100μm; b. Immunohistochemistry to detect the expression level of Ki-67 protein in endometrial cancer tumor tissues after inhibition of circ_0005692, scale bar 50μm; c. Statistical analysis of the proportion of Ki-67 positive cells in tumor tissues; All data were repeated three times independently and expressed as Mean±SD, *: P<0.05.
[0089] The results showed that the tumor volume and weight of the nude mice after Ishikawa cells inhibited circ_0005692 were significantly reduced compared with the control group (P<0.05) ( Figure 5 ), Ki-67 staining results showed that the proliferation level of tumor tissue was significantly decreased (P<0.01) ( Figure 6 The above results also support the research results in cell lines. Inhibiting circ_0005692 can reduce the tumor formation rate of endometrial cancer cells in nude mice.
[0090] Example 6: SDC3 small interfering RNA interference efficiency
[0091] First, three pairs of SDC3 siRNA (si-circ_0005692) primers (SEQ ID No.7-SEQ ID No.12) were constructed and transfected into HEC-1A and Ishikawa cells, respectively.
[0092] Endometrial cancer cell lines Ishikawa cells and HEC-1A cells were cultured in high-glucose DMEM medium and RPMI-1640 medium containing 1% streptomycin and penicillin and 10% fetal bovine serum (FBS), respectively. Cells were digested using 0.25% trypsin. The cell digestion solution was collected and centrifuged at 1000 rpm for 5 min, the supernatant was discarded, and the cell density was adjusted to 1×10 with complete cell culture medium. 5 2 mL of cell suspension was inoculated into a 6-well plate and placed in a 37°C, 5% CO2 incubator for further culture. The next day, when the cell confluence reached 70-80%, transfection was started. The transfection steps were the same as those in Example 1.
[0093] RT-qPCR was used to detect the efficiency of SDC3 knockdown in endometrial cancer Ishikawa cells.
[0094] like Figure 7 As shown, compared with the NC group, si-SDC3-03 had the highest inhibition rate on the expression level of SDC3 mRNA (inhibition rate>70%) (P<0.001). Therefore, si-SDC3-03 was selected as the best siRNA for subsequent SDC3 knockdown experiments.
[0095] Example 7: Effect of SDC3 on the proliferation of endometrial cancer cells
[0096] CCK-8 cell proliferation assay, EdU proliferation staining and clone formation assay were used to detect the proliferation of two endometrial cancer cell lines: control group, circ_0005692 overexpression group and circ_0005692 overexpression and SDC3 interference group (SDC3 small interfering RNA is si_SDC3-03).
[0097] circ_0005692+si-NC is the negative control, and circ_0005692+si-SDC3 is the SDC3 inhibition group. As the classic ceRNA competition mechanism, the effects of circ_0005692 and SDC3 on tumors can generally be reversely verified.
[0098] Figure 8 a. The CCK-8 method was used to detect the effects of circ_0005692 overexpression and SDC3 complementation on the growth curve of endometrial cancer HEC-1A cells; b. The CCK-8 method was used to detect the effects of circ_0005692 overexpression and SDC3 complementation on the growth curve of endometrial cancer Ishikawa cells; all data were repeated three times independently and expressed as Mean±SD, **P<0.01.
[0099] Fig. 9 a. The EdU proliferation staining method was used to detect the effects of circ_0005692 overexpression and SDC3 complementation on the proliferation level of endometrial cancer cell HEC-1A cells and Ishikawa cells, 50μm scale; b. The proliferation rates of endometrial cancer cell HEC-1A cells and Ishikawa cells under circ_0005692 overexpression and SDC3 complementation were statistically analyzed; all data were repeated three times independently and expressed as Mean±SD, **: P<0.01.
[0100] Fig.10a. Crystal violet staining was used to detect the effects of circ_0005692 overexpression and SDC3 complementation on the clone formation of endometrial cancer cells HEC-1A cells and Ishikawa cells; b. The colony numbers of endometrial cancer cells HEC-1A cells and Ishikawa cells under circ_0005692 overexpression and SDC3 complementation were counted; all data were repeated three times independently and expressed as Mean±SD, **P<0.01, ***P<0.001.
[0101] The results showed that overexpression of circ_0005692 promoted the growth of endometrial cancer cells, while inhibition of SDC3 decreased the cell growth rate ( Figure 8 ), the proliferation level of tumor cells ( Fig. 9 ) and colony formation ability also decreased significantly ( Fig.10 ).
[0102] Example 8: Effect of SDC3 on the invasion of endometrial cancer cells
[0103] In Ishikawa cells and HEC-1A cells, circ_005692 was designed to be overexpressed to inhibit SDC3 (SDC3 small interfering RNA is si_SDC3-03).
[0104] Fig.11 a. Transwell assay to detect the effects of circ_0005692 overexpression and SDC3 complementation on the invasion of endometrial cancer cells, 50 μm ruler; b. Statistics of the number of invasive cells; All data were repeated three times independently and expressed as Mean±SD, **P<0.01, ***P<0.001.
[0105] The results showed that overexpression of circ_0005692 promoted the invasion level of endometrial cancer cells, while inhibition of SDC3 decreased the invasion level of cells ( Fig.11 ).
[0106] Example 9: Effect of SDC3 on the migration level of endometrial cancer cells
[0107] In Ishikawa cells and HEC-1A cells, circ_005692 was overexpressed and then SDC3 was inhibited (SDC3 small interfering RNA was si_SDC3-03).
[0108] Fig.12, a. Scratch assay to detect the effects of overexpression of circ_0005692 in endometrial cancer cells and SDC3 complementation on the migration of endometrial cancer cells, 100 μm ruler; b. Statistical analysis of the migration distance of endometrial cancer cells; all data were repeated three times independently and expressed as Mean±SD, **P<0.01.
[0109] The results showed that overexpression of circ_0005692 promoted the migration level of endometrial cancer cells, while inhibition of SDC3 decreased the migration level of cells ( Fig.12 ).
[0110] Example 10: Effect of SDC3 on endometrial cancer tumor tissue
[0111] Through relevant studies, it is known that the protein expression of SDC3 in endometrial cancer tumor tissue is significantly higher than that in adjacent tissues. On this basis, the tumor size, age, tumor stage, histological grade, histological type, tumor myometrial invasion depth, p53 mutation, Ki-67 expression (Ki-67 represents the cell proliferation index, ≥20% is defined as positive) and clinical characteristics of lymph node metastasis of 47 patients with endometrial cancer were comprehensively analyzed for correlation with SDC3 expression. The cancer tissues of patients with endometrial cancer were obtained from Suzhou Science and Technology City Hospital and the First Affiliated Hospital of Soochow University. In accordance with the requirements of the Ethics Committee, all patients participating in this study signed informed consent before the start of the study.
[0112] Fig.13 , a. Immunohistochemical staining of SDC3 protein, 50μm ruler; b. Statistical analysis of SDC3 protein expression; c. Histological grade and SDC3 expression; d. Ki-67 and SDC3 expression. All data are expressed as Mean±SD, **: P<0.01, ****: P<0.0001.
[0113] The results showed that the tumor histological grade, Ki-67 expression and SDC3 expression were significantly correlated ( Fig.13 -c and d), and the high expression (positive) of Ki-67 was strongly positively correlated with the expression of SDC3, indicating that the expression of SDC3 in endometrial cancer was significantly correlated with tumor growth at the clinical level.
[0114] For ordinary technicians in this technical field, these modifications or improvements made without departing from the spirit of this application should also be regarded as the scope of protection required by this application.
Claims
1. Use of an inhibitor in regulating the proliferation, invasion and migration of endometrial cancer cells, characterized in that: The inhibitor contains a substance that reduces the expression level of circ_0005692 and / or SDC3.
2. The use according to claim 1, characterized in that: Including the application of circ_0005692 and / or SDC3 as targets in regulating the proliferation, invasion and migration of endometrial cancer cells.
3. The use according to claim 1, characterized in that: The inhibitor includes one or more of the small interfering RNA of circ_0005692 and the small interfering RNA of SDC3.
4. The use according to claim 3, characterized in that: The small interfering RNA of circ_0005692 is one or more of si_circ_0005692-01, si_circ_0005692-02 and si_circ_0005692-03, and the siRNA sequence is as follows: si_circ_0005692-01: The positive strand is shown in SEQ ID No. 1: ACCUUCUCGGGGAACUUGGAG, The antisense strand is shown in SEQ ID No. 2: CCAAGUUCCCCGAGAAGGUGG; si_circ_0005692-02: The positive strand is shown in SEQ ID No. 3: AGAUGGUGGUGACAGGCUGAG, The antisense strand is shown in SEQ ID No. 4: CAGCCUGUCACCACCAUCUGG; si_circ_0005692-03: The positive strand is shown in SEQ ID No. 5: UCUUCACGCAGGAACCGAGGC, The antisense strand is shown in SEQ ID No. 6: CUCGGUUCCUGCGUGAAGACC.
5. The use according to claim 3, characterized in that: The small interfering RNA of SDC3 is one or more of si_SDC3-01, si_SDC3-02 and si_SDC3-03, and the siRNA sequence is as follows: si_SDC3-01: The positive strand is shown in SEQ ID No.7: CGCAAACUGUACAGAUUUACA, The antisense strand is shown in SEQ ID No. 8: UAAAUCUGUACAGUUUGCGGG; si_SDC3-02: The positive strand is shown in SEQ ID No.9: GACACGUACUGCAAUGCAAGU, The antisense strand is shown in SEQ ID No. 10: UUGCAUUGCAGUACGUGUCUG; si_SDC3-03: The positive strand is shown in SEQ ID No. 11: CCUGUAACCUGUUUAUUAACC, The antisense strand is shown in SEQ ID No. 12: UUAAUAAACAGGUUACAGGGG.
6. The use according to claim 1, characterized in that: circ_0005692 regulates the proliferation, invasion and migration of endometrial cancer cells by targeting the miR-650 / SDC3 axis. circ_0005692 is negatively correlated with miR-650, and miR-650 is negatively correlated with SDC3.
7. The use according to claim 1, characterized in that: Reducing the expression level of circ_0005692 and / or SDC3 can reduce the growth rate, proliferation level and clone formation ability of endometrial cancer cells; or reducing the expression level of circ_0005692 and / or SDC3 can reduce the tumor formation rate, tumor size or Ki-67 expression level of endometrial cancer cells. The application does not include disease treatment and diagnosis.
8. The use according to claim 1, comprising use of the inhibitor in a product or drug for treating endometrial cancer, or use of the inhibitor in a product or drug for prognosis of endometrial cancer.
9. The use according to claim 8, wherein the inhibitor is administered by injection, oral administration or inhalation.
10. A biomaterial, characterized in that: The inhibitor according to claim 1, wherein the biological material is RNA, DNA, expression cassette, transposon, polypeptide, plasmid vector, phage vector, virus vector, engineered bacteria or transgenic cell line.