Micro-fluidic chip, and exosome miRNA detection kit and detection method based on micro-fluidic chip

Abstract

The invention discloses a micro-fluidic chip, and an exosome miRNA detection kit and detection method based on the micro-fluidic chip, and belongs to the technical field of micro-fluidic chips. The micro-fluidic chip comprises a substrate and a cover plate, and a mixing channel area, an exosome capture area and an exosome detection area are sequentially connected to the cover plate; the exosome capturing area comprises an exosome capturing area inlet, a capturing area Y-shaped microcolumn array and an exosome capturing area outlet which are sequentially connected from left to right; the exosome detection area comprises an exosome detection area inlet connected with the exosome capture area outlet; an entrance of the exosome detection area is provided with two branches which are respectively connected with the first detection area Y-shaped micro-column array and the second detection area Y-shaped micro-column array. The microfluidic chemiluminescence biosensor based on multiple signal amplification of a Y-type array, HCR reaction and Poly-HRP disclosed by the invention can be used for early detection of breast cancer exosomes miR-21 and miR-155.

Description

Technical Field

[0001] The present invention belongs to the technical field of microfluidic chips, and specifically relates to a microfluidic chip, a detection kit and a detection method for antigens based on the microfluidic chip, and in particular to a detection kit and a detection method for breast cancer exosomes miR-21 and miR-155. Background Art

[0002] Breast cancer is a highly heterogeneous disease. The clinical treatment of breast cancer mainly includes surgical resection, chemotherapy, radiotherapy, etc. In recent years, new breast cancer treatment drugs have emerged, such as small molecule targeted inhibitors (pyrotinib), macromolecular drugs (trastuzumab, pembrolizumab), etc. Although chemotherapy and cytotoxic drugs can effectively kill cancer cells and inhibit cancer cell growth, there are still serious off-target toxicity and late-stage drug resistance problems. Therefore, improving the early diagnosis of breast cancer is crucial to reducing mortality and improving survival benefits. Early breast cancer can usually be cured. If diagnosed early when the tumor size is less than 2 cm, it can greatly improve the patient's overall survival and prognosis.

[0003] Currently, the diagnostic methods for breast cancer used in clinical practice include mammography, breast ultrasound, and carbohydrate antigen CA 15-3 testing. Mammography has a high false positive rate of 12%-65%, is not suitable for women under 40 years old, and is prone to cause pain and discomfort. Breast ultrasound can detect denser breast tissue, but the accuracy of the results is highly dependent on the instrument and the level of the doctor. The carbohydrate antigen CA 15-3 test has a sensitivity of up to 80% for advanced breast cancer, but the initial sensitivity is low, only 30%. Therefore, developing a detection method for detecting early breast cancer is crucial to improving the survival benefits of breast cancer patients.

[0004] Exosomes are an emerging liquid biopsy marker. Due to the presence of phospholipid bilayers, miRNAs in vivo can be stably present, and have broad development prospects in breast cancer diagnosis and prognosis assessment. However, the small size of exosomes limits their further application. Conventional exosome separation and detection methods have many defects, such as cumbersome operation, bulky instruments and equipment, high cost, and insufficient sensitivity. In addition, conventional exosome separation and detection methods cannot integrate exosome separation and in vivo miRNA detection into one device, which limits its clinical application.

[0005] The rise of microfluidic chip technology has provided a good platform for the separation of exosomes and the detection of miRNA in vivo. The advantages of microfluidic chips such as miniaturization, integration, and low reagent consumption enable them to solve the various problems faced by traditional detection platforms. At present, there are many methods that use microfluidic chips to integrate exosome separation and exosome detection. However, for the detection of low-concentration exosomal miRNA, its detection sensitivity still needs to be further improved. In addition, many colorimetric, fluorescence, electrochemical and other detection methods have been developed in combination with biosensors of microfluidic chips. However, most of them also have some problems, such as insufficient detection sensitivity of colorimetric methods, easy fluorescence quenching in fluorescence detection, and poor repeatability of electrochemical detection methods. Chemiluminescence is a method that converts the concentration signal of the target to be detected into the chemiluminescent signal intensity. The main signal generation is through the enzyme-catalyzed substrate and oxidant (such as horseradish peroxidase-catalyzed luminol-hydrogen peroxide system) to produce chemiluminescence. The corresponding chemiluminescent signal intensity in the detection system is converted, which has the advantages of high sensitivity, rapid response, and low background signal. The microfluidic chip biosensor combined with chemiluminescence can achieve high-specificity detection of exosomal miRNA.

[0006] Hybridization chain reaction (HCR) is a commonly used high-signal method strategy. Its basic principle is that two designed hairpin oligonucleotides and a chain oligonucleotide initiate the chain. The starting point on the stem-loop structure can be a naked oligonucleotide with complementary sequence. Through the base complementary pairing principle and topological reaction dynamics, the structure changes to complete the self-assembly between oligonucleotides. The result of this reaction is to form a long double-stranded oligonucleotide structure by fixing two hairpin oligonucleotides on a substrate, and to generate analytical detection signals through specific groups introduced in advance in the hairpin oligonucleotide. Since the same hairpin oligonucleotide is reused many times, the concentration signal of the target analyte can be amplified by establishing a connection between the target analyte to be detected and the oligonucleotide. Summary of the invention

[0007] In view of the problems existing in the above-mentioned prior art, the purpose of the present invention is to design and provide a microfluidic chip, a detection kit and a detection method for breast cancer exosome miRNA based on a microfluidic chip. The present invention improves the capture efficiency of exosomes by increasing the specific surface area of ​​the microcolumns through a Y-shaped array, amplifies the signal through HCR reaction and Poly HRP polymer molecules, and detects by direct chemiluminescence reaction through luminol and hydrogen peroxide. The microfluidic chemiluminescent biosensor based on the Y-shaped array, HCR reaction and Poly-HRP multiple signal amplification of the present invention can be used for the early detection of breast cancer exosome miR-21 and miR-155. The present invention has developed a chemiluminescent microfluidic chip integrating reagent mixing, exosome capture and exosome miRNA detection. The upstream mixing channel mixes the chemiluminescent reagents, and the downstream detection microchannel captures the antigen and detects the chemiluminescent signal.

[0008] In order to achieve the above object, the present invention adopts the following technical solutions:

[0009] In one aspect, the present invention provides a microfluidic chip, comprising a substrate and a cover sheet, wherein a mixing channel area, an exosome capture area and an exosome detection area are sequentially connected on the cover sheet;

[0010] The material of the cover sheet is polydimethylsiloxane (PDMS), which has the advantages of high air permeability, high light transmittance, easy surface modification, strong biocompatibility, etc., and is suitable for chemiluminescence detection.

[0011] The exosome capture zone includes an exosome capture zone entrance, a capture zone Y-shaped microcolumn array, and an exosome capture zone exit, which are sequentially connected from left to right;

[0012] The exosome detection area includes an exosome detection area entrance connected to the exosome capture area exit; the exosome detection area entrance has two branches, which are respectively connected to the first detection area Y-shaped microcolumn array and the second detection area Y-shaped microcolumn array; the first detection area exit is provided on the right side of the first detection area Y-shaped microcolumn array, and the second detection area exit is provided on the right side of the second detection area Y-shaped microcolumn array;

[0013] The mixing channel area includes a mixing channel outlet connected to the first detection area outlet, and the right side of the mixing channel outlet is connected to the mixing channel; a mixing channel inlet is provided in the middle of the right side of the mixing channel; the mixing channel inlet is connected to two inlets, namely the first fluid inlet and the second fluid inlet.

[0014] The exosome capture zone is a boat-shaped capture zone, and the streamlined design of the boat-shaped detection zone with gradual expansion at the inlet and gradual contraction at the outlet avoids the generation of dead corners, so that the reagents can be distributed more evenly after entering the capture microchannel; the detection zone is a boat-shaped detection zone, and the streamlined design of the boat-shaped detection zone with gradual expansion at the inlet and gradual contraction at the outlet avoids the generation of dead corners, so that the mixed reagents can be distributed more evenly after entering the detection microchannel; the capture zone is 3.3 mm long, 2.5 mm wide, and 50 μm high; the detection zone is 3.3 mm long, 2.5 mm wide, and 50 μm high; the serpentine mixing channel has a width of 200 μm, a depth of 50 μm, and a total length of 20 cm. Its narrow and long characteristics allow the chemiluminescent reagents to be fully mixed to a greater extent in fluid mechanics, thereby quickly generating a higher chemiluminescent signal, and folding the mixing channel into a serpentine shape can save space.

[0015] In the microfluidic chip, the mixing channel is serpentine;

[0016] The intervals between the several microcolumns in the Y-shaped microcolumn array in the first detection area and the Y-shaped microcolumn array in the second detection area are detection microchannels; the microcolumns can increase the inner surface area of ​​the microchannel in the detection area, provide more space for its inner surface modification, and can increase the antigen-antibody binding probability and efficiency of the enzyme-linked immunosorbent reaction to a greater extent in terms of fluid mechanics.

[0017] The Y-shaped microcolumn array in the capture zone is modified with CD63 nucleic acid aptamers;

[0018] The first detection area Y-shaped microcolumn array and the second detection area Y-shaped microcolumn array are both modified with H1 hairpin probes;

[0019] Preferably, the capture zone Y-shaped microcolumn array (202) is sealed with bovine serum albumin.

[0020] In a second aspect, the present invention provides a detection system based on a microfluidic chip, comprising the microfluidic chip, a microinjection pump, a catheter, a syringe, a PMT detector, an ultraweak chemiluminescence analyzer and a waste liquid pool;

[0021] The conduit is used to connect the syringe with the first fluid inlet in the microfluidic chip, connect the syringe with the second fluid inlet in the microfluidic chip, connect the waste liquid pool with the first detection zone outlet in the microfluidic chip, and connect the waste liquid pool with the second detection zone outlet in the microfluidic chip;

[0022] The microinjection pump is connected to the first fluid inlet and is used to control the flow rate and flow rate of the liquid injected into the first fluid inlet and the second fluid inlet;

[0023] The PMT detector is located inside the ultra-weak chemiluminescence analyzer, and the light inlet of the PMT detector matches the detection microchannel for background signal collection;

[0024] The ultra-weak chemiluminescence analyzer is used for collecting background signals and chemiluminescence spectra.

[0025] In a third aspect, the present invention provides a detection kit based on a microfluidic chip, comprising the microfluidic chip, a biotin-modified hairpin oligonucleotide H1, a biotin-modified hairpin oligonucleotide H2, a streptavidin-modified horseradish peroxidase polymerase, and a chemiluminescent reagent;

[0026] The sample to be tested contains a priming strand I, the priming strand I and the hairpin structure oligonucleotide H1 have n complementary paired bases, and the hairpin structure oligonucleotide H1 and the hairpin structure oligonucleotide H2 have m complementary paired bases;

[0027] 2n≤m, n and m are natural numbers that do not include 0;

[0028] The hairpin structure oligonucleotide H1 can form a hairpin structure after annealing, and the hairpin structure oligonucleotide H2 can form a hairpin structure after annealing;

[0029] Preferably, the hairpin structure oligonucleotide H1 and the hairpin structure oligonucleotide H2 are both modified with biotin at the 3' end;

[0030] Preferably, the chemiluminescent reagent is luminol and / or hydrogen peroxide.

[0031] In the detection kit based on a microfluidic chip, the nucleotide sequence of the hairpin structure oligonucleotide H1 is shown as SEQ ID NO.1 or SEQ ID NO.3;

[0032] The nucleotide sequence of the hairpin structure oligonucleotide H2 is shown as SEQ ID NO.2 or SEQ ID NO.4.

[0033] The present invention uses horseradish peroxidase polymerase (Poly-HRP for short), which has higher enzyme activity than traditional horseradish peroxidase and further amplifies the chemiluminescent signal. In addition, the chemiluminescent reaction does not require an external light source, avoiding the interference of high background signals, and the related chemiluminescent instrument is easy to operate, providing great potential for early detection of breast cancer.

[0034] In a third aspect, the present invention provides a method for using the detection kit, comprising the following steps:

[0035] (1) injecting the sample to be tested into the exosome capture area of ​​the microfluidic chip through the inlet of the exosome capture area, allowing it to stand, and then cleaning the Y-shaped microcolumn array in the capture area after the exosomes in the sample to be tested are captured;

[0036] (2) injecting the exosome lysate into the exosome capture zone of the microfluidic chip through the inlet of the exosome capture zone, allowing it to stand, sealing the outlet of the exosome capture zone, cleaning the Y-shaped microcolumn array of the capture zone, and allowing the obtained exosome miRNA to enter the exosome detection zone through the inlet (204) of the exosome detection zone, allowing it to stand for a second time, and cleaning the detection microchannel in the exosome detection zone with a buffer solution;

[0037] (3) unblocking the closed outlet of the exosome capture zone, and introducing the annealed biotin-modified hairpin oligonucleotide H1 and the annealed biotin-modified hairpin oligonucleotide H2 into the exosome capture zone through the inlet of the exosome detection zone, causing a hybridization chain reaction, standing, and washing the detection microchannel in the exosome detection zone with a buffer solution;

[0038] (4) injecting streptavidin-modified horseradish peroxidase into the exosome detection area through the inlet of the exosome detection area, allowing it to stand, and using a buffer solution to clean the detection microchannel in the exosome detection area;

[0039] (5) injecting the chemiluminescent reagent into the exosome detection area through the first fluid inlet, and injecting the chemiluminescent reagent into the exosome detection area through the second fluid inlet; the mixing channel is used for fully mixing the chemiluminescent reagent lumilol and hydrogen peroxide;

[0040] (6) The background signal and chemiluminescence spectrum are collected by using a PMT detector and an ultra-weak chemiluminescence analyzer, and the expression level of exosomal miRNA in the sample to be tested is determined based on the chemiluminescence spectrum.

[0041] In the method of use, the breast cancer exosome miRNA in step (6) is miRNA-21 and breast cancer exosome miRNA-155.

[0042] In the method of use, the standing time in step (1) is 1.5 to 2 hours, and the standing temperature is 25° C. to 37° C.;

[0043] The second standing time in step (2) is 0.5-1h, and the standing temperature is 25°C to 37°C;

[0044] The standing time in step (3) is 1 to 1.5 hours, and the standing temperature is 25° C. to 37° C.;

[0045] The standing time in step (4) is 0.5-0.8h, and the standing temperature is 25°C to 37°C;

[0046] The volume ratio of lumilol to hydrogen peroxide in step (5) is 1:1;

[0047] The injection flow rates of lumilol and hydrogen peroxide in step (5) are both 5-10 μL / min;

[0048] The ultraweak chemiluminescence analyzer described in step (6) is preheated for 15 to 30 minutes before use;

[0049] The collection time in step (6) is within 300 seconds after the injection of luminol and hydrogen peroxide.

[0050] In a fourth aspect, the present invention provides the use of the microfluidic chip, the detection system or the detection kit in the preparation of reagents or equipment for detecting and / or early diagnosis of diseases.

[0051] The application is characterized in that the disease is breast cancer.

[0052] The principle of the above technical solution of the present invention for the detection of exosome miRNA is to take exosome miR-21 as an example: first, CD63 nucleic acid aptamers are modified on the Y-shaped microcolumn array in the capture area, and then bovine serum albumin (BSA) is added to block the surface of the exosome capture area to avoid nonspecific adsorption on the chip surface. When the sample contains exosomes, the exosomes are recognized and captured by the fixed CD63 nucleic acid aptamers, and then the lysis solution is added to lyse and release the corresponding exosome miRNA;

[0053] The H1 hairpin probe is pre-modified on the microcolumn of the exosome detection area, and then bovine serum albumin (BSA) is added to seal the surface of the capture area to avoid non-specific adsorption on the chip surface. When the released exosome miRNA contains miR-21, miR-21 can be captured by the H1 hairpin probe modified on the microcolumn; then, the hairpin structure oligonucleotide sequences H1 and H2 for HCR reaction are added to the detection microchannel, wherein H1 and H2 are modified with biotin. During the HCR amplification, the amount of biotin inside the chip is also increasing; finally, streptavidin-modified horseradish peroxidase (SA-Poly HRP) is added, and Poly-HRP is modified on the microfluidic chip through the combination of streptavidin (SA) and biotin. Among them, horseradish peroxidase (HRP) can catalyze and accelerate the chemiluminescent reaction of chemiluminescent reagents (such as luminol and hydrogen peroxide (H2O2)). During signal detection, the accelerated chemiluminescent reagent (such as luminol and hydrogen peroxide) is introduced into the detection microchannel through the mixing channel, and finally the CL signal is detected by the ultra-weak chemiluminescence instrument. When miR-21 and miR-155 are present in the solution, the modified H1 hairpin probe on the microcolumn is opened, and then the hairpin structure oligonucleotide sequences H1 and H2 of the HCR reaction are added to the detection microchannel, and the HCR reaction is triggered by the target miRNA to amplify the signal.

[0054] Compared with the prior art, the present invention has the following beneficial effects:

[0055] 1. The microfluidic chip of the present invention is a chemiluminescent biosensor that can be used for the detection of exosome miRNA in breast cancer. The detection method of the present invention is based on a Y-shaped array, HCR reaction and Poly-HRP combination, and through a multiple signal amplification strategy, low-concentration exosome miRNA detection is converted into a high-intensity chemiluminescent signal, thereby improving the detection sensitivity. The method has good specificity, low detection limit and wide linear range, providing more accurate data for quantitative detection.

[0056] 2. The present invention achieves early detection of breast cancer by detecting exosomal miR-21 and miR-155. Compared with traditional breast cancer detection methods, it requires less reagents and samples, has a high degree of automation and integration, and has high detection sensitivity.

[0057] 3. The streamlined design of the microchannels of the exosome capture zone and the exosome detection zone of the present invention, which gradually expands at the inlet and contracts at the outlet, avoids the generation of dead corners and allows the reagents to be distributed more evenly after entering the microchannel.

[0058] 4. The serpentine mixing channel of the present invention is narrow and long, which allows the chemiluminescent reagents to be fully mixed to a greater extent in terms of fluid mechanics, thereby quickly generating a higher chemiluminescent signal, and folding the mixing channel into a serpentine shape can save space.

[0059] 5. The Y-shaped microcolumn array of the present invention can increase the inner surface area of ​​the microchannel in the boat-shaped detection zone, provide more space for its inner surface modification, and can increase the exosome capture efficiency to a greater extent in terms of fluid mechanics.

[0060] 6. The detection method of the present invention can be used for the detection of miR-21 and miR-155 in breast cancer exosomes, which has important application prospects in the field of early detection of breast cancer. In addition, the present invention can detect the concentration of miR-21 and miR-155 in the sample in a relatively short time, greatly improving the efficiency of quantitative detection of miR-21 and miR-155.

[0061] 7. The microfluidic chip platform has the advantages of small reagent usage, integration and automation, which greatly reduces the material and labor costs for quantitative early detection of breast cancer, provides a new technical platform for breast cancer detection, and has good prospects for clinical detection applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 Schematic diagram of the three-dimensional structure of the microfluidic chip of Example 1;

[0063] Figure 2 This is a design diagram of the cover plate channel mask size of Example 2;

[0064] Figure 3 The chemiluminescence intensity spectra and linear fitting result diagrams of miRNA at different concentrations in Example 4, wherein a is the detection chemiluminescence intensity spectra of miR-21 at different concentrations, b is the peak linear fitting result diagram of the detection chemiluminescence intensity spectra of miR-21 at different concentrations, c is the detection chemiluminescence intensity spectra of miR-155 at different concentrations, and d is the peak linear fitting result diagram of the detection chemiluminescence intensity spectra of miR-155 at different concentrations;

[0065] Among them, 1-substrate, 2-cover sheet, 201-exosome capture zone entrance, 202-capture zone Y-type microcolumn array, 203-exosome capture zone exit, 204-exosome detection zone entrance, 205-first detection zone Y-type microcolumn array, 206-second detection zone Y-type microcolumn array, 207-first detection zone exit, 208-second detection zone exit, 209-mixing channel exit, 210-mixing channel, 211-mixing channel inlet, 212-first fluid inlet, 213-second fluid inlet. DETAILED DESCRIPTION

[0066] In order to understand the present invention more clearly, the present invention is further described with reference to the following examples and accompanying drawings. The examples are only used for explanation and are not intended to limit the present invention in any way. In the examples, each raw material reagent is commercially available, and the experimental methods without specifying specific conditions are conventional methods and conventional conditions well known in the art, or according to the conditions recommended by the instrument manufacturer.

[0067] Example 1: Structure of microfluidic chip

[0068] This embodiment provides a microfluidic chip, whose three-dimensional structure is as follows Figure 1 and 2 shown.

[0069] The microfluidic chip is composed of a substrate 1 and a cover sheet 2 bonded together, and a mixing channel area, an exosome capture area and an exosome detection area are sequentially connected on the cover sheet 2. In this embodiment, the substrate material is glass, and the cover sheet material is polydimethylsiloxane (PDMS).

[0070] Among them, the exosome capture area includes an exosome capture area entrance 201, a capture area Y-shaped microcolumn array 202 and an exosome capture area exit 203 which are connected in sequence from left to right; the capture area Y-shaped microcolumn array 202 is modified with CD63 nucleic acid aptamers to capture exosomes, and the addition of a lysis reagent can lyse the exosomes to release the corresponding exosomal miRNA.

[0071] The exosome detection area includes an exosome detection area entrance 204 connected to the exosome capture area outlet 203; the exosome detection area entrance 204 has two branches, which are respectively connected to the first detection area Y-type micro-column array 205 and the second detection area Y-type micro-column array 206; the first detection area Y-type micro-column array 205 is provided with a first detection area outlet 207 on the right side, and the second detection area Y-type micro-column array 206 is provided with a second detection area outlet 208 on the right side; the first detection area Y-type micro-column array 205 and the second detection area Y-type micro-column array 206 are spaced apart from each other as detection micro-channels; the first detection area Y-type micro-column array 205 and the second detection area Y-type micro-column array 206 are both modified with H1 hairpin probes.

[0072] The mixing channel area includes a mixing channel outlet 209 connected to the first detection area outlet 207, and the right side of the mixing channel outlet 209 is connected to the mixing channel 210; a mixing channel inlet 211 is provided in the middle of the right side of the mixing channel 210; the mixing channel inlet 211 is connected to two inlets, namely the first fluid inlet 212 and the second fluid inlet 213, and the mixing channel 210 is serpentine.

[0073] The length of the channel in the exosome capture area is 3.3 mm and the width is 2.5 mm. The streamlined design with gradual expansion at the inlet and gradual contraction at the outlet avoids the formation of dead corners and allows the mixed reagents to be distributed more evenly after entering the boat-shaped detection microchannel.

[0074] The length of the boat-shaped exosome detection area is 3.3 mm and the width is 2.5 mm. The streamlined design with gradual expansion at the inlet and gradual contraction at the outlet avoids the creation of dead corners and allows the mixed reagents to be more evenly distributed after entering the boat-shaped detection microchannel.

[0075] The serpentine mixing channel 210 has a width of 200 μm and a length of 20 cm. Its narrow and long characteristics allow the chemiluminescent reagents to be fully mixed to a greater extent in terms of fluid mechanics, thereby quickly generating a higher chemiluminescent signal. Folding the mixing channel into a serpentine shape can save space.

[0076] The depth of the microcolumn in the exosome detection area is 50 μm, which can increase the inner surface area of ​​the boat-shaped microchannel in the detection area, provide more space for its inner surface modification, and improve the exosome capture efficiency to a greater extent in terms of fluid mechanics.

[0077] Example 2: Preparation of microfluidic chip

[0078] (1) The silicon wafer was ultrasonicated with ethanol for 5 minutes, then with deionized water for 5 minutes, and this was repeated three times. The wafer was heated on a hot plate for 120 minutes. A thin layer of SU-82050 negative photoresist was spin-coated on the silicon wafer. The rotation speed was controlled to make the thickness of the layer about 50 μm. Figure 2 The mask of the structure is attached to the silicon wafer, and ultraviolet light is passed through the photomask to expose the photoresist, and the unexposed part is dissolved with a developer. The raised SU-8 structure on the surface of the silicon wafer serves as the positive mold for the PDMS cover. The silicon positive mold is then silanized overnight.

[0079] (2) PDMS prepolymer (monomer / curing agent = 10 / 1 mixture) was poured on the silicon positive mold and vacuum degassed, then placed in a 75°C oven for curing for about 2 hours, and then the PDMS was peeled off from the positive mold to form a PDMS cover sheet. The PDMS cover sheet was cut and punched.

[0080] (3) Place the glass substrate and the PDMS cover sheet into an oxygen plasma vacuum tube, evacuate for 90 seconds, turn on the high-frequency power supply, take out the substrate and cover sheet after 90 seconds, and bond them immediately.

[0081] (4) After bonding, treat the channel with 4% (v / v) MPTS in anhydrous ethanol solution at room temperature and let it stand for 30 minutes. Then wash with anhydrous ethanol and repeat three times or until it is completely washed. After washing, place the chip in an oven at 100°C to dry for 1 hour.

[0082] (5) Treat the chip with a freshly prepared 0.01 μmol / mL GMBS solution in anhydrous ethanol at room temperature and leave it for 30 min. Wash it with anhydrous ethanol and repeat three times or until it is completely washed. After washing, place the chip in an oven at 100°C to dry for 1 h.

[0083] (6) Treat the channel with 10 μg / mL streptavidin in PBS at room temperature, let stand for 1 hour, wash with PBS, and repeat three times until completely washed. Then add 2 μM biotin-labeled CD63 nucleic acid aptamer and H1 hairpin probe, incubate for 30 minutes, and then wash with PBS solution. After modification, store the chip at 4°C for future use. Among them, the H1 hairpin probes are H1-21 and H1-155.

[0084] Example 3: Detection system based on microfluidic chip

[0085] The detection system based on the microfluidic chip includes the microfluidic chip in Example 1, a microinjection pump, a catheter, a syringe, a PMT detector and an ultra-weak chemiluminescence analyzer. The catheter is used to connect the syringe with the first fluid inlet 212, the syringe with the second fluid inlet 213, and the mixing channel outlet 209 with the first detection area outlet.

[0086] The detection system also includes a waste liquid pool, a conduit connecting the waste liquid pool with a first detection zone outlet 207 in the microfluidic chip, and a conduit connecting the waste liquid pool with a second detection zone outlet 208 in the microfluidic chip.

[0087] Example 4: Detection kit based on microfluidic chip

[0088] The detection kit based on microfluidic chip comprises the microfluidic chip in Example 1 and biotin-modified hairpin oligonucleotide H1, biotin-modified hairpin oligonucleotide H2, streptavidin-modified horseradish peroxidase, luminol and hydrogen peroxide.

[0089] Among them, the target miRNA, the hairpin structure oligonucleotide H1 and the hairpin structure oligonucleotide H2 meet the following conditions: the target miRNA and the hairpin structure oligonucleotide H1 have n complementary paired bases, the hairpin structure oligonucleotide H1 and the hairpin structure oligonucleotide H2 have m complementary paired bases, where 2n≤m; the hairpin structure oligonucleotide H1 can form a hairpin structure after annealing; the hairpin structure oligonucleotide H2 can form a hairpin structure after annealing.

[0090] The 3' end of the hairpin structure oligonucleotide H1 is modified with biotin, and the 3' end of the hairpin structure oligonucleotide H2 is modified with biotin.

[0091] Example 5: Detection method of exosomal miR-21 and miR-155

[0092] This example uses the detection system in Example 3 and the detection kit in Example 4 to detect breast cancer exosome miR-21 and miR-155, wherein the nucleotide sequences of the hairpin structure oligonucleotides H1-21, H1-155 and the hairpin structure oligonucleotides H2-21, H2-155 are as follows, and biotin is modified at the 3' end of H1 and H2:

[0093] H1-21 (nucleotide sequence is shown in SEQ ID NO.1):

[0094] CAGACTGATGTTGATAGCCTTCAACATCAGTCTGATAAGC;

[0095] H2-21 (nucleotide sequence is shown in SEQ ID NO.2):

[0096] AGGCTATCAACATCAGTCTGGCTTATCAGACTGATGTTGA;

[0097] H1-155 (nucleotide sequence is shown in SEQ ID NO.3):

[0098] CTAATTGTGATAGGGGTTGAAACACCCCTATCACAATTAGCATTAA;

[0099] H2-155 (nucleotide sequence is shown in SEQ ID NO.4):

[0100] GTTTCAACCCCTATCACAATTAGTTAATGCTAATTGTGATAGGGGT;

[0101] The specific steps are as follows:

[0102] (1) injecting the sample to be tested into the exosome capture zone of the microfluidic chip through the inlet 201 of the exosome capture zone, and letting it stand for 1.5 hours at a temperature of 37° C. After the exosomes in the sample to be tested are captured, the capture zone Y-shaped microcolumn array (202) is washed three times with a phosphate buffer solution;

[0103] (2) Injecting the exosome lysate into the exosome capture area of ​​the microfluidic chip through the inlet 201 of the exosome capture area, leaving it to stand for 15 minutes, sealing the outlet 203 of the exosome capture area with tape, cleaning the Y-shaped microcolumn array 202 of the capture area, transferring the obtained exosome miRNA into the exosome detection area, leaving it to stand for 0.5 hours at a temperature of 37° C., capturing miR-21 and miR-155 in the exosome miRNA, respectively, and cleaning the detection microchannel in the exosome detection area with a phosphate buffer solution;

[0104] (3) unblocking the sealed outlet 203 of the exosome capture zone, injecting the annealed biotin-modified hairpin oligonucleotide H1 and the annealed biotin-modified hairpin oligonucleotide H2 into the detection microchannel of step (2), causing a hybridization chain reaction, and standing for 1.5 hours at a temperature of 37° C., and washing the detection microchannel in the exosome detection zone three times with a phosphate buffer solution;

[0105] The annealing step is as follows: heating at 95°C for 10 minutes, and then cooling at 1°C per minute to 25°C to form a hairpin structure.

[0106] (4) Injecting the horseradish peroxidase modified with streptavidin into the exosome detection area through the inlet 204 of the exosome detection area, leaving it to stand for 0.5 h at a temperature of 37° C. The horseradish peroxidase is captured on the microcolumn array through the binding of streptavidin and biotin, and the detection microchannel in the exosome detection area is cleaned three times with a phosphate buffer solution;

[0107] (5) Turn on the ultra-weak chemiluminescence analyzer and analysis software, preheat for 30 minutes, and collect the background signal.

[0108] (6) The microfluidic chip is placed in a slot in a box with a PMT detector, and a PTFE catheter is used to connect the syringe to the first fluid inlet 212, the syringe to the second fluid inlet 213, and the mixing channel outlet 209 to the inlet of the detection area. Luminol and hydrogen peroxide are injected into the detection microchannel from the mixing channel through the first fluid inlet 212 and the second fluid inlet 213, respectively. 10 μL of luminol and 10 μL of hydrogen peroxide are perfused into the microfluidic chip at a flow rate of 8 μL / min through a precision micro-syringe, and a chemiluminescent reaction occurs under the catalysis of horseradish peroxidase.

[0109] (7) Collect the chemiluminescence spectrum within 300 seconds after the injection of the chemiluminescence reagent.

[0110] (8) According to the above steps (1)-(7), chemiluminescence spectra of miR-21 and miR-155 standard samples with concentrations of 1fM, 10fM, 100fM, 1pM, and 10pM, respectively, were collected.

[0111] (9) The standard curve was drawn with the logarithm of the concentration of the miR-21 and miR-155 standard samples as the horizontal axis and the peak value of their chemiluminescence spectra as the vertical axis, and the standard equation was obtained by linear fitting.

[0112] (10) According to the above steps (1)-(7), the chemiluminescence spectrum of the sample to be tested is collected, and the peak value of the chemiluminescence intensity spectrum is substituted into the linear fitting equation obtained in (9) to calculate the concentration of miR-21 and miR-155 in the sample to be tested.

[0113] Five different miRNA concentrations were tested: 1fM, 10fM, 100fM, 1pM, and 10pM. The test results are as follows: Figure 3 As shown, Figure 3 a is the chemiluminescence intensity spectrum of different concentrations of miR-21. Figure 3 b Peak linear fitting results of the chemiluminescence intensity spectra of different concentrations of miR-21. Figure 3 c is the chemiluminescence intensity spectrum of miR-155 at different concentrations. Figure 3 d is the peak linear fitting result of the chemiluminescence intensity spectrum of different concentrations of miR-155. It can be seen that with the increase of the concentration of the two target miRNAs, their CL intensity also increases. For miRNA-21 and miRNA-155, the standard curves are y=247797x+3921093 and y=241959x+3757277, respectively. According to the 3σ rule (LOD=3D / S, D is the standard deviation of the blank sample measurement value, S is the slope of the standard curve), the detection limit of the platform is calculated, and the detection limits of miR-155 and miR-21 are 0.49fM and 0.39fM, respectively.

[0114] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A microfluidic chip, characterized in that: It comprises a base sheet (1) and a cover sheet (2), wherein the cover sheet (2) is provided with a mixing channel area, an exosome capture area and an exosome detection area in sequence; The exosome capture zone comprises an exosome capture zone entrance (201), a capture zone Y-shaped microcolumn array (202) and an exosome capture zone exit (203) which are sequentially connected from left to right; The exosome detection zone comprises an exosome detection zone entrance (204) connected to the exosome capture zone exit (203); the exosome detection zone entrance (204) has two branches, which are respectively connected to the first detection zone Y-shaped micro-column array (205) and the second detection zone Y-shaped micro-column array (206); the first detection zone exit (207) is provided on the right side of the first detection zone Y-shaped micro-column array (205), and the second detection zone exit (208) is provided on the right side of the second detection zone Y-shaped micro-column array (206); The mixing channel area includes a mixing channel outlet (209) connected to the first detection area outlet (207), and the right side of the mixing channel outlet (209) is connected to the mixing channel (210); a mixing channel inlet (211) is provided in the middle part of the right side of the mixing channel (210); the mixing channel inlet (211) is connected to two inlets, namely a first fluid inlet (212) and a second fluid inlet (213).

2. A microfluidic chip as claimed in claim 1, characterized in that: The mixing channel (210) is serpentine; The intervals between the plurality of microcolumns in the first detection zone Y-shaped microcolumn array (205) and the second detection zone Y-shaped microcolumn array (206) form detection microchannels; The capture zone Y-shaped microcolumn array (202) is modified with CD63 nucleic acid aptamers; The first detection zone Y-shaped micro-column array (205) and the second detection zone Y-shaped micro-column array (206) are both modified with H1 hairpin probes; Preferably, the capture zone Y-shaped microcolumn array (202) is sealed with bovine serum albumin.

3. A detection system based on a microfluidic chip, characterized in that: It comprises the microfluidic chip as claimed in claim 1 or 2, a microinjection pump, a catheter, a syringe, a PMT detector, an ultraweak chemiluminescence analyzer and a waste liquid pool; The conduit is used to connect the syringe with the first fluid inlet (212) in the microfluidic chip, connect the syringe with the second fluid inlet (213) in the microfluidic chip, connect the waste liquid pool with the first detection zone outlet (207) in the microfluidic chip, and connect the waste liquid pool with the second detection zone outlet (208) in the microfluidic chip; The microinjection pump is connected to the first fluid inlet (212) and is used to control the flow rate and flow rate of the injected liquid; The PMT detector is located inside the ultra-weak chemiluminescence analyzer, and the light inlet of the PMT detector matches the detection microchannel for background signal collection; The ultra-weak chemiluminescence analyzer is used for collecting background signals and chemiluminescence spectra.

4. A detection kit based on a microfluidic chip, characterized in that: The method comprises the microfluidic chip as claimed in claim 3, a biotin-modified hairpin oligonucleotide H1, a biotin-modified hairpin oligonucleotide H2, a streptavidin-modified horseradish peroxidase polymerase, and a chemiluminescent reagent; The sample to be tested contains a priming strand I, the priming strand I and the hairpin structure oligonucleotide H1 have n complementary paired bases, and the hairpin structure oligonucleotide H1 and the hairpin structure oligonucleotide H2 have m complementary paired bases; 2n≤m, n and m are natural numbers that do not include 0; The hairpin structure oligonucleotide H1 can form a hairpin structure after annealing, and the hairpin structure oligonucleotide H2 can form a hairpin structure after annealing; Preferably, the hairpin structure oligonucleotide H1 and the hairpin structure oligonucleotide H2 are both modified with biotin at the 3' end; Preferably, the chemiluminescent reagent is luminol and / or hydrogen peroxide.

5. A microfluidic chip-based detection kit as claimed in claim 4, characterized in that: The nucleotide sequence of the hairpin structure oligonucleotide H1 is shown in SEQ ID NO.1 or SEQ ID NO.3; The nucleotide sequence of the hairpin structure oligonucleotide H2 is shown as SEQ ID NO.2 or SEQ ID NO.

4.

6. The method for using the detection kit according to claim 4 or 5, characterized in that: The following steps are involved: (1) injecting the sample to be tested into the exosome capture zone of the microfluidic chip through the inlet (201) of the exosome capture zone, allowing it to stand, and after the exosomes in the sample to be tested are captured, washing the Y-shaped microcolumn array (202) in the capture zone; (2) injecting the exosome lysate into the exosome capture zone of the microfluidic chip through the exosome capture zone inlet (201), allowing the chip to stand, sealing the exosome capture zone outlet (203), cleaning the capture zone Y-shaped microcolumn array (202), and allowing the obtained exosome miRNA to enter the exosome detection zone through the exosome detection zone inlet (204), allowing the chip to stand for a second time, and cleaning the detection microchannel in the exosome detection zone with a buffer solution; (3) unblocking the sealed exosome capture zone outlet (203), allowing the annealed biotin-modified hairpin oligonucleotide H1 and the annealed biotin-modified hairpin oligonucleotide H2 to enter the exosome capture zone through the exosome detection zone inlet (204), causing a hybridization chain reaction, allowing the mixture to stand, and using a buffer solution to clean the detection microchannel in the exosome detection zone; (4) injecting streptavidin-modified horseradish peroxidase into the exosome detection area through the inlet (204) of the exosome detection area, allowing it to stand, and using a buffer solution to clean the detection microchannel in the exosome detection area; (5) injecting a chemiluminescent reagent into the exosome detection zone through the first fluid inlet (212), and injecting a chemiluminescent reagent into the exosome detection zone through the second fluid inlet (213); (6) The background signal and chemiluminescence spectrum are collected by using a PMT detector and an ultra-weak chemiluminescence analyzer, and the expression level of exosomal miRNA in the sample to be tested is determined based on the chemiluminescence spectrum.

7. The method of use according to claim 6, characterized in that: In the step (6), the breast cancer exosome miRNA is miRNA-21 and breast cancer exosome miRNA-155.

8. The method of use according to claim 6, characterized in that: The standing time in step (1) is 1.5 to 2 hours, and the standing temperature is 25° C. to 37° C.; The second standing time in step (2) is 0.5-1h, and the standing temperature is 25°C to 37°C; The standing time in step (3) is 1 to 1.5 hours, and the standing temperature is 25° C. to 37° C.; The standing time in step (4) is 0.5-0.8h, and the standing temperature is 25°C to 37°C; The volume ratio of lumilol to hydrogen peroxide in step (5) is 1:1; The injection flow rates of lumilol and hydrogen peroxide in step (5) are both 5-10 μL / min; The ultraweak chemiluminescence analyzer described in step (6) is preheated for 15 to 30 minutes before use; The collection time in step (6) is within 300 seconds after the injection of luminol and hydrogen peroxide.

9. Use of the microfluidic chip according to claim 1 or 2, the detection system according to claim 3, or the detection kit according to claim 4 or 5 in the preparation of reagents or equipment for detecting and / or early diagnosis of diseases.

10. The use according to claim 9, characterized in that The disease is breast cancer.

Images