Base editor and construction method and application thereof

Abstract

The invention relates to the technical field of gene editing, in particular to a base editor as well as a construction method and application thereof, which are used for mutation of a specific base at a specific site in DNA (Deoxyribose Nucleic Acid) level. The ABE with higher editing specificity and low RNA / DNA off-target risk, the CBE with high editing precision and low RNA / DNA off-target risk and the ACBE tool with smaller volume are constructed by the method disclosed by the invention. The ABE tool developed in the invention has higher specificity when mediating A.T-G.C mutation, the capability of mediating C.G-T.A mutation of the ABE tool is obviously inhibited and even eliminated, and the off-target effect at RNA and DNA levels is obviously reduced and even eliminated; the CBE tool developed by the invention has higher accuracy when mediating C.G-T.A mutation, and the off-target effect of RNA (Ribonucleic Acid) and DNA (Deoxyribose Nucleic Acid) levels is obviously reduced or even eliminated; the ACBE tool developed in the invention only needs single deaminase, is smaller in volume, obviously reduces and even eliminates off-target effects at RNA and DNA levels, and has higher application value.

Description

[0001] This application is a divisional application. The application date of the parent application is October 21, 2021. The application number is 202111226226.X. The name of the invention is "Base editor and its construction method and application". Technical Field

[0002] The present invention relates to the field of gene editing technology, and in particular to a base editor and a method for constructing the same. Background Art

[0003] The new gene editing technology represented by CRISPR / Cas9 has brought changes to biomedical research. This technology makes efficient and accurate gene editing possible. Since 2016, researchers have developed a variety of DNA base editing tools that can efficiently induce precise point mutations at the DNA level, and no DNA double-strand breaks will occur in the process. There are many types of base editors that have been reported, of which the two most important are cytosine base editors (CBE, which can mediate C·G--T·A mutations) and adenine base editors (ABE, which can mediate A·T--G·C mutations). Among them, CBE is a fusion of a specific cytidine deaminase with a mutant nuclease (such as spCas9 carrying D10A or mutations, called nspCas9) and a uracil glycosylase inhibitor (UGI). The resulting fusion protein can mediate C·G--T·A mutations under the guidance of sgRNA. ABE fuses the directed-evolved Escherichia coli-derived adenosine deaminase (ecTadA*) dimer or monomer with a mutant nuclease (such as spCas9 carrying D10A or mutation, called nCas9). The resulting fusion protein can mediate A·T--G·C mutation under the guidance of sgRNA. Based on ABE and CBE, the researchers also fused a specific cytidine deaminase, a directed-evolved adenosine deaminase from Escherichia coli (ecTadA*), a mutant nuclease (such as spCas9 carrying D10A or mutation, called nCas9), and a uracil glycosylase inhibitor (UGI) to construct ACBE. The resulting fusion protein can mediate the simultaneous occurrence of C·G--T·A mutation and A·T--G·C mutation in specific sites under the guidance of sgRNA (Nat Biotechnol, 2020.38(7):861-864; BMC Biol, 2020.18(1):131; Nat Biotechnol, 2020.38(7):856-860; Nat Biotechnol, 2020.38(7):865-869). Existing ABE, CBE and ACBE tools still have shortcomings, which limits their application prospects.

[0004] In addition to A·T--G·C mutations, existing ABE tools can also mediate C·G--T·A mutations to a certain extent, which reduces the specificity and accuracy of ABE editing and is not conducive to the application of ABE (Nat Biotechnol, 2021 (https: / / doi.org / 10.1038 / s41587-021-00943-2); Nat Biotechnol, 2019.37(10):1145-1148; Nat Commun, 2020.11(1):5827). Although some researchers have constructed CBE tools that can specifically mediate TC-TT mutations through point mutations based on the characteristics of ABE tools that can mediate C·G--T·A mutations, their activity is very low and their application scenarios are limited (Nat Biotechnol, 2021, https: / / doi.org / 10.1038 / s41587-021-00943-2). In addition, the deaminases currently suitable for ABE construction are all derived from the directed evolution of Escherichia coli-derived adenosine deaminase (ecTadA*), and the types of deaminases are very limited, which also limits the diversity of ABE base editing characteristics and is not conducive to the application and promotion of tools. In addition, there is currently a lack of ABE tools that can coordinately optimize multiple aspects such as RNA / DNA off-target effects and editing accuracy.

[0005] The deaminases in existing CBE tools all belong to the cytidine deaminase family. This type of tool currently has a series of problems in base editing accuracy (activity window specificity), RNA off-target effects, and DNA off-target effects. There is still a lack of CBE tools that can synergistically optimize multiple aspects such as RNA / DNA off-target effects and editing accuracy (Nat Biotechnol, 2020. 38(5): 620-628; Nat Commun, 2020. 11(1): 2052; Nat Methods, 2020. 17(6): 600-604).

[0006] Existing ACBE tools require the simultaneous fusion of two deaminases (cytidine deaminase and directed-evolved adenosine deaminase from Escherichia coli (ecTadA*)) on nCas9, which makes the ACBE tool too large and not conducive to application (Nat Biotechnol, 2020.38(7):861-864; BMC Biol, 2020.18(1):131; Nat Biotechnol, 2020.38(7):856-860; Nat Biotechnol, 2020.38(7):865-869). Summary of the invention

[0007] In order to optimize the deficiencies of base editors ABE, CBE and ACBE, and to develop ABE with higher editing specificity and low RNA / DNA off-target risk, CBE with high editing accuracy and low RNA / DNA off-target risk, and smaller ACBE tools, the purpose of the present invention is to provide a new base editor and a construction method and application thereof, which are used for mutation of specific bases at specific sites at the DNA level.

[0008] It can achieve the conversion of C·G base pairs to T·A base pairs at specific sites on the DNA level (C·G--T·A mutation, CBE), the mutation of A·T base pairs to G·C base pairs (A·T--G·C mutation, ABE), or simultaneously achieve the conversion of C·G base pairs to T·A base pairs and A·T base pairs to G·C base pairs at specific sites (C·G--T·A and A·T--G·C simultaneous mutation, ACBE).

[0009] The present invention provides a new method for constructing an adenine base editor (ABE), a cytosine base editor (CBE) and an ACBE, so as to develop an ABE with higher editing specificity and lower RNA / DNA off-target risk, a CBE with higher editing accuracy and lower RNA / DNA off-target risk, and an ACBE tool with smaller size.

[0010] The basic principle of the present invention is to perform saturation mutation screening on key amino acid sites of adenosine deaminase (TadA-8e) from Escherichia coli after directed evolution (Nat Biotechnol, 2020.38(7):883-891). Finally, through specific point mutations or point mutation combinations, the construction of ABE, CBE and ACBE and the conversion between various base editors are realized; or mutations and systematic screening are performed on various adenosine deaminase (TadA) in nature to find new functional TadA and construct diversified ABE, CBE and ACBE.

[0011] After directed protein evolution, adenosine deaminase (ecTadA) from Escherichia coli (called ecTadA* after evolution) has the ability to deaminate adenine (A) in single-stranded DNA and achieve A·T--G·C mutation. The base editor ABE constructed on this basis can achieve A·T--G·C mutation in the target site of the genome. The researchers also found that under certain conditions, ABE can deaminate cytosine (C) in single-stranded DNA, and to a certain extent can also mediate C·G--T·A mutation, and has certain CBE functions. This ability to mediate C·G--T·A mutations increases the off-target risk of ABE tools (Nat Biotechnol, 2019.37(10):1145-1148; Nat Commun, 2020.11(1):5827). Therefore, saturation mutation screening of specific sites of adenosine deaminase (TadA) or point mutation and systematic screening of naturally occurring adenosine deaminase (TadA) can construct new ABEs, CBEs, and ACBEs. Specific point mutations or combinations of point mutations can achieve the following goals:

[0012] (1) Reduce or eliminate the ability of ABE tools to mediate C·G--T·A mutations, improve RNA off-target effects and DNA off-target effects, and enhance their safety;

[0013] (2) Convert ABE to CBE to obtain new CBE tools, which have new features different from existing tools in terms of base editing accuracy (activity window specificity), RNA off-target effects, and DNA off-target effects;

[0014] (3) Convert ABE into ACBE and construct a new type of ACBE using a single deaminase to reduce the size of ACBE and improve its base editing accuracy (activity window specificity), RNA off-target effect, and DNA off-target effect.

[0015] After systematic research and saturation screening, the inventors discovered for the first time that one or more mutations in the amino acids at positions 28, 30, 46, 48, 49, 82, 84, 108, 110 or 111 in the deaminase TadA-8e have a significant effect on the deamination activity and base preference of TadA-8e. Different types of point mutations, or a combination of multiple point mutations, can significantly change the properties of the ABE tool based on TadA-8e. Through different point mutations at specific amino acid sites, or a combination of point mutations at multiple amino acid sites, ABE with higher editing specificity, CBE with high editing accuracy and low RNA / DNA off-target risk, and ACBE tools with smaller size are finally obtained, and the present invention is finally completed.

[0016] The purpose of the present invention can be achieved by the following technical solutions:

[0017] The first object of the present invention is to provide a base editor, which is a fusion protein formed by fusing a mutant TadA-8e to the N-terminus, C-terminus or internal fusion site of a Cas nuclease;

[0018] The mutant TadA-8e refers to a deaminase in which one or more amino acids are mutated less than 5 angstroms from the adenine (A) analogue 8-azanebularine (8Az) in TadA-8e, and in particular refers to a deaminase in which one or more amino acids are mutated at the amino acid position 108 in TadA-8e;

[0019] The amino acid sequence of TadA-8e is shown in SEQ ID NO.1.

[0020] In one embodiment of the present invention, the Cas nuclease is selected from the Cas9, Cas12, and Cas13 protein families; preferably, the Cas nuclease is selected from nSpCas9 and its mutants, SaCas9 and its mutants, Cas12a and its mutants, or Cas12f and its mutants, preferably nSpCas9.

[0021] In one embodiment of the present invention, the mutant TadA-8e refers to a deaminase obtained after an amino acid at the amino acid position 108 in TadA-8e is mutated to one of the other 19 amino acids different from the original amino acid at the position;

[0022] Preferably, the mutant TadA-8e refers to a deaminase obtained by performing the following single-point mutations on amino acids in TadA-8e: V28WN108H, N108M, N108C, N108D, N108F, N108Q, N108S, N108Y, N108V, N108I, N108L, N108A, N108T, N108R.

[0023] In the above-mentioned expressions similar to “V28W”, 28 indicates the 28th amino acid site in TadA-8e, V indicates the amino acid before the 28th amino acid site in TadA-8e is mutated, and W indicates the amino acid after the 28th amino acid site in TadA-8e is mutated. V and W are abbreviations of amino acids, i.e., V28W indicates that the 28th amino acid site is mutated from valine to tryptophan; other expressions similar to “V28W” above or below are interpreted similarly, i.e., N46L indicates that the 46th amino acid site is mutated from asparagine to leucine.

[0024] The base editor obtained by the above single point mutation mediates C·G--T·A mutation.

[0025] In one embodiment of the present invention, the mutant TadA-8e refers to a deaminase obtained by performing the following double-point mutations on the amino acids in TadA-8e:

[0026] (1) a deaminase in which the amino acids at positions 48 and 108 are simultaneously mutated, or

[0027] (2) a deaminase in which the amino acid at position 49 is mutated and the amino acid at position 108 is mutated, or

[0028] (3) A deaminase in which the amino acid at the amino acid position 108 is mutated and at the amino acid position 82 or 84 is mutated.

[0029] Preferably, the mutant TadA-8e refers to a deaminase obtained by performing the following double-point mutations on the amino acids in TadA-8e:

[0030] V28G-N108Y, V28G-N108C, V28G-N108H, V28G-N46C, N46P-N108Y, N46P-N108S, N46P-N108Q, N46P-N108D, N46P-N 108C, N46P-N108H, N46C-N108Y, N46C-N108S, N46C-N108Q, N46C-N108M, N46C-N108C, N46C-N108H, N46L-N108Y, N46L-N108Q, N46L-N108D, N46L-N108M, N46L-N108H, I49A-N108Y, V28W-N108H, N46P-N108M, A48G-N108H, I49A- N108H, I49G-N108H, I49G-N108Y, V82G-N108Y, V82T-N108H, V82T-N108C, F84M-N108H, F84M-N108M, F84M-N108Q.

[0031] The V28G-N46C indicates that the 28th amino acid site is mutated from valine to glycine and the 46th amino acid site is changed from asparagine to cysteine. Other similar expressions above or below shall be interpreted similarly.

[0032] The base editor obtained by the above double point mutation mediates C·G--T·A mutation.

[0033] In one embodiment of the present invention, the mutant TadA-8e refers to a deaminase obtained by performing the following three point mutations on the amino acids in TadA-8e:

[0034] (1) a deaminase in which the amino acids at positions 28, 48 and 108 are simultaneously mutated, or

[0035] (2) a deaminase in which the amino acids at positions 28, 49 and 108 are simultaneously mutated, or

[0036] (3) deaminase with simultaneous mutations in amino acids at positions 49, 82, and 108;

[0037] Preferably, the mutant TadA-8e refers to a deaminase obtained by performing the following three point mutations on the amino acids in TadA-8e:

[0038] I49A-V82T-N108Y, I49A-V82G1-N108Y, I49G-V82T-N108Y, I49G-V82G-N108Y, A48 G-V82G-N108Y, A48G-I49G-N108Y, V28G-V82G-N108Y, V28G-V82G-N108H, V28G-I4 9A-N108Y, V28G-I49A-N108H, V28G-I49G-N108H, V28G-A48G-N108Y, V28G-A48G-N 108H, V28G-A48G-I49G, V28G-I49G-N108Y, I49G-V82G-N108H, I49G-V82T-N108H.

[0039] The V28G-A48G-I49G indicates that the 28th amino acid site mutates from valine to glycine, the 48th amino acid site mutates from alanine to glycine, and the 49th amino acid site mutates from isoleucine to glycine. Other similar expressions above or below shall be interpreted similarly.

[0040] The base editor obtained by the above three-point mutation mediates C·G--T·A mutation.

[0041] In one embodiment of the present invention, the mutant TadA-8e refers to a deaminase in which the amino acid at amino acid position 108 of TadA-8e is mutated and three other sites at amino acid positions 28, 48, 49, and 82 of TadA-8e are mutated;

[0042] Preferably, the mutant TadA-8e refers to a deaminase in which the amino acid position 108 of TadA-8e is mutated to N108Y or N108H, and three other positions of the amino acid positions 28, 48, 49, and 82 of TadA-8e are mutated as follows:

[0043] The amino acid position 28 in TadA-8e was mutated to V28G,

[0044] The amino acid position 48 in TadA-8e was mutated to A48G.

[0045] The amino acid position 49 in TadA-8e was mutated to I49A or I49G.

[0046] The amino acid position 82 in TadA-8e was mutated to V82T or V82G.

[0047] The V28G-I49G-V82T-N108Y indicates that the 28th amino acid mutates from valine to glycine, the 49th amino acid mutates from isoleucine to glycine, the 82nd amino acid mutates from valine to threonine, and the 108th amino acid mutates from asparagine to tyrosine. Other similar expressions above or below shall be interpreted similarly.

[0048] The base editor obtained by the above four-point mutation mediates C·G--T·A mutation.

[0049] In one embodiment of the present invention, the mutant TadA-8e refers to a deaminase in which the amino acids at positions 28, 48, 49, 82, and 108 of TadA-8e are simultaneously mutated;

[0050] Preferably, the mutant TadA-8e refers to a deaminase obtained by subjecting the amino acids in TadA-8e to the following five mutations:

[0051] While the amino acid position 108 in TadA-8e is mutated to N108Y or N108H, the amino acid positions 28, 48, 49, and 82 in TadA-8e are also mutated to the following deaminase;

[0052] The amino acid position 28 in TadA-8e was mutated to V28G,

[0053] The amino acid position 48 in TadA-8e was mutated to A48G.

[0054] The amino acid position 49 in TadA-8e was mutated to I49A or I49G.

[0055] The amino acid position 82 in TadA-8e was mutated to V82T or V82G.

[0056] The V28G-A48G-I49G-V82T-N108H means that the 28th amino acid mutates from valine to glycine, the 48th amino acid mutates from alanine to glycine, the 49th amino acid mutates from isoleucine to glycine, the 82nd amino acid mutates from valine to threonine, and the 108th amino acid mutates from asparagine to histidine. Other similar expressions above or below shall be interpreted similarly.

[0057] The base editor obtained by the above five-point mutation mediates C·G--T·A mutation.

[0058] In one embodiment of the present invention, various variants with different sequences are added to the 5' and 3' of the mutant TadA-8e and then placed at the N-terminus, C-terminus or internal fusion site of the Cas nuclease to form a fusion protein;

[0059] Preferably, after adding NLS sequence and linker sequence to 5' and 3' of mutant TadA-8e, respectively, NLS-mutant TadA-8e-linker is obtained, and NLS-mutant TadA-8e-linker is placed at the N-terminus, C-terminus or internal fusion site of Cas nuclease to form a fusion protein;

[0060] Wherein, NLS-mutant TadA-8e-linker means that one or more amino acids in TadA-8e are mutated relative to NLS-TadA-8e-linker, the amino acid sequence of NLS-TadA-8e-linker is shown in SEQ ID NO.4, and the amino acid sequence of NLS-mutant TadA-8e-linker is the amino acid sequence obtained by replacing TadA-8e with mutant TadA-8e in the amino acid sequence of NLS-TadA-8e-linker. The NLS sequence is PKKKRKV, and the linker sequence is SGGSSGGSSGSETPGTSESATPESSGGSSGGSSR.

[0061] In one embodiment of the present invention, when the Cas nuclease is selected as nSpCas9, the fusion sites inside the nSpCas9 include fusion sites 113, 203, 312, 459, 535, 583, 687, 701, 715, 730, 770, 793, 801, 895, 905, 919, 946, 1010, 1029, 1047, 1117, 1154, 1249, and 1282;

[0062] The preferred fusion site is position 1249.

[0063] A second object of the present invention is to provide a method for constructing a base editor, comprising the following steps:

[0064] The base editor was constructed by fusing TadA-8e, mutant TadA-8e and Cas nuclease at different sites;

[0065] The amino acid sequence of TadA-8e is shown in SEQ ID NO.1;

[0066] The mutant TadA-8e refers to a deaminase in which the amino acid at the amino acid position 108 in TadA-8e is mutated;

[0067] In one embodiment of the present invention, NLS sequence and linker sequence may be added to the 5' and 3' ends of TadA-8e, mutant TadA-8e or mutant TadA-X, respectively.

[0068] The third object of the present invention is to provide an application of a base editor ABE, wherein the base editor ABE mediates A·T--G·C mutation;

[0069] Base editor ABE refers to a fusion protein formed by mutating the 106th and 108th homologous amino acids of ecTadA to valine and asparagine, respectively, and then fused to the N-terminus and 1249th fusion site of nSpCas9;

[0070] Base editor ABE also refers to a fusion protein formed by the following single point mutation or combination of point mutations in amino acids in TadA-8e, in which the deaminase is placed at the N-terminus of nSpCas9 and the 1249th fusion site. This type of fusion protein only has the obvious ability to mediate A·T--G·C mutations.

[0071] The fourth object of the present invention is to provide an application of a base editor CBE, wherein the base editor CBE mediates C·G--T·A mutation;

[0072] Base editor CBE refers to a fusion protein formed by fusion of the following amino acid mutations in TadA-8e with the deaminase placed at the N-terminus of nSpCas9 and the 1249th fusion site:

[0073] Double point mutations: V28G-N108Y, V28G-N108C, V28G-N108H, N46P-N108Y, N46P-N108S, N46P-N108Q, N46P-N108D, N46P-N108C, N46P-N108H, N46C-N108Y, N46C-N108S, N46C-N108Q, N46C-N108M, N46C-N108C, N46C-N108H, N46L-N108Y, N46L-N108Q, N46L-N108D, N46L-N108M, N46L-N108H, I49A-N108Y

[0074] Three point mutations: I49A-V82T-N108Y, I49G-V82T-N108Y, I49G-V82G-N108Y, A48G-V82G-N108Y, A48G-I49G-N108Y, V28G-V82G-N108Y, V28G-V82G-N108H, V28G-I49A-N108Y, V28G-I49A-N108H, V28G-I49G-N108H, V28G-A48G-N108Y, V28G-A48G-N108H;

[0075] Four point mutations: V28G-A48G-I49A-N108Y, V28G-A48G-I49G-N108Y, V28G-A48G-V82T-N108Y, V28G-A48G-V82G-N108Y, V28G-I49A-V82T-N108Y, V28G-I49A-V82G-N1 08Y, V28G-I49G-V82T-N108Y, V28G-I49G-V82G-N108Y, A48G-I49A-V82T-N1 08Y, A48G-I49A-V82G-N108Y, A48G-I49G-V82T-N108Y, A48G-I49G-V82G-N10 8Y, V28G-A48G-I49A-N108H, V28G-A48G-I49G-N108H, V28G-A48G-V82T-N10 8H, V28G-A48G-V82G-N108H, V28G-I49A-V82T-N108H, V28G-I49A-V82G-N108 H. V28G-I49G-V82T-N108H, V28G-I49G-V82G-N108H, A48G-I49A-V82T-N108H , A48G-I49A-V82G-N108H, A48G-I49G-V82T-N108H, A48G-I49G-V82G-N108H.

[0076] Five point mutations: V28G-A48G-I49A-V82T-N108Y, V28G-A48G-I49 G-V82T-N108Y, V28G-A48G-I49A-V82G-N108Y, V28G-A48G-I49G-V82G-N108Y, V28G-A48G-I49G-V82G-N108Y, V28G-A48G-I49A-V82T-N108H, V28G-A48G-I49G-V82T-N108H, V28G-A48G-I49A-V82G-N108H, V28G-A48G-I49G-V82G-N108H.

[0077] The fifth object of the present invention is to provide an application of a base editor ACBE, wherein the base editor ACBE mediates A·T--G·C and C·G--T·A mutations;

[0078] Base editor ACBE refers to a fusion protein formed by fusion of the deaminase obtained by point mutation or combination of point mutations in amino acids in TadA-8e to the N-terminus and the 1249th fusion site of nSpCas9. This type of fusion protein has the ability to mediate A·T--G·C and C·G--T·A mutations.

[0079] In a sixth aspect, the present invention provides a mutant TadA-8e protein, wherein the mutant protein is a non-natural protein, and the mutant TadA-8e protein refers to a deaminase in which one or more amino acids at the amino acid position 108 in TadA-8e are mutated;

[0080] Preferably, the mutant TadA-8e refers to a deaminase obtained by performing the following single-point mutation on the amino acid in TadA-8e:

[0081] N108H, N108M, N108C, N108D, N108F, N108Q, N108S, N108Y, N108V, N108I, N108L, N108A, N108T, N108R;

[0082] Alternatively, the mutant TadA-8e refers to a deaminase obtained by performing the following double-point mutations on the amino acids in TadA-8e:

[0083] V28G-N108Y, V28G-N108C, V28G-N108H, N46P-N108Y, N46P-N108S, N46P-N108Q, N46P-N108D, N46P-N108C, N46P-N108H, N 46P-F84M, N46P-I49A, N46P-I49G, N46P-A48G, N46C-N108Y, N46C-N108S, N46C-N108Q, N46C-N108M, N46C-N108C, N46C-N1 08H, N46L-N108Y, N46L-N108Q, N46L-N108D, N46L-N108M, N46L-N108H, I49A-N108Y, V28W-N108H, N46P-N108M, A48G-N108 H, I49A-N108H, I49G-N108H, I49G-N108Y, V82G-N108Y, V82T-N108H, V82T-N108C, F84M-N108H, F84M-N108M, F84M-N108Q;

[0084] Alternatively, the mutant TadA-8e refers to a deaminase obtained by performing the following three point mutations on the amino acids in TadA-8e:

[0085] I49A-V82T-N108Y, I49G-V82T-N108Y, I49G-V82G-N108Y, A48G-V82G-N1 08Y, A48G-I49G-N108Y, V28G-V82G-N108Y, V28G-V82G-N108H, V28G-I49 A-N108Y, V28G-I49A-N108H, V28G-I49G-N108H, V28G-A48G-N108Y, V28G -A48G-N108H, V28G-I49G-N108Y, I49G-V82G-N108H, I49G-V82T-N108H;

[0086] Or, the mutant TadA-8e refers to a deaminase obtained by performing the following four mutations on the amino acids in TadA-8e: V28G-A48G-I49A-N108Y, V28G-A48G-I49G-N108Y, V28G-A48G-V82T-N108Y, V28G-A48G-V82G-N108Y, V28G-I49A -V82T-N108Y, V28G-I49A-V82G-N108Y, V28G-I49G-V82T-N108Y, V28G-I49G-V82G -N108Y, A48G-I49A-V82T-N108Y, A48G-I49A-V82G-N108Y, A48G-I49G-V82T-N108Y , A48G-I49G-V82G-N108Y, V28G-A48G-I49A-N108H, V28G-A48G-I49G-N108H, V28G -A48G-V82T-N108H, V28G-A48G-V82G-N108H, V28G-I49A-V82T-N108H, V28G-I49A- V82G-N108H, V28G-I49G-V82T-N108H, V28G-I49G-V82G-N108H, A48G-I49A-V82T- N108H, A48G-I49A-V82G-N108H, A48G-I49G-V82T-N108H, A48G-I49G-V82G-N108H;

[0087] Or, the mutant TadA-8e refers to the deaminase obtained after the following five-point mutations in amino acids in TadA-8e: V28G-A48G-I49A-V82T-N108Y, V28G-A48G-I49 G-V82T-N108Y, V28G-A48G-I49A-V82G-N108Y, V28G-A48G-I49G-V82G-N108Y, V28G-A48G-I49G-V82G-N108Y, V28G-A48G-I49A-V82T-N108H, V28G-A48G-I49G-V82T-N108H, V28G-A48G-I49A-V82G-N108H, V28G-A48G-I49G-V82G-N108H.

[0088] In a seventh aspect, the present invention provides an adenine deaminase TadA mutant protein, wherein the adenine deaminase TadA mutant protein is a non-natural protein, and the adenine deaminase TadA mutant protein refers to a deaminase in which the amino acids 106 and 108 homologous to ecTadA in TadA-X are mutated to valine and asparagine, respectively;

[0089] Furthermore, the mutant TadA-8e protein or the adenine deaminase TadA mutant protein is a monomer or a dimer.

[0090] In an eighth aspect, the present invention provides a polynucleotide encoding the fusion protein in the base editor.

[0091] Or, a polynucleotide encoding the mutant TadA-8e protein.

[0092] The ninth aspect of the present invention provides a vector containing the polynucleotide.

[0093] In the tenth aspect of the present invention, a host cell is provided, comprising the base editor, or the mutant TadA-8e protein or the adenine deaminase TadA mutant protein, or the vector.

[0094] In the eleventh aspect of the present invention, a kit is provided, comprising reagents for constructing the base editor.

[0095] Compared with the prior art, the present invention has the following beneficial effects:

[0096] (1) The ABE tool developed in the present invention has higher specificity in mediating A·T--G·C mutation, and its ability to mediate C·G--T·A mutation is significantly inhibited or even eliminated.

[0097] (2) The CBE tool developed in the present invention has higher accuracy in mediating C·G--T·A mutation, and the off-target effects at the RNA and DNA levels are significantly reduced or even eliminated.

[0098] (3) The ACBE tool developed in the present invention only requires a single deaminase, which is smaller in size and has significantly reduced or even eliminated off-target effects at the RNA and DNA levels, thus having higher application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0099] Figure 1 Schematic diagram of the editing efficiency of various base editors ABEs for base A (A·T--G·C mutation) and C (C·G--T·A mutation rate) at the sgRNA-S1 site when TadA-8e is fused to different positions of the nSpCas9 protein (including N-, C-, and internal fusion sites).

[0100] Figure 2Schematic diagram of the editing efficiency of various base editors ABEs for base A (A·T--G·C mutation) and C (C·G--T·A mutation rate) at the sgRNA-S1 site when NLS-TadA-8e-linker is fused to different positions of the nSpCas9 protein (including N-, C-, and internal fusion sites).

[0101] Figure 3 a is a schematic diagram of the editing efficiency (C·G--T·A mutation rate) of 1249-NLS-TadA-8e-linker and 1249-TadA-8e for the fourth base C (C4) and the sixth base C (C6) at the sgRNA-S1 site.

[0102] Figure 3 b is a schematic diagram of the spatial positions of V28, V30, N46, A48, I49, V82, F84, N108, K110, and R111 in the TadA-8e structure (PDB: 6VPC); the amino acid residues marked in the figure are located in the active pocket of TadA-8e.

[0103] Figure 3 c is a single point mutation that enhances the C·G--T·A mutation ability and preference for cytosine (C) mediated by 1249-NLS-TadA-8e-linker. The bar graphs from left to right are the cytosine (C) preference of the 1249-NLS-TadA-8e-linker mutant (cytosine (C) preference = C·G--T·A mutation rate / A·T--G·C mutation rate), the relative editing activity of cytosine (C) (cytosine (C) relative editing activity = C·G--T·A mutation rate of mutant / non-mutant 1249-NLS-TadA-8e-linker) and the relative editing activity of adenine (A) (adenine (A) relative editing activity = A·T--G·C mutation rate of mutant / non-mutant 1249-NLS-TadA-8e-linker).

[0104] Figure 4 Schematic diagram of the change in the ability of TadA-8e in 1249-NLS-TadA-8e-linker to mediate A·T--G·C mutation and C·G--T·A mutation at the sgRNA-S1 site after saturation mutation of V28 (A) and V30 (B);

[0105] The point mutations marked by the dark boxes in the figure can significantly enhance the C·G--T·A mutation ability and preference for cytosine (C) of 1249-NLS-TadA-8e-linker.

[0106] Figure 5Schematic diagram of the change in the ability of TadA-8e in 1249-NLS-TadA-8e-linker to mediate A·T--G·C mutation and C·G--T·A mutation at the sgRNA-S1 site after saturation mutation at N46 (A) and A48 (B);

[0107] The point mutations marked by the dark boxes in the figure can significantly enhance the C·G--T·A mutation ability and preference for cytosine (C) of 1249-NLS-TadA-8e-linker.

[0108] Figure 6 Schematic diagram of the change in the ability of TadA-8e in 1249-NLS-TadA-8e-linker to mediate A·T--G·C mutation and C·G--T·A mutation at the sgRNA-S1 site after saturation mutation at I49 (A) and V82 (B);

[0109] The point mutations marked by the dark boxes in the figure can significantly enhance the C·G--T·A mutation ability and preference for cytosine (C) of 1249-NLS-TadA-8e-linker.

[0110] Figure 7 Schematic diagram of the change in the ability of TadA-8e in 1249-NLS-TadA-8e-linker to mediate A·T--G·C mutation and C·G--T·A mutation at the sgRNA-S1 site after saturation mutation of F84 (A) and N108 (B);

[0111] The point mutations marked by the dark boxes in the figure can significantly enhance the C·G--T·A mutation ability and preference for cytosine (C) of 1249-NLS-TadA-8e-linker.

[0112] Figure 8 Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability of TadA-8e at the sgRNA-S1 site after saturation mutation of K110 (A) and R111 (B) in 1249-NLS-TadA-8e-linker.

[0113] Fig. 9 Schematic diagram of the editing efficiency (heat map) of bases A (A·T--G·C mutation) and C (C·G--T·A mutation rate) at the sgRNA-S1 site after saturation mutation of TadA-8e at the N108 site in 1249-NLS-TadA-8e-linker.

[0114] Fig.10Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability at the sgRNA-S1 site after the introduction of double point mutations V28G-X (a) and V28W-X (b) in TadA-8e in 1249-NLS-TadA-8e-linker; the V28G-X indicates that in addition to the mutation of the 28th amino acid from valine to glycine, there are mutations X at other amino acid sites.

[0115] The point mutation 1249-NLS-TadA-8e-linker marked by the dark box in the figure has almost no A·T--G·C mutation ability, but its C·G--T·A mutation ability is still not weaker than the wild-type 1249-NLS-TadA-8e-linker.

[0116] Fig.11 Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability at the sgRNA-S1 site after the introduction of double point mutations N46P-X (a), N46C-X (b) and N46L-X (c) into TadA-8e in 1249-NLS-TadA-8e-linker;

[0117] The point mutation 1249-NLS-TadA-8e-linker marked by the dark box in the figure has almost no A·T--G·C mutation ability, but its C·G--T·A mutation ability is still not weaker than the wild-type 1249-NLS-TadA-8e-linker.

[0118] Fig.12 Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability at the sgRNA-S1 site after the introduction of double point mutations A48G-X (a), I49G-X (b) and I49A-X (c) into TadA-8e in 1249-NLS-TadA-8e-linker;

[0119] The point mutation 1249-NLS-TadA-8e-linker marked by the dark box in the figure has almost no A·T--G·C mutation ability, but its C·G--T·A mutation ability is still not weaker than the wild-type 1249-NLS-TadA-8e-linker.

[0120] Fig.13 Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability at the sgRNA-S1 site after the introduction of V82G-X (a), V82T-X (b) and F84M / YX (c) double point mutations into TadA-8e in 1249-NLS-TadA-8e-linker;

[0121] The point mutation 1249-NLS-TadA-8e-linker marked by the dark box in the figure has almost no A·T--G·C mutation ability, but its C·G--T·A mutation ability is still not weaker than the wild-type 1249-NLS-TadA-8e-linker.

[0122] Fig.14 Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability at the sgRNA-S1 site after the introduction of N108Y-X (a), N108H-X (b) and N108M / C / D / Q / SX (C) double point mutations into TadA-8e in 1249-NLS-TadA-8e-linker;

[0123] The point mutation 1249-NLS-TadA-8e-linker marked by the dark box in the figure has almost no A·T--G·C mutation ability, but its C·G--T·A mutation ability is still not weaker than the wild-type 1249-NLS-TadA-8e-linker.

[0124] Fig.15 Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability at the sgRNA-S1 site after the introduction of double point mutations N108M-X (a), N108C-X (b), N108D-X (c), N108S-X (d) and N108Q-X (e) into TadA-8e in 1249-NLS-TadA-8e-linker;

[0125] The point mutation 1249-NLS-TadA-8e-linker marked by the dark box in the figure has almost no A·T--G·C mutation ability, but its C·G--T·A mutation ability is still not weaker than the wild-type 1249-NLS-TadA-8e-linker.

[0126] Fig.16 A summary of double-point mutations that can further enhance the editing ability and preference of 1249-NLS-TadA-8e-linker for cytosine (C) compared to single-point mutations.

[0127] Fig.17Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability at the sgRNA-S1 site after introducing various three-point mutations into TadA-8e in 1249-NLS-TadA-8e-linker. The point mutation type 1249-NLS-TadA-8e-linker marked by the dark box has a significantly reduced A·T--G·C mutation ability, but its C·G--T·A mutation ability is still not weaker than that of the wild-type 1249-NLS-TadA-8e-linker.

[0128] Fig.18 Schematic diagram of the change in the ability of A·T--G·C mutation and C·G--T·A mutation at the sgRNA-S1 site after the introduction of three point mutations V28G-XY (A) and A48G-XY (B) into TadA-8e in 1249-NLS-TadA-8e-linker; V28G-XY indicates that on the basis of the mutation of amino acid valine to glycine at position 28, there are mutations X and Y at the other two amino acid sites;

[0129] The point mutations indicated by red arrows in the figure can significantly enhance the C·G--T·A mutation ability of 1249-NLS-TadA-8e-linker, among which the dark red arrows are preferred point mutations. X and Y indicate amino acid mutations at other sites.

[0130] Fig.19 Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability at the sgRNA-S1 site after the introduction of the three-point mutations I49A-XY (A) and I49G-XY (B) into TadA-8e in 1249-NLS-TadA-8e-linker;

[0131] The point mutations indicated by red arrows in the figure can significantly enhance the C·G--T·A mutation ability of 1249-NLS-TadA-8e-linker, among which the dark red arrows are preferred point mutations. X and Y indicate amino acid mutations at other sites.

[0132] Fig. 20 Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability at the sgRNA-S1 site after the introduction of the three-point mutations V82G-XY (A) and V82T-XY (B) into TadA-8e in 1249-NLS-TadA-8e-linker;

[0133] The point mutations indicated by red arrows in the figure can significantly enhance the C·G--T·A mutation ability of 1249-NLS-TadA-8e-linker, among which the dark red arrows are preferred point mutations. X and Y indicate amino acid mutations at other sites.

[0134] Fig.21 Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability at the sgRNA-S1 site after the introduction of N108H-XY (A) and N108Y-XY (B) triple mutations into TadA-8e in 1249-NLS-TadA-8e-linker;

[0135] The point mutations indicated by red arrows in the figure can significantly enhance the C·G--T·A mutation ability of 1249-NLS-TadA-8e-linker, among which the dark red arrows are preferred point mutations. X and Y indicate amino acid mutations at other sites.

[0136] Fig. 22 Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability at the sgRNA-S1 site after the introduction of four-point mutations V28G-XYZ (A) and A48G-XYZ (B) into TadA-8e in 1249-NLS-TadA-8e-linker;

[0137] Schematically, the V28G-XYZ indicates that the amino acid at position 28 is mutated from valine to glycine and there are also mutations X, Y and Z;

[0138] The point mutations indicated by the red arrows in the figure can significantly enhance the C·G--T·A mutation ability of 1249-NLS-TadA-8e-linker, among which the dark red arrows are preferred point mutations. X, Y and Z refer to amino acid mutations at other sites.

[0139] Fig.23 Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability at the sgRNA-S1 site after the introduction of I49A-XYZ (A) and I49G-XYZ (B) four-point mutations into TadA-8e in 1249-NLS-TadA-8e-linker;

[0140] The point mutations indicated by the red arrows in the figure can significantly enhance the C·G--T·A mutation ability of 1249-NLS-TadA-8e-linker, among which the dark red arrows are preferred point mutations. X, Y and Z refer to amino acid mutations at other sites.

[0141] Fig.24Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability at the sgRNA-S1 site after the introduction of four-point mutations V82G-XYZ (A) and V82T-XYZ (B) into TadA-8e in 1249-NLS-TadA-8e-linker;

[0142] The point mutations indicated by the red arrows in the figure can significantly enhance the C·G--T·A mutation ability of 1249-NLS-TadA-8e-linker, among which the dark red arrows are preferred point mutations. X, Y and Z refer to amino acid mutations at other sites.

[0143] Fig.25 Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability at the sgRNA-S1 site after the introduction of four-point mutations N108H-XYZ (A) and N108Y-XYZ (B) into TadA-8e in 1249-NLS-TadA-8e-linker;

[0144] The point mutations indicated by the red arrows in the figure can significantly enhance the C·G--T·A mutation ability of 1249-NLS-TadA-8e-linker, among which the dark red arrows are preferred point mutations. X, Y and Z refer to amino acid mutations at other sites.

[0145] Fig.26 Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability at the sgRNA-S1 site after introducing five point mutations, V28G-XYZU (A), A48G-XYZU (B), I49A-XYZU (C) and I49G-XYZU (D), into TadA-8e in 1249-NLS-TadA-8e-linker;

[0146] Schematically, the V28G-XYZU indicates that the amino acid at position 28 is mutated from valine to glycine and there are also mutations X, Y, Z and U;

[0147] The point mutations indicated by the red arrows in the figure can significantly enhance the C·G--T·A mutation ability of 1249-NLS-TadA-8e-linker, among which the dark red arrows are preferred point mutations. X, Y, Z and U refer to amino acid mutations at other sites.

[0148] Fig. 27Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability at the sgRNA-S1 site after the introduction of four point mutations V82G-XYZU (A), V82T-XYZU (B), N108H-XYZU (C) and N108Y-XYZU (D) into TadA-8e in 1249-NLS-TadA-8e-linker;

[0149] The point mutations indicated by the red arrows in the figure can significantly enhance the C·G--T·A mutation ability of 1249-NLS-TadA-8e-linker, among which the dark red arrows are preferred point mutations. X, Y, Z and U refer to amino acid mutations at other sites.

[0150] Fig.28 Schematic diagram of the changes in the A·T--G·C mutation ability and C·G--T·A mutation ability at the sgRNA-S1 site after introducing various four-point and five-point mutations into TadA-8e in 1249-NLS-TadA-8e-linker. The A·T--G·C mutation ability of the point mutant 1249-NLS-TadA-8e-linker marked by the dark box is significantly reduced, but its C·G--T·A mutation ability is still not weaker than that of the wild-type 1249-NLS-TadA-8e-linker.

[0151] Fig.29 Schematic diagram of the off-target effects of different types of base editors at the RNA level and DNA level (non-Cas dependent).

[0152] a. Number of AI off-targets for each base editor at the RNA level.

[0153] b. Number of CU off-targets for each base editor at the RNA level.

[0154] c. AG off-target effects of each base editor at the DNA level (non-Cas9 dependent). A total of four off-target sites R-loop 1, 2, 3, and 4 were used for detection.

[0155] d. CT off-target effects of each base editor at the DNA level (non-Cas9 dependent). A total of four off-target sites R-loop 1, 2, 3, and 4 were used for detection.

[0156] * means P < 0.05; ** means P < 0.01; *** means P < 0.001. (The results are from three independent biological replicates).

[0157] Fig.30A schematic diagram showing the activity window of the optimized base editor for mediating C·G--T·A mutation and A·T--G·C mutation, and the base preference when mediating C·G--T·A mutation;

[0158] The figure shows the activity window of 1249-NLS-TadA-8e-linker mediating C·G--T·A mutation and A·T--G·C mutation (a) and the base preference when mediating C·G--T·A mutation (b); the activity window of 1249-NLS-TadA-8e-linker (V28G) mediating C·G--T·A mutation and A·T--G·C mutation (c) and the base preference when mediating C·G--T·A mutation (d); the activity window of 1249-NLS-TadA-8e-linker (N108Y) mediating C·G--T·A mutation and A·T--G·C mutation (e) and the base preference when mediating C·G--T·A mutation (f).

[0159] Fig.31 A schematic diagram showing the activity window of the optimized base editor for mediating C·G--T·A mutation and A·T--G·C mutation, and the base preference when mediating C·G--T·A mutation;

[0160] The figure shows the activity window of 1249-NLS-TadA-8e-linker (N46L) for mediating C·G--T·A mutation and A·T--G·C mutation (a) and its base preference when mediating C·G--T·A mutation (b); the activity window of 1249-NLS-TadA-8e-linker (N46C) for mediating C·G--T·A mutation and A·T--G·C mutation (c) and its base preference when mediating C·G--T·A mutation (d); the activity window of 1249-NLS-TadA-8e-linker (N46P) for mediating C·G--T·A mutation and A·T--G·C mutation (e) and its base preference when mediating C·G--T·A mutation (f).

[0161] Fig.32 A schematic diagram showing the activity window of the optimized base editor for mediating C·G--T·A mutation and A·T--G·C mutation, and the base preference when mediating C·G--T·A mutation;

[0162] The figure shows the activity window of 1249-NLS-TadA-8e-linker (V28G-N46L) for mediating C·G--T·A mutation and A·T--G·C mutation (a) and its base preference when mediating C·G--T·A mutation (b); the activity window of 1249-NLS-TadA-8e-linker (V28G-N46C) for mediating C·G--T·A mutation and A·T--G·C mutation (c) and its base preference when mediating C·G--T·A mutation (d); the activity window of 1249-NLS-TadA-8e-linker (V28G-N46P) for mediating C·G--T·A mutation and A·T--G·C mutation (e) and its base preference when mediating C·G--T·A mutation (f).

[0163] Fig.33 A schematic diagram showing the activity window of the optimized base editor for mediating C·G--T·A mutation and A·T--G·C mutation, and the base preference when mediating C·G--T·A mutation;

[0164] The figure shows the activity window of 1249-NLS-TadA-8e-linker (N46C-N108Y) for mediating C·G--T·A mutation and A·T--G·C mutation (a) and its base preference when mediating C·G--T·A mutation (b); the figure shows the activity window of 1249-NLS-TadA-8e-linker (N46P-N108S) for mediating C·G--T·A mutation and A·T--G·C mutation (c) and its base preference when mediating C·G--T·A mutation (d).

[0165] Fig.34 A schematic diagram showing the activity window of the optimized base editor for mediating C·G--T·A mutation and A·T--G·C mutation, and the base preference when mediating C·G--T·A mutation;

[0166] The figure shows the activity window of 1249-NLS-TadA-8e-linker (F84M-N108Y) for mediating C·G--T·A mutation and A·T--G·C mutation (a) and its base preference when mediating C·G--T·A mutation (b); the figure shows the activity window of 1249-NLS-TadA-8e-linker (F84M-N108C) for mediating C·G--T·A mutation and A·T--G·C mutation (c) and its base preference when mediating C·G--T·A mutation (d).

[0167] Fig.35 A schematic diagram showing the activity window of the optimized base editor for mediating C·G--T·A mutation and A·T--G·C mutation, and the base preference when mediating C·G--T·A mutation;

[0168] The figure shows the activity window of 1249-NLS-Q13XZ4(VN)-linker for mediating C·G--T·A mutation and A·T--G·C mutation (a) and its base preference when mediating C·G--T·A mutation (b); the activity window of 1249-NLS-B3PCY2(VN)-linker for mediating C·G--T·A mutation and A·T--G·C mutation (c) and its base preference when mediating C·G--T·A mutation (d); the activity window of 1249-NLS-E8WVH3(VN)-linker for mediating C·G--T·A mutation and A·T--G·C mutation (e) and its base preference when mediating C·G--T·A mutation (f).

[0169] Fig.36 Schematic diagram of the activity window for optimizing base editors to mediate C·G--T·A mutation and A·T--G·C mutation;

[0170] The figure shows the activity window of 1249-NLS-B5ZCW4(VN)-linker mediated C·G--T·A mutation and A·T--G·C mutation (a); the activity window of 1249-NLS-Q57LE3(VN)-linker mediated C·G--T·A mutation and A·T--G·C mutation (b); the activity window of 1249-NLS-Q99W51(VN)-linker mediated C·G--T·A mutation and A·T--G·C mutation (c). DETAILED DESCRIPTION

[0171] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0172] Example 1

[0173] Construction of TadA-8e-based base editor ABE

[0174] It is known that ecTadA* can be placed at the N-terminus, C-terminus or internal fusion site of nSpCas9 (D10A) for the construction of functional ABE (Nat Commun, 2020.11(1):5827). In this embodiment, in order to obtain ABE tools with higher editing activity and more diverse editing windows, according to existing studies (Nat Commun, 2020.11(1):5827), TadA-8e (SEQ ID NO.1) was placed at the N-terminus, C-terminus (the C-terminus had an additional link sequence (SEQ ID NO.3)) and multiple internal fusion sites (Table 1) of SV40NLS-linker-nSpCas9-nucleoplasmin NLS (SEQ.ID NO.2, positions 2-17 in the sequence are the SV40NLS-linker sequence, positions 18-1384 correspond to the 2-1368 sequence of nSpCas9 (D10A), and positions 1385-1400 are the nucleoplasmin NLS sequence) to construct a variety of ABE tool expression vectors ABE-Internal-8e (simultaneously expressing EGFP through the 2A-EGFP element). In addition, considering that the protein linker may improve the conformation of the fusion protein after internal fusion, the applicant added NLS sequence and linker sequence to the 5' and 3' of TadA-8e to obtain NLS-TadA-8e-linker (SEQ ID NO.4), and placed them at the N-terminus and multiple internal fusion sites of nSpCas9, respectively, to construct a variety of ABE tool expression vectors ABE-Internal-8e (expressing EGFP simultaneously through the 2A-EGFP element). To evaluate the editing activity of ABE-Internal-8e, different ABE-Internal-8e were co-transfected with single guide RNA (sgRNA) (sgRNA simultaneously expressed uracil glycosylase inhibitor UGI and 2A-mCherry) into cultured 293T cells. After 72 hours of cell culture, double-positive cells expressing EGFP and mCherry were collected by FACS. The sgRNA used in this example is S1 (sequence is GAACACAAAGCATAGACTGC).

[0175] Table 1 nspCas9 fusion sites

[0176]

[0177]

[0178] The genome of the collected double-positive cells was extracted, and directional PCR was performed using primers that can specifically amplify the sgRNA-S1 site information. The PCR products were verified by Sanger sequencing to verify the editing efficiency of different ABE-Internal-8e at the S1 site. The results showed that compared with TadA-8e, NLS-TadA-8e-linker can enhance the editing activity of various ABE-Internal-8e and expand the editing window to a certain extent ( Figure 1-2 In addition, the results showed that 1249-TadA-8e and 1249-NLS-TadA-8e-linker constructed at the 1249th fusion site of nSpCas9 had certain C·G--T·A mutation activity, among which 1249-NLS-TadA-8e-linker had higher C·G--T·A mutation activity at the C4 site than 1249-TadA-8e( Figure 3 a).

[0179] Example 2

[0180] Screening for point mutations in TadA-8e using the 1249-NLS-TadA-8e-linker tool

[0181] In this example, according to the structural information of TadA-8e (PDB: 6VPC), any one of several amino acids (amino acids at positions 28, 30, 46, 48, 49, 82, 84, 108, 110 or 111) located in the active pocket of TadA-8e and adjacent to the reaction substrate was selected for saturation mutation ( Figure 3 b), analyze the effects of different point mutations on the base editing activity of 1249-NLS-TadA-8e-linker.

[0182] To evaluate the effect of different point mutations on the base editing activity of 1249-NLS-TadA-8e-linker, the 1249-NLS-TadA-8e-linker mutant (simultaneously expressing EGFP through the 2A-EGFP element) was co-transfected with a single guide RNA (sgRNA) (sgRNA simultaneously expressing uracil glycosylase inhibitor UGI and 2A-mCherry) into cultured 293T cells. After 72 hours of cell culture, double positive cells expressing both EGFP and mCherry were collected by FACS (Scheme 1, FACS) or cells were directly collected (Scheme 2, NO.FACS). The sgRNA used in this example is S1 (sequence is GAACACAAAGCATAGACTGC).

[0183] The genome was extracted from the collected cells, and directional PCR was performed using primers that can specifically amplify the sgRNA-S1 site information. The PCR products were sequenced by Sanger to verify the changes in the base editing activity of each mutant of 1249-NLS-TadA-8e-linker.

[0184] In this example, the abilities of the base editors for A·T--G·C mutation and C·G--T·A mutation after single-point mutation of TadA-8e were analyzed.

[0185] The analysis indicators are: (1) after point mutation, the editing efficiency changes of the third adenine (A3), the fourth cytosine (C4), the fifth adenine (A5), the sixth cytosine (C6), and the seventh adenine (A7) (PAM is 21-23 sites) (relative efficiency = point mutation group / no mutation group, relative efficiency > 1 indicates that the ability of the mutant 1249-NLS-TadA-8e-linker A·T--G·C mutation or C·G--T·A mutation is enhanced);

[0186] (2) According to the editing of each base in the S1 site by 1249-NLS-TadA-8e-linker, its editing efficiency for A3, A5, A7, A8 and A9 is the highest and the efficiency of each site is close. Therefore, A5 is selected as the representative of the ability of 1249-NLS-TadA-8e-linker to mediate A·T--G·C mutation. After point mutation, the change in the ratio of C4 mutation efficiency to A5 mutation efficiency (C4 / A5) and the change in the ratio of C6 mutation efficiency to A5 mutation efficiency (C6 / A5) can reflect the change in the preference of 1249-NLS-TadA-8e-linker for cytosine (C) and adenine (A). The relative efficiency of C4 / A5 = (point mutation group C4 / A5) / (no mutation group C4 / A5), the relative efficiency of C6 / A5 = (point mutation group C6 / A5) / (no mutation group C6 / A5), and the relative efficiency > 1 indicates that the mutant 1249-NLS-TadA-8e-linker has enhanced editing ability and preference for cytosine (C).

[0187] Combining the above two indicators, the applicant screened for point mutations that can promote the C·G--T·A mutation ability mediated by 1249-NLS-TadA-8e-linker and increase the preference for cytosine (C). The results showed that V28W, V28G, N46L, N46P, N46C, A48C, A48G, A48N, A48S, I49D, I49E, I49H, I49N, I49P, I49Q, I49V, I49W, I49Y, I49R, I49A, I49T, I49G, I49L, I49S, I49M, I49C, I49F, I49 K, V82G, V82A, V82T, V82C, V82S, V82D, F84M, N108H, N108M, N108C, N108D, N108F, N108Q, N108S, and N108Y point mutations can enhance the ability of 1249-NLS-TadA-8e-linker to mediate C·G--T·A mutations and its editing preference for cytosine (C) ( Figure 3 c). The effects of other point mutations on the function of 1249-NLS-TadA-8e-linker can be found in Figure 4-Figure 8 .

[0188] Among the different point mutations at the N108 site, except for N108V, all can cause the activity window of 1249-NLS-TadA-8e-linker to be significantly narrowed. N108I, N108L, N108A, and N108T can significantly improve the base editing specificity and accuracy of 1249-NLS-TadA-8e-linker, and the active window is mainly located in A5. N108R can significantly improve the base editing specificity and accuracy of 1249-NLS-TadA-8e-linker, and the active window is mainly located in A3-A7. N108I, N108L, N108R, N108A, and N108T can significantly inhibit the ability of 1249-NLS-TadA-8e-linker to mediate C·G--T·A mutations (<10% editing efficiency). N108H, N108M, N108C, N108D, N108F, N108Q, N108S, and N108Y can significantly improve the ability of 1249-NLS-TadA-8e-linker to mediate C·G--T·A mutation (increased by more than 20%) Fig. 9 ).

[0189] Example 3

[0190] Perform combined point mutation screening (double point mutation) on TadA-8e in the 1249-NLS-TadA-8e-linker tool

[0191] In this example, according to the structural information of TadA-8e (PDB: 6VPC), key point mutations V28G, V28W (preferably V28G), N46P, N46C, N46L, A48G, I49A, I49G, V82T, F84M, N108H, N108M, N108C, N108D, N108Q, N108S, N108Y (preferably N108H, N108Y) that can enhance the ability of TadA-8e to mediate C·G--T·A mutation are selected, as well as the V82G point mutation that can reduce the risk of RNA off-target, and a double-point mutation type 1249-NLS-TadA-8e-linker is constructed to analyze the effects of different double-point mutation combinations on the base editing activity of 1249-NLS-TadA-8e-linker.

[0192] To evaluate the effect of different point mutations on the base editing activity of 1249-NLS-TadA-8e-linker, 1249-NLS-TadA-8e-linker mutants (simultaneously expressing EGFP through the 2A-EGFP element) were co-transfected with single guide RNA (sgRNA) (sgRNA simultaneously expressing uracil glycosylase inhibitor UGI and 2A-mCherry) into cultured 293T cells. After 72 hours of cell culture, double positive cells expressing both EGFP and mCherry were collected by FACS (Scheme 1), or all cells were directly collected (Scheme 2). The sgRNA used in this example is S1 (sequence is GAACACAAAGCATAGACTGC).

[0193] The collected cells were used to extract the genome, and directional PCR was performed using primers that can specifically amplify the sgRNA-S1 site information. The PCR products were sequenced by Sanger sequencing to verify the activity changes of each mutant of 1249-NLS-TadA-8e-linker.

[0194] The analysis indicators are: (1) changes in editing efficiency of the fourth cytosine (C4), the fifth adenine (A5), and the sixth cytosine (C6) after double point mutation (PAM is 21-23 sites) (relative efficiency = double point mutation group / no mutation group, when the relative efficiency of double point mutation > the relative efficiency of single point mutation, it indicates that compared with the single point mutation, the ability of the A·T--G·C mutation or C·G--T·A mutation of 1249-NLS-TadA-8e-linker after double point mutation is enhanced);

[0195] (2) After double point mutation, the relative efficiency of C4 / A5 = (double point mutation group C4 / A5) / (no mutation group C4 / A5), the relative efficiency of C6 / A5 = (double point mutation group C6 / A5) / (no mutation group C6 / A5). When the relative efficiency of double point mutation > the relative efficiency of single point mutation, it indicates that compared with the single point mutation, the editing ability and preference of 1249-NLS-TadA-8e-linker for cytosine (C) are enhanced after double point mutation.

[0196] Based on the above two indicators, the applicant screened for double-point mutations that can promote the ability of 1249-NLS-TadA-8e-linker to mediate C·G--T·A mutation ( Figure 10-15). Among them, the double point mutations V28G-N108Y, V28G-N108C, V28G-N108H, V28G-N46L, V28G-N46C, V28G-N46P, V28W-N46L, V28W-N46C, V28W-N46P, N46P-N108Y, N46P-N108S, N46P-N108Q, N46P-N108D, N46P-N108C, N46P-N108H, N46P-F84M, N46P-I49A, N46P-I49G, N46P-A48G, N46C-N108Y, N46C-N108S, N46C- N108Q, N46C-N108M, N46C-N108C, N46C-N108H, N46L-N108Y, N46L-N108Q, N46L-N108D, N46L-N108M, N46L-N108H, N46L-F84M, N46L-I49A, N46L-I49G, N46L-V82G, and I49A-N108Y can almost completely inhibit the A·T--G·C mutation ability of 1249-NLS-TadA-8e-linker, while maintaining the C·G--T·A mutation ability that is not weaker than that of 1249-NLS-TadA-8e-linker. In addition, compared with the corresponding single-point mutations, V28G-N46C, V28G-N46P, V28G-A48G, V28G-I49A, V28G-I49G, V28G-V82T, V28G-F84Y, V28W-N108H, V28W-N46P, V28W-N46C, N46C-V82G, N46C-V82T, N46C-F84M, N46L-A48G, N46L-V82T, N46L-F84M, N46P-F84M, N46P-N108H, N46P-N46P, and N46P-N108H. 08C, N46P-N108Q, N46P-N108S, A48G-N108H, I49A-N108H, I49G-N108H, I49G-N108Y, I49G-V82G, I49G-V82T, I49G-F84Y, V82G-N108Y, V82T-N108H, V82T-N108C, F84M-N108H, F84M-N108M, and F84M-N108Q double-point mutations can further enhance the editing ability and preference of 1249-NLS-TadA-8e-linker for cytosine (C) ( Fig.16 ).

[0197] Example 4

[0198] Perform point mutation combinatorial screening (three-point mutation) on TadA-8e in the 1249-NLS-TadA-8e-linker tool

[0199] In this example, according to the structural information of TadA-8e (PDB: 6VPC), as well as the results of single-point mutations and triple-point mutations, key point mutations V28G, A48G, I49A, I49G, V82T, N108H, and N108Y that can enhance the ability of TadA-8e to mediate C·G--T·A mutations, and V82G point mutations that can reduce the risk of RNA off-targets were selected, and a triple-point mutation type 1249-NLS-TadA-8e-linker was constructed to analyze the effects of different triple-point mutation combinations on the base editing activity of 1249-NLS-TadA-8e-linker.

[0200] To evaluate the effect of different point mutations on the base editing activity of 1249-NLS-TadA-8e-linker, 1249-NLS-TadA-8e-linker mutants (simultaneously expressing EGFP through the 2A-EGFP element) were co-transfected with single guide RNA (sgRNA) (sgRNA simultaneously expressing uracil glycosylase inhibitor UGI and 2A-mCherry) into cultured 293T cells. After 72 hours of cell culture, double positive cells expressing both EGFP and mCherry were collected by FACS (Scheme 1), or all cells were directly collected (Scheme 2). The sgRNA used in this example is S1 (sequence is GAACACAAAGCATAGACTGC).

[0201] The collected cells were used to extract the genome, and directional PCR was performed using primers that can specifically amplify the sgRNA-S1 site information. The PCR products were sequenced by Sanger sequencing to verify the activity changes of each mutant of 1249-NLS-TadA-8e-linker.

[0202] The analysis indicators were: (1) changes in editing efficiency of the fourth cytosine (C4), the fifth adenine (A5), and the sixth cytosine (C6) after triple-point mutation (PAM was 21-23 sites) (relative efficiency = three-point mutation group / no mutation group, relative efficiency > single-point mutation group, indicating that compared with single-point mutation, the ability of A·T--G·C mutation or C·G--T·A mutation of 1249-NLS-TadA-8e-linker was enhanced after triple-point mutation);

[0203] (2) After triple-point mutation, the relative efficiency of C4 / A5 = (C4 / A5 in triple-point mutation group) / (C4 / A5 in non-mutation group), the relative efficiency of C6 / A5 = (C6 / A5 in triple-point mutation group) / (C6 / A5 in non-mutation group), and the relative efficiency > single-point mutation group indicated that compared with single-point mutation, the ability of C·G--T·A mutation of 1249-NLS-TadA-8e-linker was enhanced after triple-point mutation.

[0204] Combining the above two indicators, we found that the three point mutations that significantly inhibited the A·T--G·C mutation ability of 1249-NLS-TadA-8e-linker while maintaining or enhancing the C·G--T·A mutation ability all contained N108Y or N108H point mutations. These three-point mutations include I49A-V82T-N108Y, I49A-V82G1-N08Y, I49G-V82T-N108Y, I49G-V82G-N108Y, A48G-V82G-N108Y, A48G-I49G-N108Y, V28G-V82G-N108Y, V28G-V82G-N108H, V28G-I49A-N108Y, V28G-I49A-N108H, V28G-I49G-N108H, V28G-A48G-N108Y, V28G-A48G-N108H ( Fig.17 ).

[0205] The analysis indicators were: (1) changes in editing efficiency of the fourth cytosine (C4), the fifth adenine (A5), and the sixth cytosine (C6) after triple-point mutation (PAM was 21-23 sites) (triple / single relative efficiency = triple-point mutation group / corresponding single-point mutation group, relative efficiency > 1 indicated that compared with the single-point mutation, the ability of the A·T--G·C mutation or C·G--T·A mutation of 1249-NLS-TadA-8e-linker was enhanced after triple-point mutation);

[0206] (2) After triple-point mutation, the triple / single relative efficiency of C4 / A5 = (triple-point mutation group C4 / A5) / (corresponding single-point mutation group C4 / A5), and the triple / single relative efficiency of C6 / A5 = (triple-point mutation group C6 / A5) / (corresponding single-point mutation group C6 / A5). The relative efficiency > 1 indicates that compared with the single-point mutation, the ability of the C·G--T·A mutation of 1249-NLS-TadA-8e-linker is enhanced after triple-point mutation.

[0207] Combining the above two indicators, the applicant screened for three point mutations that could promote the ability of 1249-NLS-TadA-8e-linker to mediate C·G--T·A mutation ( Figure 18-21). The results showed that V28G-A48G-I49G, V28G-A48G-I49A, V28G-A48G-V82G, V28G-A48G-V82T, V28G-A48G-N108H, V28G-A48G-N108Y, V28G-I49G-V82G, V28G-I49G-V82T, V28G-I49G-N108H, V28G-I49G-N108Y, V28G-I49G-V82G. The triple-point mutations 9A-V82G, V28G-I49A-V82T, V28G-I49A-N108H, V28G-I49A-N108Y, I49G-V82G-N108H, I49G-V82G-N108Y, I49G-V82T-N108H, and I49G-V82T-N108Y can further enhance the C·G--T·A mutation ability mediated by 1249-NLS-TadA-8e-linker.

[0208] Example 5

[0209] Perform point mutation combinatorial screening on TadA-8e in the 1249-NLS-TadA-8e-linker tool (four point mutations)

[0210] In this example, according to the structural information of TadA-8e (PDB: 6VPC), as well as the results of single-point mutation, double-point mutation and triple-point mutation, the key point mutations V28G, A48G, I49A, I49G, V82T, N108H, N108Y that can enhance the ability of TadA-8e to mediate C·G--T·A mutation, and the V82G point mutation that can reduce the risk of RNA off-target are selected, and the four-point mutation expression vector of 1249-NLS-TadA-8e-linker is constructed to analyze the effects of different four-point mutation combinations on the base editing activity of 1249-NLS-TadA-8e-linker.

[0211] To evaluate the effect of different point mutations on the base editing activity of 1249-NLS-TadA-8e-linker, 1249-NLS-TadA-8e-linker mutants (simultaneously expressing EGFP through the 2A-EGFP element) were co-transfected with single guide RNA (sgRNA) (sgRNA simultaneously expressing uracil glycosylase inhibitor UGI and 2A-mCherry) into cultured 293T cells. After 72 hours of cell culture, double positive cells expressing both EGFP and mCherry were collected by FACS (Scheme 1), or all cells were directly collected (Scheme 2). The sgRNA used in this example is S1 (sequence is GAACACAAAGCATAGACTGC).

[0212] The collected cells were used to extract the genome, and directional PCR was performed using primers that can specifically amplify the sgRNA-S1 site information. The PCR products were sequenced by Sanger sequencing to verify the activity changes of each mutant of 1249-NLS-TadA-8e-linker.

[0213] The analysis indicators were: (1) changes in editing efficiency of the fourth cytosine (C4), the fifth adenine (A5), and the sixth cytosine (C6) after four-point mutation (PAM was 21-23 sites) (four / single relative efficiency = four-point mutation group / corresponding single-point mutation group, relative efficiency > 1 indicated that compared with the single-point mutation, the ability of the A·T--G·C mutation or C·G--T·A mutation of 1249-NLS-TadA-8e-linker was enhanced after four-point mutation);

[0214] (2) After four-point mutation, the four / single relative efficiency of C4 / A5 = (four-point mutation group C4 / A5) / (corresponding single-point mutation group C4 / A5), and the four / single relative efficiency of C6 / A5 = (four-point mutation group C6 / A5) / (corresponding single-point mutation group C6 / A5). The relative efficiency > 1 indicates that compared with the single-point mutation, the ability of the C·G--T·A mutation of 1249-NLS-TadA-8e-linker is enhanced after four-point mutation.

[0215] Combining the above two indicators, the applicant screened for four point mutations that could promote the ability of 1249-NLS-TadA-8e-linker to mediate C·G--T·A mutation ( Figure 22-25 The results showed that the four-point mutations V28G-I49G-V82T-N108Y, A48G-I49A-V82T-N108H, and A48G-I49G-V82G-N108H could further enhance the ability of 1249-NLS-TadA-8e-linker to mediate C·G--T·A mutation.

[0216] Example 6

[0217] Perform point mutation combinatorial screening on TadA-8e in the 1249-NLS-TadA-8e-linker tool (five point mutations)

[0218] In this example, according to the structural information of TadA-8e (PDB: 6VPC), as well as the results of single-point mutation, two-point mutation, three-point mutation and four-point mutation, the key point mutations V28G, A48G, I49A, I49G, V82T, N108H, N108Y that can enhance the ability of TadA-8e to mediate C·G--T·A mutation, and the V82G point mutation that can reduce the risk of RNA off-target are selected, and the five-point mutation expression vector of 1249-NLS-TadA-8e-linker is constructed to analyze the effects of different five-point mutation combinations on the base editing activity of 1249-NLS-TadA-8e-linker.

[0219] To evaluate the effect of different point mutations on the base editing activity of 1249-NLS-TadA-8e-linker, 1249-NLS-TadA-8e-linker mutants (simultaneously expressing EGFP through the 2A-EGFP element) were co-transfected with single guide RNA (sgRNA) (sgRNA simultaneously expressing uracil glycosylase inhibitor UGI and 2A-mCherry) into cultured 293T cells. After 72 hours of cell culture, double positive cells expressing both EGFP and mCherry were collected by FACS (Scheme 1), or all cells were directly collected (Scheme 2). The sgRNA used in this example is S1 (sequence is GAACACAAAGCATAGACTGC).

[0220] The collected cells were used to extract the genome, and directional PCR was performed using primers that can specifically amplify the sgRNA-S1 site information. The PCR products were sequenced by Sanger sequencing to verify the activity changes of each mutant of 1249-NLS-TadA-8e-linker.

[0221] The analysis indicators were: (1) changes in editing efficiency of the fourth cytosine (C4), the fifth adenine (A5), and the sixth cytosine (C6) after five-point mutation (PAM was 21-23 sites) (five / single relative efficiency = five-point mutation group / corresponding single-point mutation group, relative efficiency > 1 indicated that compared with the single-point mutation, the ability of the A·T--G·C mutation or C·G--T·A mutation of 1249-NLS-TadA-8e-linker was enhanced after five-point mutation);

[0222] (2) After the five-point mutation, the five-point / single relative efficiency of C4 / A5 = (five-point mutation group C4 / A5) / (corresponding single-point mutation group C4 / A5), and the five-point / single relative efficiency of C6 / A5 = (five-point mutation group C6 / A5) / (corresponding single-point mutation group C6 / A5). The relative efficiency > 1 indicates that compared with the single-point mutation, the ability of the C·G--T·A mutation of 1249-NLS-TadA-8e-linker is enhanced after the five-point mutation.

[0223] Combining the above two indicators, the applicant screened five mutations that could promote the ability of 1249-NLS-TadA-8e-linker to mediate C·G--T·A mutation ( Figure 26-27 The results showed that the five-point mutations V28G-A48G-I49G-V82T-N108H, V28G-A48G-I49G-V82T-N108Y, V28G-A48G-I49A-V82T-N108H, and V28G-A48G-I49A-V82T-N108Y could further enhance the ability of 1249-NLS-TadA-8e-linker to mediate C·G--T·A mutation.

[0224] In addition, we further analyzed the data of four-point mutations and five-point mutations and calculated two indicators respectively:

[0225] (1) Changes in editing efficiency of the fourth cytosine (C4), the fifth adenine (A5), and the sixth cytosine (C6) after multiple point mutations (PAM is 21-23 sites) (relative efficiency = multiple point mutation group / no point mutation group).

[0226] (2) After multiple point mutations, the relative efficiency of C4 / A5 = (multiple point mutation group C4 / A5) / (no point mutation group C4 / A5), and the relative efficiency of C6 / A5 = (multiple point mutation group C6 / A5) / (no point mutation group C6 / A5).

[0227] Combining the above two indicators, we found that the four / five point mutations that significantly inhibited the A·T--G·C mutation ability of 1249-NLS-TadA-8e-linker, while maintaining or enhancing the C·G--T·A mutation ability, all contained N108Y or N108H point mutations. This indicates that the point mutation at the N108 site is critical to changing the base editor's preference for editing cytosine (C) and adenine (A). The N108Y / H point mutation can significantly enhance the 1249-NLS-TadA-8e-linker's preference for editing cytosine (C). Except for A48G-I49A-V82T-N108H, all four-point mutations and five-point mutations containing N108Y / H (various four-point mutations and five-point mutation combinations of V28G, A48G, I49A / G, V82T / G and N108H / Y) can significantly inhibit the A·T--G·C mutation ability of 1249-NLS-TadA-8e-linker. ( Fig.28 ).

[0228] Example 7

[0229] Preferred tools for off-target effect analysis at the RNA level

[0230] In this embodiment, 1249-NLS-TadA-8e-linker, 1249-NLS-TadA-8e-linker (V28G), 1249-NLS-TadA-8e-linker (N46L), 1249-NLS-TadA-8e-linker (N46C), 1249-NLS-TadA-8e-linker (N46P), 1249-NLS-TadA-8e-linker (N108Y), 1249-NLS-TadA-8e-linker (V28G-N46L), 1249-NLS-TadA-8e-linker (V28G-N46P), 1249-NLS-TadA-8e-linker (V28G-N46C), 1249-NLS-TadA-8e-linker (N46C- N108Y), 1249-NLS-TadA-8e-linker (N46P-N108S), 1249-NLS-TadA-8e-linker (F84M-N108Y), 1249-NLS-TadA-8e-linker(F84M-N108C), 1249-NLS-Q13XZ4(VN)-linker, 1249-NLS-B3PCY2(V N)-linker, 1249-NLS-B5ZCW4(VN)-linker, 1249-NLS-E8WVH3(VN)-linker, 1249-NLS-Q57LE3(VN)-linker, 1249-NLS-Q99W51(VN)-linker, 1249-NLS-ecTadA(VN)-linker to analyze its off-target effects at the RNA level. Among them, 1249-NLS-TadA-8e-linker(8E) was used as a positive control; nCas9-D10A was used as a negative control.

[0231] To evaluate the off-target effects of each preferred tool at the RNA level, each preferred expression vector (expressing EGFP simultaneously through the 2A-EGFP element) was co-transfected with a single guide RNA (sgRNA) (sgRNA simultaneously expressed the uracil glycosylase inhibitor UGI and 2A-puromycin) into cultured 293T cells. Puromycin was added 24 hours after transfection to select positive cells. After 48 hours of puromycin treatment, cells were collected to extract total RNA for RNA-seq experiments. The sgRNA used in this protocol is sg-RNF (sequence GTCATCTTAGTCATTACCTG).

[0232] RNA editing refers to the process of changing genetic information at the mRNA level. Specifically, it refers to the deletion, insertion or chemical modification of nucleotides in mRNA molecules. This modification affects gene expression, the production of different amino acids and the formation of open reading frames. In mammalian cells, there are two main types of RNA editing, namely AI editing and CU editing. This RNA editing is mediated by RNA-dependent adenine deaminase.

[0233] We first analyzed the AI ​​editing results and found that the TadA-8e* point mutation significantly reduced the off-target effect of 1249-NLS-TadA-8e-linker at the RNA level. After the point mutation, the off-target effect at the RNA level was similar to that of the background (NC, transfection of sgRNA only) and the negative control group (Cas9-D10A+sgRNA). In addition, among other newly screened functional TadA-based base editors, the off-target effects of 1249-NLS-B5ZCW4(VN)-linker and 1249-NLS-B3PCY2(VN)-linker at the RNA level were similar to those of the background and negative controls, while the off-target effects of 1249-NLS-Q13XZ4(VN)-linker, 1249-NLS-ecTadA(VN)-linker, 1249-NLS-Q57LE3(VN)-linker and 1249-NLS-E8WVH3(VN)-linker at the RNA level were slightly higher than those of the background and negative controls, but significantly lower than those of 1249-NLS-TadA-8e-linker. The off-target effect of 1249-NLS-Q99W51(VN)-linker at the RNA level was significantly higher than that of 1249-NLS-TadA-8e-linker( Fig.29 a).

[0234] The results of CU editing at the RNA level showed that each sample group was similar to the background (NC, transfected with sgRNA only) and the negative control group (Cas9-D10A+sgRNA), with no significant increase ( Fig.29 b).

[0235] Example 8

[0236] Analysis of off-target effects of some tools at the DNA level (non-Cas-dependent off-target effects)

[0237] In this embodiment, 1249-NLS-TadA-8e-linker (V28G), 1249-NLS-TadA-8e-linker (N46L), 1249-NLS-TadA-8e-linker (N46C), 1249-NLS-TadA-8e-linker (N46P), 1249-NLS-TadA-8e-linker (N108Y), 1249-NLS-TadA-8e-linker (V28G-N46L), 1249-NLS-TadA-8e-linker (V28G-N46P), 1249-NLS-TadA-8e-linker (V28G-N46C), 1249-NLS-TadA-8e-linker (N46C-N108Y) are preferred. , 1249-NLS-TadA-8e-linker(N46P-N108S), 1249-NLS-TadA-8e-linker(F84M-N108Y), 1249-NLS-TadA-8e-linker(F84M-N108C), 1249-NLS-Q13XZ4(VN)-linker, 1249-NLS-B3PCY2(VN)-linker, 1249-NLS-B5ZCW4(VN)-linker, 1249-NLS-E8WVH3(VN)-linker, 1249-NLS-Q57LE3(VN)-linker, 1249-NLS-Q99W51(VN)-linker to analyze their off-target effects at the DNA level (non-Cas-dependent off-target effects). 1249-NLS-TadA-8e-linker (8e) was also selected as a control.

[0238] Off-target effects at the DNA level (non-Cas-dependent off-target effects) are analyzed by R-Loop experiments [8]. The basic principle is that dSaCas9 and sasgRNA (sasgRNA-X) targeting a specific genomic site (site X) are co-expressed in cells, inducing the formation of a single-stranded DNA (ssDNA) region at site X; at this time, the co-expressed base editor (ABE or CBE) in the cell may bind to ssDNA and mediate C·G--T·A (CBE) or A·T--G·C (ABE) mutations due to its own affinity for ssDNA.

[0239] After the human HEK293T cell line was revived and cultured, it was plated in 12-well plates at a density of 30%-50%. After 24 hours, liposomes were used to co-transfect the preferred expression vectors of the base editor (simultaneously expressing EGFP through the 2A-EGFP element) and the inactivated SaCas9 (dSaCas9)-sasgRNA co-expression vector (simultaneously expressing red fluorescent protein). After 72 hours of culture, the cells were harvested by trypsin digestion, double-positive cells were sorted by flow cytometry, and the genome was extracted by lysing the cells with lysis buffer. After that, primers were designed for directional amplification of the sasgRNA site. The amplified products were purified and deeply sequenced, and data analysis was performed to understand the AG and CT mutation frequencies at the sasgRNA site. In the study, four different sasgRNA off-target sites (sasgRNA-1~6) were selected for off-target effect analysis at the DNA level (non-Cas-dependent off-target effects).

[0240] The results of AG mutation efficiency showed that the base editing efficiency of 1249-NLS-TadA-8e-linker (8e) at the four sites of sasgRNA-1, 2, 4, and 6 was <8% (the editing efficiency is the sum of the AG mutation frequencies of all off-target sites), indicating that its off-target effect at the DNA level (non-Cas-dependent off-target effect) is very low. Compared with 1249-NLS-TadA-8e-linker (8e), 1249-NLS-TadA-8e-linker (V28G), 1249-NLS-TadA-8e-linker (N46L), 1249-NLS-TadA-8e-linker (N46C), 1249-NLS-TadA-8e-linker (N46P), 1249-NLS-TadA-8e-linker (N108 Y), 1249-NLS-TadA-8e-linker (V28G-N46L), 1249-NLS-TadA-8e-linker (V28G-N46P), 1249-NLS-TadA-8e- linker(V28G-N46C), 1249-NLS-TadA-8e-linker(N46C-N108Y), 1249-NLS-TadA-8e-linker(N46P-N108S), 1 249-NLS-TadA-8e-linker(F84M-N108Y), 1249-NLS-TadA-8e-linker(F84M-N108C), 1249-NLS-Q13XZ4(VN) -linker, 1249-NLS-B3PCY2(VN)-linker, 1249-NLS-B5ZCW4(VN)-linker, 1249-NLS-E8WVH3(VN)-linker, 1 Point mutations such as 249-NLS-Q57LE3(VN)-linker and 1249-NLS-Q99W51(VN)-linker can significantly reduce the off-target effects at the DNA level of the four sites of sasgRNA-1, 2, and 4 (non-Cas-dependent off-target effects); at the sasgRNA-6 site, the off-target effects at the DNA level of the above base editors (non-Cas-dependent off-target effects) are also lower than 8e, and the AG base editing efficiencies at the four off-target sites 1, 2, 4, and 6 are all <4% ( Fig.29 c).

[0241] Analysis of CT mutation efficiency showed that except for V28G-N46C at the sasgRNA-6 site, which had a mutation efficiency of nearly 4%, the CT mutation efficiencies of the other base editors at the four sites were all <2% ( Fig.29 d).

[0242] The results of DNA off-target effect analysis showed that base editors constructed with point mutations and new TadA deaminase had a low level of non-Cas-dependent off-target effects and significantly improved safety.

[0243] Example 9: Optimizing the activity window and base preference of base editors

[0244] In this embodiment, 1249-NLS-TadA-8e-linker, 1249-NLS-TadA-8e-linker(V28G), 1249-NLS-TadA-8e-linker(N46L), 1249-NLS-TadA-8e-linker(N46C), 1249-NLS-TadA-8e-linker(N46P), 1249-NLS -TadA-8e-linker(N108Y)、1249-NLS-TadA-8e-linker(V28G-N46L)、1249-NLS-TadA-8e-linke r(V28G-N46P), 1249-NLS-TadA-8e-linker(V28G-N46C), 1249-NLS-TadA-8e-linker(N46C-N10 8Y), 1249-NLS-TadA-8e-linker (N46P-N108S), 1249-NLS-TadA-8e-linker (F84M-N108Y), 1249 -NLS-TadA-8e-linker(F84M-N108C), 1249-NLS-Q13XZ4(VN)-linker, 1249-NLS-B3PCY2(VN)-l Inker, 1249-NLS-B5ZCW4(VN)-linker, 1249-NLS-E8WVH3(VN)-linker, 1249-NLS-Q57LE3(VN)-linker, and 1249-NLS-Q99W51(VN)-linker were used to analyze their activity window and base preference, and 1249-NLS-TadA-8e-linker (8e) was selected as a control.

[0245] In order to systematically analyze the activity window and base preference of base editors, 12 sgRNAs (S18 sequence: ACACACACACTTAGAATCTG; HEK4 sequence: GGCACTGCGGCTGGAGGTGG; ZSCAN2 sequence: GTGCGGCAAGAGCTTCAGCC; AAVS1 sequence: GACCCTCAGCCGTGCTGCTC; FAN3 sequence: CGCCGTCTCCAAGGTGAAAG; EMX sequence: GAGTCCGAGCAGAAGAAGAA; MSKC sequence: CGTCGCCGATCTTCACAGGG; PT14 sequence: TCCAAACCCATATATACAGC; RNF sequence: GTCATCTTAGTCATTACCTG; S1 sequence: GAACACAAAGCATAGACTGC; sgB sequence: AGAGCCCCCCCTCAAAGAGA; UBE3A sequence: GTACAGTTAGTACTCAGCAG) were selected for related research. The 1249-NLS-TadA-8e-linker mutant (which simultaneously expresses EGFP through the 2A-EGFP element) was co-transfected with a single guide RNA (sgRNA) (which simultaneously expresses the uracil glycosylase inhibitor UGI and 2A-mCherry) into cultured 293T cells. After 72 hours of cell culture, double-positive cells expressing both EGFP and mCherry were collected by FACS (Scheme 1).

[0246] The cell-extracted genome was collected and directional PCR was performed using primers that can specifically amplify the target sgRNA site information. The PCR products were sequenced by amplicon to analyze the activity window and base preference of the preferred base editor (n = 3 biological replicates).

[0247] The results showed that 1249-NLS-TadA-8e-linker has the ability to mediate C·G--T·A mutation (CBE activity) and A·T--G·C mutation (ABE activity), but its ABE activity is significantly higher than its CBE activity. The ABE activity window of 1249-NLS-TadA-8e-linker is A2-A14 (PAM is 21-23), and the CBE activity window is (C4-C7) ( Fig.30 a). The CBE activity of 1249-NLS-TadA-8e-linker showed base preference, and its preference for different base sites was CA≈CT>CG≈CC, AC≈TC>GC≈CC( Fig.30 b).

[0248] Different point mutations of TadA-8e have an impact on its base editing activity and base preference. For single point mutations, after the V28G point mutation, the CBE activity of 1249-NLS-TadA-8e-linker (V28G) is higher than the ABE activity, and the CBE activity window is (C4-C7), and the ABE activity window is A5 ( Fig.30 c). Its preference for different base sites is CA≈CT>CG≈CC, AC≈TC>CC>GC( Fig.30 d). The CBE activity of 1249-NLS-TadA-8e-linker (N108Y) is similar to the ABE activity, where the CBE activity window is (C4-C7) and the ABE activity window is (A5-A7) ( Fig.30 e). Its preference for different base sites is CT≈CA≈CC>CG, TC>AC>CC≈GC ( Fig.30 f). 1249-NLS-TadA-8e-linker (N46L) has almost no ABE activity, and its CBE activity window is (C4-C8) ( Fig.31 a). Its preference for different base sites is CG>CA≈CC≈CT, CC≈TC>GC≈AC( Fig.31 b). The CBE activity of 1249-NLS-TadA-8e-linker (N46C) is similar to the ABE activity, where the CBE activity window is (C4-C8) and the ABE activity window is (A5-A7) ( Fig.31 c). Its preference for different base sites is CT≈CA≈CC>CG, CC≈TC>GC≈AC ( Fig.31 d). 1249-NLS-TadA-8e-linker (N46P) has only CBE activity, and the activity window is (C4-C8) ( Fig.31 e). Its preference for different base sites is CC≈TC>GC≈AC( Fig.31 f).

[0249] For the double-point mutation, the ABE activity of 1249-NLS-TadA-8e-linker (V28G-N46L) is very low, and the CBE activity window is (C4-C8) ( Fig.32 a), its preference for different base sites is CG≈CT≈CA>CC, TC≈CC>GC≈AC( Fig.32 b). The ABE activity of 1249-NLS-TadA-8e-linker (V28G-N46C) is very low, and the CBE activity window is (C4-C9) ( Fig.32 c), its preference for different base sites is TC≈CC≈AC>GC( Fig.32d). The ABE activity of 1249-NLS-TadA-8e-linker (V28G-N46P) is very low, and the CBE activity window is (C4-C8) ( Fig.32 e), its preference for different base sites is CT≈CG≈CA>CC, TC≈CC>GC≈AC( Fig.32 f). The ABE and CBE activities of 1249-NLS-TadA-8e-linker (N46C-N108Y) are both very low, with the ABE activity window at A5 and the CBE activity window at C4-C6 ( Fig.33 a). Its preference for different base sites is CA≈CT>CC≈CG, AC≈TC>CC≈GC( Fig.33 b). The CBE activity of 1249-NLS-TadA-8e-linker (N46P-N108S) is significantly higher than the ABE activity. The ABE activity window is A5, and the CBE activity window is C4-C9 ( Fig.33 c), which has no obvious base preference ( Fig.33 d). The ABE activity of 1249-NLS-TadA-8e-linker (F84M-N108Y) is similar to that of CBE. The activity window of ABE is A5-A7, while that of CBE is C4-C7 ( Fig.34 a), its preference for different base sites is CT≈CA≈CC>CG, TC≈AC>CC≈GC( Fig.34 b). The activity of ABE of 1249-NLS-TadA-8e-linker (F84M-N108C) is significantly higher than that of CBE. The activity window of ABE is A5-A7, while that of CBE is C4-C7 ( Fig.34 c). Its preference for different base sites is CA≈CT>CC≈CG, AC≈TC>CC≈GC ( Fig.34 d).

[0250] In summary, different point mutations in TadA-8e will significantly change the base editing activity and preference of 1249-NLS-TadA-8e-linker, and the effects of different point mutations on ABE and CBE activities are significantly different.

[0251] For base editors derived from TadA homologous proteins, the CBE activity of 1249-NLS-Q13XZ4(VN)-linker is significantly higher than the ABE activity. The CBE activity window is C4-6, and the ABE activity window is A5, A7 ( Fig.35 a). Its preference for different base sites is CA≈CT>CC≈CG, AC≈TC>CC≈GC( Fig.35b). The ABE activity of 1249-NLS-B3PCY2(VN)-linker is very low, and the CBE activity window is C4-7 ( Fig.35 c). Its preference for different base sites is that it has high editing activity at CT / AC sites and very low editing activity at CG / GC sites ( Fig.35 d). 1249-NLS-E8WVH3(VN)-linker has similar ABE and CBE activities, with the CBE activity window being C4-6 and the ABE activity window being A3-7 ( Fig.35 e). Its preference for different base sites is CA≈CT>CC>CG, AC>TC≈CC≈GC( Fig.35 f). The CBE activity of 1249-NLS-B5ZCW4(VN)-linker is very low, and the ABE activity window is A5-7 ( Fig.36 a) The CBE activity of 1249-NLS-Q57LE3(VN)-linker is very low, and the ABE activity window is A5. Fig.36 b), the CBE and ABE activities of 1249-NLS-Q99W51(VN)-linker are both very low, with the CBE activity window at C5 and the ABE activity window at A3 and A5 ( Fig.36 c)

[0252] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A base editor, characterized in that A fusion protein formed by fusion of the mutant TadA-8e to the N-terminus, C-terminus or internal fusion site of the Cas nuclease; The mutant TadA-8e refers to a deaminase in which the amino acid at the amino acid position 108 in TadA-8e is mutated; The amino acid sequence of TadA-8e is shown in SEQ ID NO.

1.

2. The base editor according to claim 1, characterized in that The Cas nuclease is selected from the Cas9, Cas12, and Cas13 protein families; Preferably, the Cas nuclease is selected from nSpCas9 and its mutants, SaCas9 and its mutants, Cas12a and its mutants or Cas12f and its mutants, preferably nSpCas9.

3. The base editor according to claim 1, characterized in that The mutant TadA-8e refers to a deaminase obtained after the amino acid at the 108th amino acid position in TadA-8e is mutated to one of the other 19 amino acids different from the original amino acid at the position; Preferably, the mutant TadA-8e refers to a deaminase obtained by performing the following single-point mutations on amino acids in TadA-8e: N108H, N108M, N108C, N108D, N108F, N108Q, N108S, N108Y, N108V, N108I, N108L, N108A, N108T, N108R.

4. The base editor according to claim 1, characterized in that The mutant TadA-8e refers to a deaminase obtained by performing the following double-point mutations on the amino acids in TadA-8e: (1) a deaminase in which the amino acid at position 28 is mutated and the amino acid at position 108 is mutated, or (2) a deaminase in which the amino acid at position 46 is mutated and the amino acid at position 108 is mutated, or (3) a deaminase in which the amino acids at positions 48 and 108 are simultaneously mutated, or (4) a deaminase in which the amino acid at position 49 is mutated and the amino acid at position 108 is mutated, or (5) a deaminase in which the amino acid at position 108 is mutated and one of the amino acids at position 82 or 84 is mutated; Preferably, the mutant TadA-8e refers to a deaminase obtained by performing the following double-point mutations on the amino acids in TadA-8e: V28G-N108Y, V28G-N108C, V28G-N108H, N46P-N108Y, N46P-N108S, N46P-N108Q, N46P-N108D, N46P-N108C, N4 6P-N108H, N46C-N108Y, N46C-N108S, N46C-N108Q, N46C-N108M, N46C-N108C, N46C-N108H, N46L-N108Y, N46L- N108Q, N46L-N108D, N46L-N108M, N46L-N108H, I49A-N108Y, V28W-N108H, N46P-N108M, A48G-N108H, I49A-N10 8H, I49G-N108H, I49G-N108Y, V82G-N108Y, V82T-N108H, V82T-N108C, F84M-N108H, F84M-N108M, F84M-N108Q.

5. The base editor according to claim 1, characterized in that The mutant TadA-8e refers to a deaminase obtained by performing the following three point mutations on the amino acids in TadA-8e: (1) a deaminase in which the amino acids at positions 28, 48 and 108 are simultaneously mutated, or (2) a deaminase in which the amino acids at positions 28, 49 and 108 are simultaneously mutated, or (3) deaminase with simultaneous mutations in amino acids at positions 49, 82, and 108; Preferably, the mutant TadA-8e refers to a deaminase obtained by performing the following three point mutations on the amino acids in TadA-8e: I49A-V82T-N108Y, I49G-V82T-N108Y, I49G-V82G-N108Y, A48G-V82G-N1 08Y, A48G-I49G-N108Y, V28G-V82G-N108Y, V28G-V82G-N108H, V28G-I49 A-N108Y, V28G-I49A-N108H, V28G-I49G-N108H, V28G-A48G-N108Y, V28G -A48G-N108H, V28G-I49G-N108Y, I49G-V82G-N108H, I49G-V82T-N108H.

6. The base editor according to claim 1, characterized in that The mutant TadA-8e refers to a deaminase in which the amino acid at the 108th amino acid position in TadA-8e is mutated and three other positions at the 28th, 48th, 49th and 82nd amino acid positions in TadA-8e are mutated; Preferably, the mutant TadA-8e refers to a deaminase in which the amino acid position 108 of TadA-8e is mutated to N108Y or N108H, and three other positions of the amino acid positions 28, 48, 49, and 82 of TadA-8e are mutated as follows: The amino acid position 28 in TadA-8e was mutated to V28G, The amino acid position 48 in TadA-8e was mutated to A48G. The amino acid position 49 in TadA-8e was mutated to I49A or I49G. The amino acid position 82 in TadA-8e was mutated to V82T or V82G.

7. The base editor according to claim 1, characterized in that The mutant TadA-8e refers to a deaminase in which the amino acids at positions 28, 48, 49, 82, and 108 of TadA-8e are simultaneously mutated; Preferably, the mutant TadA-8e refers to a deaminase obtained by subjecting the amino acids in TadA-8e to the following five mutations: While the amino acid position 108 in TadA-8e is mutated to N108Y or N108H, the amino acid positions 28, 48, 49, and 82 in TadA-8e are also mutated to the following deaminase; The amino acid position 28 in TadA-8e was mutated to V28G, The amino acid position 48 in TadA-8e was mutated to A48G. The amino acid position 49 in TadA-8e was mutated to I49A or I49G. The amino acid position 82 in TadA-8e was mutated to V82T or V82G.

8. The base editor according to claim 1 or 2 or 3 or 4 or 5 or 6 or 7, characterized in that Various variants with different sequences are added to the 5' and 3' of the mutant TadA-8e and then placed at the N-terminus, C-terminus or internal fusion site of the Cas nuclease to form a fusion protein; Preferably, after adding NLS sequence and linker sequence to 5' and 3' of mutant TadA-8e, respectively, NLS-mutant TadA-8e-linker is obtained, and NLS-mutant TadA-8e-linker is placed at the N-terminus, C-terminus or internal fusion site of Cas nuclease to form a fusion protein; Among them, NLS-mutant TadA-8e-linker means that one or more of the amino acids in TadA-8e are mutated relative to NLS-TadA-8e-linker, the amino acid sequence of NLS-TadA-8e-linker is shown in SEQ ID NO.4, and the amino acid sequence of NLS-mutant TadA-8e-linker is the amino acid sequence obtained by replacing TadA-8e with mutant TadA-8e in the amino acid sequence of NLS-TadA-8e-linker.

9. The base editor according to claim 1 or 2 or 3 or 4 or 5 or 6 or 7, characterized in that When the Cas nuclease is selected as nSpCas9, the internal fusion sites include fusion sites 113, 203, 312, 459, 535, 583, 687, 701, 715, 730, 770, 793, 801, 895, 905, 919, 946, 1010, 1029, 1047, 1117, 1154, 1249, and 1282; The preferred fusion site is position 1249.

10. A method for constructing a base editor, characterized in that: The following steps are involved: The mutant TadA-8e was fused to different sites of the Cas nuclease to construct a base editor; The mutant TadA-8e refers to a deaminase in which the amino acid at the 108th amino acid position in TadA-8e is mutated.

11. The method for constructing a base editor according to claim 10, characterized in that: An NLS sequence and a linker sequence were added to the 5' and 3' ends of the mutant TadA-8e, respectively.

12. Application of base editor ABE, characterized in that: The base editor ABE mediates A·T--G·C mutation; Base editor ABE refers to a fusion protein formed by placing the deaminase after the amino acid mutation at the 108th amino acid position in TadA-8e at the N-terminus and the 1249th fusion site of nSpCas9. This type of fusion protein only has the obvious ability to mediate A·T--G·C mutation.

13. Application of base editor CBE, characterized in that: The base editor CBE mediates C·G--T·A mutation; Base editor CBE refers to a fusion protein formed by fusion of the following amino acid mutations in TadA-8e with the deaminase placed at the N-terminus of nSpCas9 and the 1249th fusion site: Double point mutations: V28G-N108Y, V28G-N108C, V28G-N108H, N46P-N108Y, N46P-N108S, N46P-N108Q, N46P-N108D, N46P-N108C, N46P-N108H, N46C-N108Y, N46C-N108S, N46C-N108Q, N46C-N108M, N46C-N108C, N46C-N108H, N46L-N108Y, N46L-N108Q, N46L-N108D, N46L-N108M, N46L-N108H, I49A-N108Y Three point mutations: I49A-V82T-N108Y, I49A-V82G1-N108Y, I49G-V82T-N108Y, I49G-V82G-N108Y, A48G-V82G-N108Y, A48G-I49G-N108Y, V28G-V82G-N108Y, V28G-V82G-N108H, V28G-I49A-N108Y, V28G-I49A-N108H, V28G-I49G-N108H, V28G-A48G-N108Y, V28G-A48G-N108H; Four point mutations: V28G-A48G-I49A-N108Y, V28G-A48G-I49G-N108Y, V28G-A48G-V82T-N108Y, V28G-A48G-V82G-N108Y, V28G-I49A-V82T-N108Y, V28G-I49A-V82G-N1 08Y, V28G-I49G-V82T-N108Y, V28G-I49G-V82G-N108Y, A48G-I49A-V82T-N1 08Y, A48G-I49A-V82G-N108Y, A48G-I49G-V82T-N108Y, A48G-I49G-V82G-N10 8Y, V28G-A48G-I49A-N108H, V28G-A48G-I49G-N108H, V28G-A48G-V82T-N10 8H, V28G-A48G-V82G-N108H, V28G-I49A-V82T-N108H, V28G-I49A-V82G-N108 H. V28G-I49G-V82T-N108H, V28G-I49G-V82G-N108H, A48G-I49A-V82T-N108H , A48G-I49A-V82G-N108H, A48G-I49G-V82T-N108H, A48G-I49G-V82G-N108H. Five point mutations: V28G-A48G-I49A-V82T-N108Y, V28G-A48G-I49 G-V82T-N108Y, V28G-A48G-I49A-V82G-N108Y, V28G-A48G-I49G-V82G-N108Y, V28G-A48G-I49G-V82G-N108Y, V28G-A48G-I49A-V82T-N108H, V28G-A48G-I49G-V82T-N108H, V28G-A48G-I49A-V82G-N108H, V28G-A48G-I49G-V82G-N108H.

14. Application of base editor ACBE, characterized in that: The base editor ACBE mediates A·T--G·C and C·G--T·A mutations; Base editor ACBE refers to a fusion protein formed by placing the deaminase after the amino acid mutation at the 108th amino acid position in TadA-8e at the N-terminus and the 1249th fusion site of nSpCas9. This type of fusion protein has the ability to mediate A·T--G·C and C·G--T·A mutations.

15. A mutant TadA-8e protein, characterized in that: The mutant protein is a non-natural protein, and the mutant TadA-8e protein refers to a deaminase after the amino acid at the 108th amino acid position in TadA-8e is mutated; Preferably, the mutant TadA-8e refers to a deaminase obtained by performing the following single-point mutation on the amino acid in TadA-8e: N108H, N108M, N108C, N108D, N108F, N108Q, N108S, N108Y, N108V, N108I, N108L, N108A, N108T, N108R; Alternatively, the mutant TadA-8e refers to a deaminase obtained by performing the following double-point mutations on the amino acids in TadA-8e: V28G-N108Y, V28G-N108C, V28G-N108H, N46P-N108Y, N46P-N108S, N46P-N108Q, N46P-N108D, N46P-N108C, N4 6P-N108H, N46C-N108Y, N46C-N108S, N46C-N108Q, N46C-N108M, N46C-N108C, N46C-N108H, N46L-N108Y, N46L- N108Q, N46L-N108D, N46L-N108M, N46L-N108H, I49A-N108Y, V28W-N108H, N46P-N108M, A48G-N108H, I49A-N10 8H, I49G-N108H, I49G-N108Y, V82G-N108Y, V82T-N108H, V82T-N108C, F84M-N108H, F84M-N108M, F84M-N108Q; Alternatively, the mutant TadA-8e refers to a deaminase obtained by performing the following three point mutations on the amino acids in TadA-8e: I49A-V82T-N108Y, I49G-V82T-N108Y, I49G-V82G-N108Y, A48G-V82G-N1 08Y, A48G-I49G-N108Y, V28G-V82G-N108Y, V28G-V82G-N108H, V28G-I49 A-N108Y, V28G-I49A-N108H, V28G-I49G-N108H, V28G-A48G-N108Y, V28G -A48G-N108H, V28G-I49G-N108Y, I49G-V82G-N108H, I49G-V82T-N108H; Or, the mutant TadA-8e refers to a deaminase obtained by performing the following four mutations on the amino acids in TadA-8e: V28G-A48G-I49A-N108Y, V28G-A48G-I49G-N108Y, V28G-A48G-V82T-N108Y, V28G-A48G-V82G-N108Y, V28G-I49A -V82T-N108Y, V28G-I49A-V82G-N108Y, V28G-I49G-V82T-N108Y, V28G-I49G-V82G -N108Y, A48G-I49A-V82T-N108Y, A48G-I49A-V82G-N108Y, A48G-I49G-V82T-N108Y , A48G-I49G-V82G-N108Y, V28G-A48G-I49A-N108H, V28G-A48G-I49G-N108H, V28G -A48G-V82T-N108H, V28G-A48G-V82G-N108H, V28G-I49A-V82T-N108H, V28G-I49A- V82G-N108H, V28G-I49G-V82T-N108H, V28G-I49G-V82G-N108H, A48G-I49A-V82T- N108H, A48G-I49A-V82G-N108H, A48G-I49G-V82T-N108H, A48G-I49G-V82G-N108H; Or, the mutant TadA-8e refers to the deaminase obtained after the following five-point mutations in amino acids in TadA-8e: V28G-A48G-I49A-V82T-N108Y, V28G-A48G-I49 G-V82T-N108Y, V28G-A48G-I49A-V82G-N108Y, V28G-A48G-I49G-V82G-N108Y, V28G-A48G-I49G-V82G-N108Y, V28G-A48G-I49A-V82T-N108H, V28G-A48G-I49G-V82T-N108H, V28G-A48G-I49A-V82G-N108H, V28G-A48G-I49G-V82G-N108H.

16. A polynucleotide, characterized in that Encoding the fusion protein in the base editor according to any one of claims 1 to 9.

17. A polynucleotide, characterized in that Encodes the protein according to claim 15.

18. A carrier, characterized in that Containing the polynucleotide according to claim 17.

19. A host cell, characterized in that Containing the base editor according to any one of claims 1 to 9, or containing the protein according to claim 15, or containing the vector according to claim 18.

Images