MiR-144-3p inhibitor for relieving fish intestinal injury induced by oxidized fish oil and application of miR-144-3p inhibitor

Abstract

The invention discloses a miR-144-3p inhibitor for relieving fish intestinal injury induced by oxidized fish oil and application, and belongs to the technical field of aquatic animal nutrition physiological regulation and control. The miR-144-3p inhibitor is injected into the intraperitoneal cavity of megalobrama amblycephala, transcription of an oxidative stress core regulatory element Nrf2 is up-regulated, overexpression of autophagy and apoptosis related genes induced by intake of oxidized fish oil is inhibited, damage of an intestinal tight junction structure is improved, and the active oxygen level and the autophagy and apoptosis level of intestinal cells are reduced. The method can quickly, efficiently and specifically relieve intestinal barrier injury, oxidative stress and intestinal cell apoptosis induced by oxidative rancidity of freshwater fish feed grease and the like, and healthy and efficient culture of freshwater fish is achieved.

Description

Technical Field

[0001] The present invention relates to a method for activating freshwater fish Nrf2 and downstream damage repair genes by using miRNA inhibitors to alleviate intestinal damage induced by oxidized fish oil, in particular to a miR-144-3p inhibitor for alleviating fish intestinal damage induced by oxidized fish oil and its application, belonging to the technical field of nutritional physiological regulation of aquatic animals. Background Art

[0002] Fat is one of the main energy substances for fish, which can maintain their normal growth, development and reproduction, and reduce the use of feed protein. However, feed fat, especially fish oil rich in highly unsaturated fatty acids DHA and EPA, is prone to oxidation and rancidity during storage and processing. The intestine is the first tissue exposed to potentially harmful substances in the diet and is also the tissue most susceptible to adverse factors. The intake of oxidized oils can cause damage to the mechanical barrier of the fish intestine and increase mucosal permeability, reduce the intestine's ability to digest and absorb feed, and destroy the intestinal immune barrier's ability to respond to and clear exogenous toxic substances, thereby leading to decreased fish growth performance. The toxic side effects of feed fat oxidation have become one of the problems that seriously plague the sustainable and healthy development of the aquaculture industry.

[0003] Megalobrama amblycephala is one of the main freshwater farmed fish in my country, with an annual output of about 700,000 tons. The body shape and physical characteristics of Megalobrama amblycephala make it an ideal material for studying tissue oxidative damage after freshwater fish ingest oxidized fats. Our team's previous studies found that fish oil oxidative rancidity can cause oxidative stress in the intestine of Megalobrama amblycephala. Through high-throughput sequencing, we screened for differential miRNAs that cause oxidative stress damage in the intestine of Megalobrama amblycephala. We further confirmed that the target gene of intestinal miR-144 is Nrf2 through dual luciferase reporter gene assay. We also analyzed that the Nrf2 signaling pathway plays an important role in oxidative stress damage in the intestine of Megalobrama amblycephala. However, research targeting miR-144 to regulate tissue oxidative damage caused by lipid oxidation is very scarce.

[0004] The present invention conducts high-throughput sequencing of miRNA on intestinal tissues after the intestinal oxidative stress of the amblycephalus ingesting oxidized fish oil in the early stage, and confirms that the target gene of miR-144 is Nrf2 through dual luciferase reporter assay. Further, the inhibitor of miR-144-3p is chemically synthesized to intervene in the relevant signal pathway, so as to achieve the purpose of alleviating the intestinal damage of fish induced by oxidized oil. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a miR-144-3p inhibitor for alleviating fish intestinal damage induced by oxidized fish oil and its application.

[0006] According to the technical solution provided by the present invention, a miR-144-3p inhibitor is provided for alleviating fish intestinal damage induced by oxidized fish oil, wherein the miR-144-3p inhibitor is chemically synthesized.

[0007] The gene sequence of miR-144-3p is shown in sequence 1: UACAGUAUAGAUGAUGUACU. The gene sequence of miR-144-3p inhibitor is shown in sequence 2: AGUACAUCAUCUAUACUGUA. The target gene of miR-144-3p is Nrf2, and the specific sequence is shown in sequence 3.

[0008] The specific sequence of sequence 3 is as follows:

[0009] TGACTGCTTACCTTACGGTTGACCGGTGGCTCTCCTGGCTGTGCCTCGAAA

[0010] CAGACTGAATGTATCGCTGGACCCCCTCTCTCCCGTCGCTAAAGGAATGTC

[0011] GACGTGGAGCTGCCAAACGTGAACGTGTAGGGTACTCATGAACGCGCTCG

[0012] TCGGAGAGTCTTCTCTGAGCTCGTACCCTTGGCATAGGTAGAGTGGGCAT

[0013] GGCGCTGATCACAGCTACCTGTCACATTTCGTGGCGTGTTGAAAGCTGAG

[0014] GGGGAAGAAATTCTTGAAAGACGAAGCCTGCAGTGTTTGATTCATCTAAA

[0015] AGCTGTTTAAATCTATATGCATTTCGTTGTACTTTAAAATGCAATGTAGCT

[0016] ACATTTGTGCACGTTTAATATTTGGAGTGGTTCATCCTCATAAGATTTTATTT

[0017] GATCATAAAACTTATATTAAATTCTATTTTAGGTAGCCTACAGTTGTAGAT

[0018] TCTAAAAAGTAAAATTGAGTAGCAATTTTTTATGTTAAAAGTTTTTTATGTA

[0019] AAAGTTTACATGTTAATGAGGTAAACCTATGTGTTTTTCTTGTGCTTTTCTC

[0020] AGGATAAATTTGATCAACATCAACCATTTCATTTTTGATTTATAAGTAAAG

[0021] AAGGTTGTAAAGACATGTTATAAAGCGATGAATGCATGTCTCCTTTGAGTT

[0022] TCTTTGAATCTGCTGTTTGATTGGCTGATGGATTGTCCCTGAATTTGTTATC

[0023] TTCTGTTTGATTGGCTGATGGATATTGTGGGCGAGTCCTGCCTGTATTTTGG

[0024] GATCTGTTACACACGCGTGTCGTCAGATTTGATCCAGAAATATGCTTTGCG

[0025] TCTGCTTGAATTAGTCCTTCATCAGACTTTTCATCAGCTAAGAGACATGGA

[0026] CGACCCTTCAGCTCAGTTTCAACATGATTCGGATTTGATTGATATTTTTATG

[0027] GAGGCAGGATGTCGATTTGGGGGTGGAGCGAGAGATCTTGATGGATGCC

[0028] TTCGGCAGAAGGAGGAGACCATGAGAGCAAGAGAAAGAGAGTTGAAAAG

[0029] CGAGAGAGAGCTTGAAAGATAATGCAAAGGTTACAGAAACTTGACAAA

[0030] GAGACCGGAGAGTTTTTGCCTAGTCCTTCATCTGTAAACTCCCAGGCTGTG

[0031] CCCTTCTCAGAGACGTTGCCCTCGAGAGTGTCTACTCAGCATTCACCCGTT

[0032] ACCCAGAATCCCCTGCTATCTGCCCTGCTATTCTCCAAGTCTCAGAAGCCT

[0033] CCTTCTCAGGAGCAGGCTTTTAGTGAACTGCTGTCACTGCCAGACTTACAG

[0034] TATTATCTGGATGTCTTGGAGTATGAGGGCTCAAATTTGCCCTTAGAGGAT

[0035] ATCACTGAAATCTGCCACCACAACCTGCCAGAGCCACAGAGGGAAAACTC

[0036] AACAGATGAATTATGTGACATCGGTGAACTCACACAGACAATATCAGACT

[0037] CTTTTGAAGTTGCTCAGCCTTTATCATGCATGCCCTCTGACCCATTAGAAG

[0038] TCTTGGAAACATGCATACAGACATTCTCAGATCCAGGCAATCCTACACCTT

[0039] CACCTTCAAACACAATTTACAGCTGTAGTAGCCCAGAGAATCAAGGGATT

[0040] TTTACTAAATGCCAAGCAAATTCAAGCGATTCGTCCTTGAGTGAGTTTTGC

[0041] CCTGATATAAATACATATACCATCAATACTAGCACACTCAGTGAACCAGA

[0042] ACAATTAAATAGTGTGCCTGGAAGGAAAGCTCCACAAATGCTTTCACAAT

[0043] TTGAGGAGCATCGCATTCTTCTGGGTTTTGATGACTCTGCTTCTGTTGGCTC

[0044] TGTGGATTTAGAGATGTCCCTCTATGCGGCTGACACCGTAAGCAACGGCC

[0045] GATCAGACAAGGATGAGCTGGAAAGCATCCAATCAGATTACACCGATCTG

[0046] CTGTCTTTATCTCTCCACTCTGAGACAGTAGAGGCAACACTGTATGAAACT

[0047] GCTACGTATTCACCACACCAAACTCAAAACGAATCAGCGCCTGAATATTC

[0048] ACAAAG.

[0049] The expression of target gene Nrf2 and other related genes was detected by fluorescence quantitative method. The detailed steps of fluorescence quantitative method are as follows:

[0050] Using TB Premix Ex Taq TM Ⅱ (Tli RNaseH Plus) (Novozyme Biotech Co., Ltd., RR820A), the primers used were synthesized by Shanghai Jierui Biotechnology Co., Ltd. (Shanghai, China). The reaction system was: 10 μL TB Premix Ex Taq TM Ⅱ (Tli RNaseH Plus) + 0.8μL PCR Forward Primer (10μM) + 0.8μL PCR Reverse Primer (10μM) + 2μL cDNA template + 6.4μL DEPC water. Fluorescence quantification was performed using CFX96 Real-Time PCR Detetion System (Bio-Rad, California, USA), and the reaction conditions were as follows: first step: 95℃30s, second step PCR reaction: 95℃5s, 60℃30s, 40 cycles, third step: melting curve, 95℃10s, then heating from 65℃ every 5s by 0.5℃ until 95℃.

[0051] The upstream and downstream primers of Nrf2 gene are shown in Sequence 4 and Sequence 5.

[0052] Sequence 4:GGGGAAGTCCTTGAACGGAG;

[0053] Sequence 5: AACCAGCGGGAATATCTCGG.

[0054] The upstream and downstream primers of the MLCK gene are shown in Sequence 6 and Sequence 7. Sequence 6: GTTCTGGAGGGCATTGGCTAT;

[0055] Sequence 7: GTCACAGATTTTGATGTCTTCCC.

[0056] The upstream and downstream primers of the occludin gene are shown in SEQ ID NO:8 and SEQ ID NO:9.

[0057] Sequence 8: TATCTGTATCACTACTGCGTCG;

[0058] Sequence 9: CATTCACCCAATCCTCCA.

[0059] The upstream and downstream primers of ZO-1 gene are shown in SEQ ID NO: 10 and SEQ ID NO: 11. SEQ ID NO: 10: GCATGTGCATTTTACCTGGCT;

[0060] Sequence 11: TGATAGCTTTTGGCGTCAGC.

[0061] The upstream and downstream primers of Claudin-7α gene are shown in SEQ ID NO: 12 and SEQ ID NO: 13. SEQ ID NO: 12: ACTTACCAGGGACTGTGGATGT;

[0062] Sequence 13: CACTATCATCAAAGCACGGGT.

[0063] The upstream and downstream primers of TNF-α gene are shown in SEQ ID NO:14 and SEQ ID NO:15.

[0064] Sequence 14: CGACGCTATACGGACCTTCG;

[0065] Sequence 15: AAGACAGGAGCCAAGGAGAAC.

[0066] The upstream and downstream primers of NF-κB gene are shown in SEQ ID NO:16 and SEQ ID NO:17.

[0067] Sequence 16: AGTCCGATCCATCCGCACTA;

[0068] Sequence 17: ACTGGAGCCGGTCATTTCAG.

[0069] The upstream and downstream primers of IL-1β gene are shown in SEQ ID NO: 18 and SEQ ID NO: 19. SEQ ID NO: 18: TCGGAGCATTCTTCCAGCAT;

[0070] Sequence 19: TCATCTTGACCGAGGTGGTG.

[0071] The upstream and downstream primers of IL-10 gene are shown in SEQ ID NO: 20 and SEQ ID NO: 21. SEQ ID NO: 20: GTGTTTTCGGGTGCAAGTGG;

[0072] Sequence 21: ATGAACGAGATCCTGCGCTT.

[0073] The upstream and downstream primers of the GPx gene are shown in Sequence 22 and Sequence 23. Sequence 22: TTTGAGGAACGACCACCAGG;

[0074] Sequence 23: CGAACTGATTGCAGGGGACT.

[0075] The upstream and downstream primers of the GSS gene are shown in SEQ ID NO:24 and SEQ ID NO:25.

[0076] Sequence 24: CCGTTCACGTTGTTTCCCAC;

[0077] Sequence 25: AGAAAGGTGGGGTCCTGACT.

[0078] The upstream and downstream primers of the P62 gene are shown in SEQ ID NO:26 and SEQ ID NO:27.

[0079] Sequence 26: CACTTGAGGTGCTGCTCTGA;

[0080] Sequence 27: TTAACTTCGGACAGACGGGC.

[0081] The upstream and downstream primers of the GRP78 gene are shown in SEQ ID NO:28 and SEQ ID NO:29.

[0082] Sequence 28: CACGCCCTTGAGATTACTG;

[0083] Sequence 29: GCTGGATGTGAGGCTTGTT.

[0084] The upstream and downstream primers of the ATG5 gene are shown in SEQ ID NO:30 and SEQ ID NO:31.

[0085] Sequence 30: TGTTGTTTGACCTCCACGCT;

[0086] Sequence 31: CGCATCGGCCTCTTTAATGC.

[0087] The upstream and downstream primers of ATG8 gene are shown in SEQ ID NO:32 and SEQ ID NO:33.

[0088] Sequence 32: CTCGGCTCTCAGGTGGATTC;

[0089] Sequence 33: GCTGTGTGTGAGAGAAGCCT.

[0090] The upstream and downstream primers of HSP27 gene are shown in SEQ ID NO:34 and SEQ ID NO:35.

[0091] Sequence 34: CCCGACATGCCCTCCTTAAT;

[0092] Sequence 35: CACCACCCCATCTTTGGTCT.

[0093] The upstream and downstream primers of Caspase-3 gene are shown in SEQ ID NO:36 and SEQ ID NO:37.

[0094] Sequence 36: AGATGGTGTGGGAGATGGAG;

[0095] Sequence 37: CCAGTTGCTTGCCGTATTTT.

[0096] The upstream and downstream primers of Caspase-8 gene are shown in SEQ ID NO:38 and SEQ ID NO:39.

[0097] Sequence 38: TTGTCTGCTGTGTCCTCTCG;

[0098] Sequence 39: ATCGTTCCCTTGTCCATCTG.

[0099] The internal reference gene is Megalobrama amblycephala β-actin, and the upstream and downstream primers are shown in SEQ ID NO: 40 and SEQ ID NO: 41.

[0100] Sequence 40: TCGTCCACCGCAAATGCTTCTA;

[0101] Sequence 41: CCGTCACCTTCACCGTTCCAGT.

[0102] The miR-144-3p is highly expressed in the intestine after the amblycephalic bream ingests oxidized oil. After intraperitoneal injection of miR-144-3p inhibitor, the transcription level of intestinal miR-144-3p was significantly decreased, and the expression of its target gene Nrf2 and downstream inflammation-related genes (NF-κB, TNF-α, IL-1β), autophagy-related genes (P62, ATG5, ATG8, GRP78), and apoptosis-related genes (HSP27, Caspase-3, Caspase-8) was significantly downregulated, and the expression of intestinal epithelial cell barrier factor-related genes (Occludin, Claudin-7, ZO-1), antioxidant factors (Gpx, GSS), and anti-inflammatory related genes (IL-10) was significantly upregulated.

[0103] Fluorescence quantitative PCR was used to detect the expression of miR-144-3p in the intestinal tissue of Megalobrama amblycephala. The main steps are:

[0104] (1) Extracting total RNA from the intestinal tissue of Megalobrama amblycephala;

[0105] (2) reverse transcription into cDNA using the stem-loop method, the reverse transcription primer is shown in SEQ ID NO:42;

[0106] (3) A fluorescent quantitative PCR kit was used to amplify miR-144-3p. The specific steps of the fluorescent quantitative method are as follows: Use TB Premix Ex Taq TM Ⅱ (Tli RNaseH Plus) (Novozyme, Nanjing, China, RR820A), the primers used were synthesized by Shanghai Jierui Biotechnology Co., Ltd. (Shanghai, China). The reaction system was: 10 μL TB Premix Ex Taq TM Ⅱ (Tli RNaseH Plus) + 0.8μL PCR Forward Primer (10μM) + 0.8μL PCR Reverse Primer (10μM) + 2μL cDNA template + 6.4μL DEPC water. Fluorescence quantification was performed using CFX96 Real-Time PCR Detection System (Bio-Rad, California, USA), and the reaction conditions were as follows: first step: 95℃30s, second step PCR reaction: 95℃5s, 60℃30s, 40 cycles, third step: melting curve, 95℃10s, then heating from 65℃ every 5s by 0.5℃ until 95℃.

[0107] The upstream and downstream primers of miR-144-3p gene are shown in SEQ ID NO: 43 and SEQ ID NO: 44:

[0108] Sequence 42:

[0109] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGTA CAT;

[0110] Sequence 43: CGCGCGCGACAGTATAGATG;

[0111] Sequence 44: AGTGCAGGGTCCGAGGTATT.

[0112] The present invention also discloses the use of a miR-144-3p inhibitor for alleviating fish intestinal damage induced by oxidized fish oil, wherein the chemically synthesized miR-144-3p inhibitor is injected into the abdominal cavity or tail vein of a grouper that has ingested oxidized fish oil, with an injection dose of 1-3 nmol / g fish weight, and an injection cycle of 5-7 days. After 2-5 injection cycles, the grouper's intestinal villus length decreases, the muscle layer thickness decreases, the tight junction structure between epithelial cells loosens, the intestinal cell ROS content increases, and the cell autophagy and apoptosis and other damage symptoms can be significantly alleviated.

[0113] The dihydroethidium (DHE) fluorescent probe method was used to detect the cellular ROS content, and transmission electron microscopy (Hitachi H-7650, Tokyo, Japan) was used to observe mitochondrial damage, the number of autophagosomes, and the tight junction structure between epithelial cells.

[0114] The beneficial effects of the present invention are as follows: the present invention provides a miRNA inhibitor and application method that can effectively alleviate intestinal oxidative damage of freshwater fish induced by intake of oxidized oil. After 2-5 cycles of intraperitoneal or caudal vein injection of the novel miR-144-3p inhibitor of the present invention into the amblycephalic bream that ingested oxidized fish oil, the symptoms of damage induced by ingestion of oxidized fish oil, such as decreased intestinal villus length, thinning of muscular layer thickness, loosening of tight junction structure between intestinal epithelial cells, increased ROS content in intestinal cells, autophagy and apoptosis of intestinal cells, can be significantly alleviated. The novel miR-144-3p inhibitor has strong specificity, high inhibition efficiency, and rapid effect; the miR-144-3p inhibitor has an extremely small molecular weight, is safe and easy to degrade, and has low pollution. BRIEF DESCRIPTION OF THE DRAWINGS

[0115] Figure 1 This is a graph showing the effects of the injection of miR-144-3p analogs and inhibitors on the expression of miR-144-3p and Nrf2 in the intestine of Megalobrama amblycephala.

[0116] Figure 2-1 This is a graph showing the effect of injecting miR-144-3p analogs and inhibitors on the level of reactive oxygen species (ROS) in the intestinal cells of Megalobrama amblycephala using the DHE fluorescent probe method.

[0117] Figure 2-2 This is a graph showing the effect of the injection of miR-144-3p analogs and inhibitors on the average fluorescence intensity value of reactive oxygen species (ROS) in the intestinal cells of Megalobrama amblycephala detected by the DHE fluorescent probe method in the present invention.

[0118] Figure 2-3 This is a diagram showing the effect of the injection of miR-144-3p analogs and inhibitors on the expression of antioxidant genes in the intestine of Megalobrama amblycephala.

[0119] Figure 3-1This is a diagram showing the effects of the injection of miR-144-3p analogs and inhibitors on intestinal tissue sections of Megalobrama amblycephala according to the present invention.

[0120] Figure 3-2 This is a graph showing the effects of the injection of miR-144-3p analogs and inhibitors on the intestinal morphological parameters of Megalobrama amblycephala.

[0121] Figure 4-1 This is a diagram showing the effect of the injection of miR-144-3p analogs and inhibitors on the tight junction structure of the intestine of Megalobrama amblycephala according to the present invention.

[0122] Figure 4-2 This is a diagram showing the effect of the injection of miR-144-3p analogs and inhibitors on the expression of tight junction protein genes in the intestine of Megalobrama amblycephala.

[0123] Figure 5 This is a graph showing the effects of the injection of miR-144-3p analogs and inhibitors on the expression of genes related to intestinal inflammation in Megalobrama amblycephala.

[0124] Figure 6 This is a graph showing the effects of the injection of miR-144-3p analogs and inhibitors on the expression of autophagy-related genes in the intestine of Megalobrama amblycephala.

[0125] Figure 7 This is a graph showing the effect of the injection of miR-144-3p analogs and inhibitors on the expression of apoptosis-related genes in the intestine of Megalobrama amblycephala.

[0126] Figure 8 This is a diagram showing the effect of the injection of miR-144-3p analogs and inhibitors on the ultrastructure of autophagosomes in the intestinal cells of Megalobrama amblycephala. DETAILED DESCRIPTION

[0127] The substantive content of the present invention is further illustrated by the following examples, but the contents described in the examples of the present invention are only used to illustrate the present invention, and should not and will not limit the present invention described in detail in the claims. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. The methods in the embodiments are conventional methods unless otherwise specified, and the reagents used are conventionally sold reagents or reagents prepared according to conventional methods unless otherwise specified.

[0128] A synthesis of a miR-144-3p inhibitor for alleviating oxidized fish oil-induced fish intestinal damage comprises the following steps:

[0129] 1. Synthesize sequence-specific miR-144-3p and its inhibitors based on the nucleotide sequence of miR-144-3p screened by high-throughput miRNA sequencing;

[0130] The miR-144-3p gene sequence is shown in Sequence 1:

[0131] Sequence 1: UACAGUAUAGAUGAUGUACU.

[0132] The gene sequence of miR-144-3p inhibitor is shown in SEQ ID NO:

[0133] Sequence 2:AGUACAUCAUCUAUACUGUA.

[0134] The target gene of miR-144-3p is Nrf2, and the specific sequence is shown in Sequence 3:

[0135] The specific sequence of sequence 3 is as follows:

[0136] TGACTGCTTACCTTACGGTTGACCGGTGGCTCTCCTGGCTGTGCCTCGAAA

[0137] CAGACTGAATGTATCGCTGGACCCCCTCTCTCCCGTCGCTAAAGGAATGTC

[0138] GACGTGGAGCTGCCAAACGTGAACGTGTAGGGTACTCATGAACGCGCTCG

[0139] TCGGAGAGTCTTCTCTGAGCTCGTACCCTTGGCATAGGTAGAGTGGGCAT

[0140] GGCGCTGATCACAGCTACCTGTCACATTTCGTGGCGTGTTGAAAGCTGAG

[0141] GGGGAAGAAATTCTTGAAAGACGAAGCCTGCAGTGTTTGATTCATCTAAA

[0142] AGCTGTTTAAATCTATATGCATTTCGTTGTACTTTAAAATGCAATGTAGCT

[0143] ACATTTGTGCACGTTTAATATTTGGAGTGGTTCATCCTCATAAGATTTTATTT

[0144] GATCATAAAACTTATATTAAATTCTATTTTAGGTAGCCTACAGTTGTAGAT

[0145] TCTAAAAAGTAAAATTGAGTAGCAATTTTTTATGTTAAAAGTTTTTTATGTA

[0146] AAAGTTTACATGTTAATGAGGTAAACCTATGTGTTTTTCTTGTGCTTTTCTC

[0147] AGGATAAATTTGATCAACATCAACCATTTCATTTTTGATTTATAAGTAAAG

[0148] AAGGTTGTAAAGACATGTTATAAAGCGATGAATGCATGTCTCCTTTGAGTT

[0149] TCTTTGAATCTGCTGTTTGATTGGCTGATGGATTGTCCCTGAATTTGTTATC

[0150] TTCTGTTTGATTGGCTGATGGATATTGTGGGCGAGTCCTGCCTGTATTTTGG

[0151] GATCTGTTACACACGCGTGTCGTCAGATTTGATCCAGAAATATGCTTTGCG

[0152] TCTGCTTGAATTAGTCCTTCATCAGACTTTTCATCAGCTAAGAGACATGGA

[0153] CGACCCTTCAGCTCAGTTTCAACATGATTCGGATTTGATTGATATTTTTATG

[0154] GAGGCAGGATGTCGATTTGGGGGTGGAGCGAGAGATCTTGATGGATGCC

[0155] TTCGGCAGAAGGAGGAGACCATGAGAGCAAGAGAAAGAGAGTTGAAAAG

[0156] CGAGAGAGAGCTTGAAAGATAATGCAAAGGTTACAGAAACTTGACAAA

[0157] GAGACCGGAGAGTTTTTGCCTAGTCCTTCATCTGTAAACTCCCAGGCTGTG

[0158] CCCTTCTCAGAGACGTTGCCCTCGAGAGTGTCTACTCAGCATTCACCCGTT

[0159] ACCCAGAATCCCCTGCTATCTGCCCTGCTATTCTCCAAGTCTCAGAAGCCT

[0160] CCTTCTCAGGAGCAGGCTTTTAGTGAACTGCTGTCACTGCCAGACTTACAG

[0161] TATTATCTGGATGTCTTGGAGTATGAGGGCTCAAATTTGCCCTTAGAGGAT

[0162] ATCACTGAAATCTGCCACCACAACCTGCCAGAGCCACAGAGGGAAAACTC

[0163] AACAGATGAATTATGTGACATCGGTGAACTCACACAGACAATATCAGACT

[0164] CTTTTGAAGTTGCTCAGCCTTTATCATGCATGCCCTCTGACCCATTAGAAG

[0165] TCTTGGAAACATGCATACAGACATTCTCAGATCCAGGCAATCCTACACCTT

[0166] CACCTTCAAACACAATTTACAGCTGTAGTAGCCCAGAGAATCAAGGGATT

[0167] TTTACTAAATGCCAAGCAAATTCAAGCGATTCGTCCTTGAGTGAGTTTTGC

[0168] CCTGATATAAATACATATACCATCAATACTAGCACACTCAGTGAACCAGA

[0169] ACAATTAAATAGTGTGCCTGGAAGGAAAGCTCCACAAATGCTTTCACAAT

[0170] TTGAGGAGCATCGCATTCTTCTGGGTTTTGATGACTCTGCTTCTGTTGGCTC

[0171] TGTGGATTTAGAGATGTCCCTCTATGCGGCTGACACCGTAAGCAACGGCC

[0172] GATCAGACAAGGATGAGCTGGAAAGCATCCAATCAGATTACACCGATCTG

[0173] CTGTCTTTATCTCTCCACTCTGAGACAGTAGAGGCAACACTGTATGAAACT

[0174] GCTACGTATTCACCACACCAAACTCAAAACGAATCAGCGCCTGAATATTC

[0175] ACAAAG.

[0176] The upstream and downstream primers of the Nrf2 gene are shown in Sequence 4 and Sequence 5:

[0177] Sequence 4:GGGGAAGTCCTTGAACGGAG;

[0178] Sequence 5: AACCAGCGGGAATATCTCGG.

[0179] 2. The expression of miR-144-3p in the intestinal tissue of Megalobrama amblycephala was detected by fluorescence quantitative PCR. The main steps were as follows:

[0180] (1) The chemically synthesized miR-144-3p inhibitor was injected into the abdominal cavity of Megalobrama amblycephala, and total RNA from the intestinal tissue of Megalobrama amblycephala was extracted 5-7 days later;

[0181] The specific steps are as follows: 50-100 mg of intestinal tissue sample was placed in a 2 mL round-bottom centrifuge tube with sterilized small steel balls in advance, and 1 mL RNAiso Plus (Takara, Dalian, China) was added, and the mixture was homogenized at 50 Hz for 15 seconds, twice. After homogenization, 200 μL of chloroform (Shanghai Lingfeng Chemical Reagent Co., Ltd.) was added, the tube mouth was tightly capped, and the mixture was shaken vigorously for 15 seconds and allowed to stand at room temperature for 15 minutes. Centrifuge at 4°C, 12,000 rpm for 15 minutes, and 500 μL of the upper aqueous phase was carefully transferred to another 1.5 mL centrifuge tube. 500 μL of isopropanol (Shanghai McLean Biochemical Technology Co., Ltd.) was added to the 1.5 mL centrifuge tube, and the mixture was fully mixed, allowed to stand at room temperature for 10 minutes, and centrifuged at 4°C, 12,000 rpm for 10 minutes. Aspirate the isopropanol, add 1 mL of ice-cold 75% ethanol (Shanghai MacLean Biochemical Technology Co., Ltd.), wash the precipitate, centrifuge at 4°C, 12000 rpm for 10 min, discard the supernatant, repeat 1-2 times, aspirate the residual ethanol, and air-dry the RNA precipitate at room temperature. Add 20-50 μL of DEPC water according to the volume of the precipitate to dissolve the precipitate, measure the OD value with Nanodrop 2000, and finally adjust the RNA concentration to 500 ng / μL.

[0182] (2) using the stem-loop method to reverse transcribe the total RNA of the intestinal tissue of Megalobrama amblycephala extracted in step (1) into cDNA, and the reverse transcription primer is shown in SEQ ID NO: 42;

[0183] The steps of stem-loop reverse transcription are as follows: miRNA 1st Strand cDNA Synthesis Kit (by stem-loop) (Novozyme Biotech Co., Ltd., Nanjing, China, MR101) was used for miRNA reverse transcription, which contained reagents 5×gDNA Wiper Mix, 10×RT Mix, HiScriptⅡEnzyme Mix, and RNase-free ddH2O. The first step of genomic DNA removal reaction system was: 2μL total RNA + 2μL 5×gDNA Wiper Mix + 6μL RNase-free ddH2O. Incubate at 42℃ for 2min. The second step of first-strand cDNA synthesis reaction system was: 10μL of the previous step mixture + 1μL Stem-loop primer (Shanghai Jierui Bioengineering Co., Ltd.) + 2μL 10×RT Mix + 2μL HiScriptⅡEnzyme Mix + 5μL RNase-free ddH2O. Synthesis was performed under the reaction conditions of 25℃ for 5min, 50℃ for 15min, and 85℃ for 5min.

[0184] Sequence 42:

[0185] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGTA CAT;

[0186] (3) using a fluorescent quantitative PCR kit to amplify miR-144-3p from the cDNA reverse transcribed in step (2);

[0187] The upstream and downstream primers of miR-144-3p gene are shown in SEQ ID NO: 43 and SEQ ID NO: 44:

[0188] Sequence 43: CGCGCGCGACAGTATAGATG;

[0189] Sequence 44: AGTGCAGGGTCCGAGGTATT.

[0190] The results showed that injecting the chemically synthesized miR-144-3p inhibitor into the abdominal cavity of the bighead carp reduced the expression of intestinal miR-144-3p within 5-7 days, promoted the expression of Nrf2 and intestinal tight junction proteins, and improved the intestinal barrier damage, increased reactive oxygen species, and autophagy and apoptosis of intestinal epithelial cells induced by oxidized fish oil.

[0191] An application of a miR-144-3p inhibitor for alleviating fish intestinal damage induced by oxidized fish oil, comprising:

[0192] 1. Preparation of oxidized fish oil

[0193] Refined fish oil was purchased from Huaiyin Dabeinong Feed Co., Ltd. in Huai'an City. Fe was added according to the proportion of refined fish oil. 2+ (30mg kg -1 ,FeSO4·7H2O)(Shanghai McLean Biochemical Technology Co., Ltd.), Cu 2+ (15mg·kg -1 ,CuSO4·5H2O) (Shanghai McLean Biochemical Technology Co., Ltd.), H2O2 (600 mg·kg -1 Oxidized fish oil was prepared by mixing 1% 2-hydroxy-1-nitropropene (2-hydroxy-1-nitropropene) (30%) (Shanghai McLean Biochemical Technology Co., Ltd.) and water (0.3%). The mixture was thoroughly mixed and oxidized at 80°C. The hydrogen peroxide level was monitored every 8 hours. The final peroxide value reached 323 mmol kg -1 After that, add 150mg·kg -1 Ethoxyquinoline (Shanghai MacLean Biochemical Technology Co., Ltd.) blocked further oxidation and prepared oxidized fish oil.

[0194] 2. Breeding and management of experimental fish

[0195] The experimental grouper was provided by the Freshwater Fisheries Research Center of the Chinese Academy of Fishery Sciences. 90 healthy grouper with the same size and weight (initial weight of individuals: 7.58±0.09 g) were selected and kept for one week before being transferred into nine indoor temperature-controlled circulating water aquaculture tanks (size: ), randomly divided into 3 groups, 3 replicates in each group, and the breeding barrels used in each group of experiments were randomly dispersed in space to avoid errors caused by environmental factors. During the breeding period, the experimental diet was fed to apparent satiation (about 3% of body weight, and the intake of oxidized fish oil was about 1.8‰ of body weight) every day, and fed twice a day, at 7:00-8:00 and 17:00-18:00, respectively. The breeding cycle was 5 weeks. During the breeding period, continuous aeration and oxygenation were performed day and night to ensure sufficient oxygen, reduce human interference, keep quiet, prevent additional stress, and measure water quality once a week. The feeding and mortality of the bighead carp were observed daily. Water quality during the breeding period: water temperature 26-28℃, dissolved oxygen>6.0mg / L, pH 6.5-7.0, ammonia nitrogen content <0.10mg / L, nitrite nitrogen <0.10mg / L.

[0196] 3. Preparation of experimental diets

[0197] All experimental feed raw materials were crushed by a grinder, then passed through a 60-mesh sieve, and then accurately weighed according to the formula. The vitamin, mineral and carboxymethyl cellulose mixture was fully mixed step by step according to the proportion by the step-by-step expansion method, and then fish oil or oxidized fish oil was added. The addition amount of fish oil and oxidized fish oil was 6%. Finally, water (500mL / kg) was added and stirred and mixed. The wet granular feed with a particle size of 1.5mm was made by F-26 twin-screw extruder (Guangzhou Huagong Opto-Mechanical Technology Co., Ltd.), placed in a cool and ventilated place to dry, and then collected and stored in a self-sealing bag and placed in a -20℃ refrigerator for standby use. The composition of the experimental diet is shown in Table 1.

[0198] Table 1. Feed ingredients and basic nutrient levels (%)

[0199]

[0200]

[0201] Note: 1 Vitamin content per kilogram of diet: Vitamin A, 900 IU; Vitamin B1, 0.32 mg; Vitamin B2, 1.09 mg; Vitamin B5, 2 mg; Vitamin B6, 0.50 mg; Vitamin B 12 ,0.0016mg; Vitamin C,5mg; Vitamin D,200IU; Vitamin E,4.50mg; Vitamin K3,0.22mg; Niacinamide,2.80mg; Folic acid,0.17mg; Pantothenic acid,1mg; Choline,60mg;

[0202] 2 Mineral content per kilogram of diet: ferrous sulfate heptahydrate, 75 mg; copper sulfate pentahydrate, 6 mg; zinc sulfate heptahydrate, 66 mg; sodium selenite, 0.12 mg; manganese sulfate tetrahydrate, 21 mg; cobalt chloride hexahydrate, 0.30 mg; potassium iodide, 0.0780 mg.

[0203] 4. The synthesized miR-144-3p inhibitor was intraperitoneally injected into the bighead carp at a dose of 1-3 nmol / g fish weight, with an injection cycle of 5-7 days.

[0204] After intraperitoneal injection of miR-144-3p inhibitor, the transcription level of intestinal miR-144-3p was significantly decreased, and the expression of myosin light chain kinase MLCK, a negative regulator of intestinal barrier factors, was significantly upregulated; the expression of target gene Nrf2 and downstream inflammation-related genes (NF-κB, TNF-α, IL-1β), autophagy-related genes (P62, ATG5, ATG8, GRP78) and apoptosis-related genes (HSP27, Caspase-3, Caspase-8) were significantly downregulated, and the expression of intestinal epithelial cell barrier factor-related genes (Occludin, Claudin-7α, ZO-1), antioxidant factors (Gpx, GSS) and anti-inflammatory related genes (IL-10) were significantly upregulated;

[0205] The upstream and downstream primers of the MLCK gene are shown in SEQ ID NO: 6 and SEQ ID NO: 7:

[0206] Sequence 6: GTTCTGGAGGGCATTGGCTAT;

[0207] Sequence 7: GTCACAGATTTTGATGTCTTCCC.

[0208] The upstream and downstream primers of the occludin gene are shown in SEQ ID NO: 8 and 9: SEQ ID NO: TATCTGTATCACTACTGCGTCG;

[0209] Sequence 9: CATTCACCCAATCCTCCA;

[0210] The upstream and downstream primers of ZO-1 gene are shown in SEQ ID NO: 10 and SEQ ID NO: 11: GCATGTGCATTTTACCTGGCT;

[0211] Sequence 11: TGATAGCTTTTGGCGTCAGC;

[0212] The upstream and downstream primers of Claudin-7α gene are shown in SEQ ID NO: 12 and SEQ ID NO: 13:

[0213] Sequence 12: ACTTACCAGGGACTGTGGATGT;

[0214] Sequence 13: CACTATCATCAAAGCACGGGT;

[0215] The upstream and downstream primers of TNF-α gene are shown in SEQ ID NO: 14 and SEQ ID NO: 15: CGACGCTATACGGACCTTCG;

[0216] Sequence 15: AAGACAGGAGCCAAGGAGAAC;

[0217] The upstream and downstream primers of NF-κB gene are shown in SEQ ID NO: 16 and SEQ ID NO: 17: SEQ ID NO: AGTCCGATCCATCCGCACTA;

[0218] Sequence 17: ACTGGAGCCGGTCATTTCAG;

[0219] The upstream and downstream primers of IL-1β gene are shown in SEQ ID NO: 18 and SEQ ID NO: 19: TCGGAGCATTCTTCCAGCAT;

[0220] Sequence 19: TCATCTTGACCGAGGTGGTG;

[0221] The upstream and downstream primers of IL-10 gene are shown in SEQ ID NO: 20 and SEQ ID NO: 21: SEQ ID NO: GTGTTTTCGGGTGCAAGTGG;

[0222] Sequence 21: ATGAACGAGATCCTGCGCTT;

[0223] The upstream and downstream primers of the GPx gene are shown in SEQ ID NO: 22 and SEQ ID NO: 23: SEQ ID NO: TTTGAGGAACGACCACCAGG;

[0224] Sequence 23: CGAACTGATTGCAGGGGACT;

[0225] The upstream and downstream primers of the GSS gene are shown in SEQ ID NO: 24 and SEQ ID NO: 25: CCGTTCACGTTGTTTCCCAC;

[0226] Sequence 25: AGAAAGGTGGGGTCCTGACT;

[0227] The upstream and downstream primers of the P62 gene are shown in SEQ ID NO: 26 and SEQ ID NO: 27:

[0228] Sequence 26: CACTTGAGGTGCTGCTCTGA;

[0229] Sequence 27: TTAACTTCGGACAGACGGGC;

[0230] The upstream and downstream primers of GRP78 gene are shown in SEQ ID NO: 28 and SEQ ID NO: 29:

[0231] Sequence 28: CACGCCCTTGAGATTACTG;

[0232] Sequence 29: GCTGGATGTGAGGCTTGTT;

[0233] The upstream and downstream primers of ATG5 gene are shown in SEQ ID NO: 30 and SEQ ID NO: 31:

[0234] Sequence 30: TGTTGTTTGACCTCCACGCT;

[0235] Sequence 31: CGCATCGGCCTCTTTAATGC;

[0236] The upstream and downstream primers of ATG8 gene are shown in SEQ ID NO: 32 and SEQ ID NO: 33:

[0237] Sequence 32: CTCGGCTCTCAGGTGGATTC;

[0238] Sequence 33: GCTGTGTGTGAGAGAAGCCT;

[0239] The upstream and downstream primers of HSP27 gene are shown in SEQ ID NO: 34 and SEQ ID NO: 35:

[0240] Sequence 34: CCCGACATGCCCTCCTTAAT;

[0241] Sequence 35: CACCACCCCATCTTTGGTCT;

[0242] The upstream and downstream primers of Caspase-3 gene are shown in SEQ ID NO: 36 and SEQ ID NO: 37:

[0243] Sequence 36: AGATGGTGTGGGAGATGGAG;

[0244] Sequence 37: CCAGTTGCTTGCCGTATTTT;

[0245] The upstream and downstream primers of Caspase-8 gene are shown in SEQ ID NO: 38 and SEQ ID NO: 39:

[0246] Sequence 38: TTGTCTGCTGTGTCCTCTCG;

[0247] Sequence 39: ATCGTTCCCTTGTCCATCTG;

[0248] The internal reference gene is Megalobrama amblycephala β-actin, and the upstream and downstream primers are shown in sequence 40 and sequence 41:

[0249] Sequence 40: TCGTCCACCGCAAATGCTTCTA;

[0250] Sequence 41: CCGTCACCTTCACCGTTCCAGT.

[0251] 5. After 2-5 injection cycles, the intestinal tissues of Megalobrama amblycephala were collected to detect ROS content, intestinal tissue morphology, intestinal tight junction structure and autophagosome ultrastructure, and the expression of genes related to cellular inflammation, autophagy and apoptosis.

[0252] The dihydroethidium (DHE) fluorescent probe method was used to detect the cellular ROS content, and transmission electron microscopy was used to observe mitochondrial damage, the number of autophagosomes, and the tight junction structure between epithelial cells.

[0253] The results showed that miR-144-3p inhibitors and their application can effectively alleviate the intestinal tissue damage of Megalobrama amblycephala caused by the intake of oxidized oils (decrease in villus length, reduction in muscle layer thickness, loose tight junction structure between epithelial cells), increase in intestinal cell ROS content, cell autophagy and apoptosis.

[0254] In summary, after fish ingested oxidized fish oil, the expression level of miR-144-3p in intestinal tissue was significantly upregulated, and the transcription level of intestinal miR-144-3p was significantly decreased after intraperitoneal injection of miR-144-3p inhibitor. The application of miR-144-3p inhibitor for alleviating fish intestinal damage induced by oxidized fish oil can improve intestinal damage of freshwater fish, including reducing intestinal reactive oxygen levels, repairing the tight junction structure between intestinal epithelial cells, and downregulating intestinal cell inflammation, autophagy and apoptosis levels.

[0255] Example 1 Effects of injection of miR-144-3p analogs and inhibitors on the expression of miR-144-3p and Nrf2 in the intestine of Megalobrama amblycephala

[0256] One hundred and twenty Megalobrama amblycephala with uniform initial weight (7.58±0.097g) were divided into four groups, namely, 6% normal fish oil group (NC), equal proportion oxidized fish oil group (OF), oxidized fish oil + miR-144-3p analog injection group (OF+ago), oxidized fish oil + miR-144-3p inhibitor injection group (OF+anta), with three replicates in each group and 10 fish in each replicate. Under laboratory conditions, by adding Fe in the proportion of fresh fish oil, the 2+ (30mg kg -1 ,FeSO4·7H2O),Cu 2+ (15mg kg -1, CuSO4·H2O), H2O2 (600mg·kg -1 30%) and water (0.3%) were used to prepare the oxidized fish oil. After the mixture was completely mixed, it was stirred and oxidized at 80°C. The peroxide level was monitored every 4 hours. When the final peroxide value reached 323 mmol kg -1 After that, add 150mg·kg -1 Ethoxyquin was added to prevent further oxidation. The miR-144-3p analogs and inhibitors were dissolved in DEPC water. The experimental fish in the OF+ago and OF+anta groups were intraperitoneally injected with 1-3 nmol / g body weight once a week during the 35 days of the culture period. Intestinal tissues were collected after 5 weeks for fluorescence quantitative PCR analysis. The miRNA 1st strand cDNA Synthesis Kit (by stem-loop) (Vazyme, Nanjing, China) and Mir-X TM miRNA qRT-PCR Kit (Takara, Otsu, Japan) was used for miRNA reverse transcription and fluorescence quantitative analysis, and 5sRNA was used as an internal reference. ⅢRT SuperMix for qPCR (+gDNA wiper) (Vazyme, Nanjing, China) and TB Premix Ex Taq TM II (Tli RNaseH Plus) (Takara, Dalian, China) was used for reverse transcription and quantitative analysis of Nrf2 and other downstream related genes, and β-actin was used as an internal reference.

[0257] The results showed that compared with the NC group, the intake of oxidized fish oil and the injection of miR-144-3p analogs led to a significant upregulation of miR-144-3p expression, and the expression pattern of the target gene Nrf2 was opposite to that of miR-144-3p. The injection of miR-144-3p analogs on the basis of the OF group significantly inhibited the expression of Nrf2. The injection of miR-144-3p inhibitor on the basis of the OF group significantly inhibited the expression of miR-144-3p in the intestine of Megalobrama amblycephala ( Figure 1 ), which significantly promoted the expression of Nrf2.

[0258] The above results indicate that the miR-144-3p inhibitor of the present invention has a highly efficient and specific regulatory effect on the Nrf2 pathway.

[0259] Example 2 Effects of injection of miR-144-3p analogs and inhibitors on reactive oxygen species (ROS) levels and antioxidant gene expression in intestinal cells of Megalobrama amblycephala

[0260] On the basis of Example 1, intestinal samples of Megalobrama amblycephala were taken and ROS in intestinal tissue was detected using a DHE probe. Specifically, first, a DHE probe diluted with phosphate-buffered saline (PBS) (usually PBS:DHE=200:1-300:1) was used to incubate frozen sections of intestinal tissue in the dark at 37°C for 30 minutes. The slides were placed in PBS (PH=7.4) in a decolorizing shaker and rinsed three times in the dark for 5 minutes each time. After the sections were slightly dried, DAPI staining solution was added to stain the nuclei at room temperature for 10 minutes. After rinsing 3 times according to the above method, the sections were slightly dried and sealed with an anti-fluorescence quenching sealant. Finally, photos were taken using an Eclipse TI-SR confocal microscope (Nikon, Japan). The expression determination method of intestinal antioxidant genes GPx and GSS is the same as in Example 1.

[0261] The results showed that compared with the NC group, the intake of oxidized fish oil and the injection of miR-144-3p analogs led to a significant increase in the ROS content of intestinal cells ( Figure 2-1 , Figure 2-2 ), the expression of intestinal antioxidant genes GPx and GSS was significantly downregulated ( Figure 2-3 ); Based on the OF group, injection of miR-144-3p inhibitor significantly reduced the ROS content in the intestine of Megalobrama amblycephala ( Figure 2-1 , Figure 2-2 ), significantly increased the expression level of antioxidant genes ( Figure 2-3 ).

[0262] Example 3 Effects of injection of miR-144-3p analogs and inhibitors on intestinal tissue morphology of Megalobrama amblycephala

[0263] On the basis of Example 1, the intestinal samples of Megalobrama amblycephala were taken for H&E staining. One fish was randomly selected from each barrel and its intestine was collected. Blood, feces and other impurities were rinsed with normal saline. The intestinal tissue was fixed in 4% paraformaldehyde for 24 hours, dehydrated with gradient ethanol and xylene, embedded in paraffin, cut into 4 μm sections, dewaxed, hydrated, and stained with hematoxylin-eosin (H&E). Finally, the H&E-stained tissue sections were examined using an optical microscope to assess the extent of histopathological damage.

[0264] The results showed that compared with the NC group, oxidized fish oil intake and injection of miR-144-3p analogs showed inflammatory infiltration and serosal destruction ( Figure 3-1 ), and both resulted in a significant decrease in muscle thickness and villus length ( Figure 3-2 ). Injection of miR-144-3p inhibitor effectively alleviated the damage and inflammatory infiltration of intestinal tissues based on the OF group ( Figure 3-1 ).

[0265] Example 4 Effects of injection of miR-144-3p analogs and inhibitors on the tight junction structure and tight junction protein gene expression in the intestine of Megalobrama amblycephala

[0266] On the basis of Example 1, the intestinal samples of Megalobrama amblycephala were taken for transmission electron microscopic ultramicroscopic observation. The tissue was fixed for 2 hours using glutaraldehyde solution (volume fraction 2%; pH = 7.4), rinsed with 0.2 mg / L phosphate buffer, and fixed with osmic acid (volume fraction 1%). Then, dehydration (acetone), embedding (Epon812 epoxy resin), ultrathin sectioning (thickness: 50-70 nm), staining (uranyl acetate-lead citrate), transmission electron microscopic ultramicrostructure observation and photography were performed in sequence.

[0267] The results showed that compared with the NC group, the tight junction structure of the intestine of the bighead carp was blurred and dispersed after the intake of oxidized fish oil and the injection of miR-144-3p analogs, and the intercellular spaces between epithelial cells were enlarged ( Figure 4-1 ). RT-PCR results showed that the expression of myosin light chain kinase (MLCK), a negative regulator of intestinal barrier factors, was significantly upregulated, while the expression of intestinal barrier factors Occludin, Claudin-7α and ZO-1 was significantly downregulated ( Figure 4-2 ); Based on the OF group, injection of miR-144-3p inhibitor significantly increased the density of the intestinal tight junction structure of Megalobrama amblycephala ( Figure 4-1 ), and significantly upregulated the expression levels of intestinal barrier factor genes ( Figure 4-2 ).

[0268] Example 5 Effects of injection of miR-144-3p analogs and inhibitors on the expression of genes related to intestinal inflammation in Megalobrama amblycephala

[0269] On the basis of Example 1, the intestinal tissue of Megalobrama amblycephala was taken to measure the expression of inflammation-related genes. The results showed that compared with the NC group, the intake of oxidized fish oil and the injection of miR-144-3p analogs led to a significant upregulation of the expression of inflammatory factors NF-κB, TNF-α and IL-1β, and a significant downregulation of the expression of the anti-inflammatory gene IL-10; on the basis of the OF group, the injection of miR-144-3p inhibitor significantly downregulated the expression of intestinal inflammatory genes in Megalobrama amblycephala, and increased the expression of the anti-inflammatory gene IL-10 ( Figure 5 ).

[0270] Example 6 Effects of injection of miR-144-3p analogs and inhibitors on the expression of autophagy-related genes in the intestine of Megalobrama amblycephala

[0271] Based on Example 1, the intestinal tissue of Megalobrama amblycephala was taken to measure the expression of autophagy-related genes. The results showed that compared with the NC group, the intake of oxidized fish oil and the injection of miR-144-3p analogs significantly upregulated the expression levels of autophagy-related genes P62, ATG5, ATG8 and GRP78; on the basis of the OF group, the injection of miR-144-3p inhibitor significantly reduced the expression of autophagy-related genes ( Figure 6 ).

[0272] Example 7 Effects of injection of miR-144-3p analogs and inhibitors on the expression of apoptosis-related genes in the intestine of Megalobrama amblycephala

[0273] Based on Example 1, the intestinal tissue of Megalobrama amblycephala was taken to measure the expression of apoptosis-related genes. The results showed that compared with the NC group, the intake of oxidized fish oil and the injection of miR-144-3p analogs upregulated the expression of apoptosis-related genes HSP27, Caspase3 and Caspase8; on the basis of the OF group, the injection of miR-144-3p inhibitor significantly reduced the expression of apoptosis-related genes in the intestine of Megalobrama amblycephala ( Figure 7 ).

[0274] Example 8 Effects of injection of miR-144-3p analogs and inhibitors on the ultrastructure of autophagosomes in intestinal cells of Megalobrama amblycephala

[0275] Based on Example 1, samples of the intestine of Megalobrama amblycephala were taken for transmission electron microscopic ultramicroscopic observation. The results showed that compared with the NC group, the number of autophagosomes in the intestinal cells of the group that took oxidized fish oil and injected with miR-144-3p analogs increased significantly; and the number of autophagosomes was downregulated by injecting miR-144-3p inhibitors based on the OF group.

[0276] In summary, the present invention relates to a miRNA inhibitor that can effectively alleviate intestinal oxidative damage after freshwater fish ingestion of oxidized oils and its application can effectively alleviate the damage of intestinal tissue of Megalobrama amblycephala caused by ingestion of oxidized oils (decreased villus length, reduced muscle layer thickness, loose tight junction structure between epithelial cells), increased ROS content in intestinal cells, cell autophagy and apoptosis, etc.

[0277] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

[0278] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A miR-144-3p inhibitor that alleviates fish intestinal damage induced by oxidative fish oil, Its characteristics are: The miR-144-3p inhibitor is chemically synthesized. The nucleotide sequence of miR-144-3p screened by high-throughput miRNA sequencing is synthesized sequence-specific miR-144-3p and miR-144-3p inhibitors. Things, The miR-144-3p gene sequence is shown in Sequence 1: Sequence 1: UACAGUAUGAUGAUGUACU; The miR-144-3p inhibitor gene sequence is shown in Sequence 2: Sequence 2: AGUACAUCAUCUAUACUGUA.

2. A miR-144-3p inhibitor that alleviates oxidative fish oil-induced intestinal damage to fish intestinal tract according to claim 1, Its characteristics are: The miR-144-3p target gene is Nrf2, and the expression of miR-144-3p on Nrf2 is negatively regulated, and the expression of miR-144-3p inhibitor on Nrf2 is positively regulated; The specific sequence of Nrf2 is shown in Sequence 3: TGACTGCTTACCTTACGGTTGACCGGTGGCTCTCCTGGCTGTGCCTCGAAACAGACTGAATGTATCGCTGGACCCCCTCTCTCCCGTCGCTAAAGGAATGTCGACGTGGAGCTGCCAAACGTGAACGTGTAGGGTACTCATGAACGCGCTCGTCGGAGAGTCTTCTCTGAGCTCGTACCCTTGGCATAGGTAGAGTGGGCATGGCGCTGATCACAGCTACCTGTCACATTTCGTGGCGTGTTGAAAGCTGAGGGGGAAGAAATTCTTGAAAGACGAAGCCTGCAGTGTTTGATTCATCTAAAAGCTGTTTAAATCTATATGCATTTCGTTGTACTTTAAAATGCAATGTAGCTACATTGTGCACGTTTAATATTTGGAGTGGTTCATCCTCATAAGATTTTATTTGATCATTAAACTTATATTAAATTCTATTTTAGGTAGCCTACAGTTGTAGATTCTAAAAAGTAAAATTGAGTAGCAATTTTTTATGTTAAAGTTTTTTATGTAAAAGTTTACATGTTAATGAGGTAAACCTATGTGTTTTTCTTGTGCTTTTCTCAGGATAAATTTGATCAACATCAACCATTTCATTTTTGATTTATAAGTAAAGAAGGTTGTAAAGACATGTTATAAAGCGATGAATGCATGTCTCCTTTGAGTTTCTTTGAATCTGCTGTTTGATTGGCTGATGGATTGTCCCTGAATTTGTTATCTTCTGTTTGATTGGCTGATGGATATTGTGGGCGAGTCCTGCCTGTATTTGGGATCTGTTACACACGCGTGTCGTCAGATTTGATCCAGAAATATGCTTTGCGTCTGCTTGAATTAGTCCTTCATCAGACTTTTCATCAGCTAAGAGACATGGACGACCCTTCAGCTCAGTTTCAACATGATTCGGATTTGATTGATATTTTATGGAGGCAGGATGTCGATTTGGGGGTGGAGCGAGAGATCTTTGATGGATGCCTTCGGCAGAAGGAGGAGACCATGAGAGCAAGAGAAAGAGAGTTGAAAAGCGAGAGAGAGCTTGAAAGAATAATGCAAAGGTTACAGAAACTTGACAAAGAGACCGGAGAGTTTTTGCCTAGTCCTTCATCTGTAAACTCCCAGGCTGTGCCCTTCTCAGAGACGTTGCCCTCGAGAGTGTCTACTCAGCATTCACCCGTTACCCAGAATCCCCTGCTATCTGCCCTGCTATTCTCCAAGTCTCAGAAGCCTCCTTCTCAGGAGCAGGCTTTTAGTGAACTGCTGTCACTGCCAGACTTACAGTATTATCTGGATGTCTTGGAGTATGAGGGCTCAAATTTGCCCTTAGAGGATATCACTGAAATCTGCCACCACAACCTGCCAGAGCCACAGAGGGAAAACTCAACAGATGAATTATGTGACATCGGTGAACTCACACAGACAATATCAGACTCTTTTGAAGTTGCTCAGCCTTTATCATGCATGCCCTCTGACCCATTAGAAGTCTTGGAAACATGCATACAGACATTCTCAGATCCAGGCAATCCTACACCTTCACCTTCAAACACAATTTACAGCTGTAGTAGCCCAGAGAATCAAGGGATTTTTACTAAATGCCAAGCAAATTCAAGCGATTCGTCCTTGAGTGAGTTTTGCCCTGATATAAATACATATACCATCAATACTAGCACACTCAGTGAACCAGAACAATTAAATAGTGTGCCTGGAAGGAAAGCTCCACAAATGCTTTCACAATTTGAGGAGCATCGCATTCTTCTGGGTTTTGATGACTCTGCTTCTGTTGGCTCTGTGGATTTAGAGATGTCCCTCTATGCGGCTGACACCGTAAGCAACGGCCGATCAGACAAGGATGAGCTGGAAAGCATCCAATCAGATTACACCGATCTGCTGTCTTTATCTCTCCACTCTGAGACAGTAGAGGCAACACTGTATGAAACTGCTACGTATTCACCACACCAAACTCAAAACGAATCAGCGCCTGAATATTCACAAAG; The upstream and downstream primers of the Nrf2 gene are shown in Sequence 4 and Sequence 5: Sequence 4: GGGGAAGTCCTTGAACGGAG; Sequence 5: AACCAGCGGGAATATCTCGG.

3. A miR-144-3p inhibitor that alleviates oxidative fish oil-induced intestinal damage to fish intestinal tract according to claim 2, Its characteristics are: The main steps are to detect miR-144-3p expression in intestinal tissue of the cypress head by fluorescence quantitative PCR. (1) The chemically synthesized miR-144-3p inhibitor was injected into the abdominal cavity of the slug erectus, and the total RNA of the intestinal tissue of the slug erectus was extracted after 5-7 days; (2) The total RNA of the intestinal tissue extracted from step (1) was reverse transcribed into cDNA using the stem loop method, and the reverse transcription primers were shown in sequence 42; Sequence 42: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGTA CAT; (3) Use the fluorescence quantitative PCR kit to reversely transcribe into cDNA in step (2) for miR-144-3p amplification; The upstream and downstream primers of miR-144-3p gene are shown in sequence 43 and sequence 44: Sequence 43: CGCGCGCGACAGTATAGATG; Sequence 44: AGTGCAGGGTCCGAGGTATT.

4. A miR-144-3p inhibitor that alleviates oxidative fish oil-induced intestinal damage to fish intestinal tract according to claim 3, Its characteristics are: Chemically synthesized miR-144-3p inhibitor was injected into the abdominal cavity of the slughead bream, which reduced the expression of intestinal miR-144-3p within 5-7 days, promoted the expression of Nrf2 and intestinal tight junction proteins, and improved the induction of oxidized fish oil. Intestinal barrier damage and increased reactive oxygen species, as well as autophagy and apoptosis of intestinal epithelial cells.

5. The application of a miR-144-3p inhibitor to alleviate the intestinal damage caused by oxidative fish oil induced by fish intestinal injury according to claim 1, Its characteristics are: After intraperitoneal injection of miR-144-3p inhibitor of tutu ruta, the transcription level of intestinal miR-144-3p was significantly reduced, the target gene Nrf2 was significantly upregulated, and the expression of inflammation-related genes, autophagy-related genes and apoptosis-related genes was significantly downregulated. The expression of barrier factor-related genes, antioxidant factors and anti-inflammatory-related genes in the tract epithelial cell was significantly upregulated; the expression of the negative regulator of intestinal barrier factor-myosin light chain kinase MLCK was significantly reduced. The upstream and downstream primers of the MLCK gene are shown in Sequences 6 and Sequence 7: Sequence 6: GTTCTGGAGGGCATTGGCTAT; Sequence 7: GTCACAGATTTTGATGTCTTCCC.

6. The application of a miR-144-3p inhibitor to alleviate intestinal damage caused by oxidative fish oil induced by fish intestinal injury according to claim 5, Its characteristics are: The downstream inflammation-related gene of the target gene Nrf2 includes NF-κB, TNF-α, IL-1β; the autophagy-related gene includes P62, ATG5, ATG8, and GRP78; the apoptosis-related gene includes HSP27, Caspase-3, Caspase-8; The intestinal epithelial cell barrier factor-related genes include Occludin, Claudin-7α, and ZO-1; the antioxidant factor includes Gpx, GSS; the anti-inflammatory-related gene IL-10; The upstream and downstream primers of the Occludin gene are shown in Sequences 8 and Sequence 9: Sequence 8: TATCTGTATCACTACTGCGTCG; Sequence 9: CATTCACCCAATCCTCCA; The upstream and downstream primers of the ZO-1 gene are shown in Sequence 10 and Sequence 11: Sequence 10: GCATGTGCATTTTACCTGGCT; Sequence 11: TGATAGCTTTTGGCGTCAGC; The upstream and downstream primers of the Claudin-7α gene are shown in Sequences 12 and Sequence 13: Sequence 12: ACTTACCAGGGACTGTGGATGT; Sequence 13: CACTATCATCAAAGCACGGGT; The upstream and downstream primers of the TNF-α gene are shown in sequence 14 and sequence 15: Sequence 14: CGACGCTATACGGACCTTCG; Sequence 15: AAGACAGGAGCCAAGGAGAAC; The upstream and downstream primers of the NF-κB gene are shown in Sequences 16 and 17: Sequence 16: AGTCCGATCCATCCGCACTA; Sequence 17: ACTGGAGCCGGTCATTTCAG; The upstream and downstream primers of the IL-1β gene are shown in sequence 18 and sequence 19: Sequence 18: TCGGAGCATTCTTCCAGCAT; Sequence 19: TCATCTTGACCGAGGTGGTG; The upstream and downstream primers of the IL-10 gene are shown in sequence 20 and sequence 21: Sequence 20: GTGTTTTCGGGTGCAAGTGG; Sequence 21: ATGAACGAGATCCTGCGCTT; The upstream and downstream primers of the GPx gene are shown in sequence 22 and sequence 23: Sequence 22: TTTGAGGAACGACCACCAGG; Sequence 23: CGAACTGATTGCAGGGGACT; The upstream and downstream primers of the GSS gene are shown in sequence 24 and sequence 25: Sequence 24: CCGTTCACGTTGTTTCCCAC; Sequence 25: AGAAAGGTGGGGTCCTGACT; The upstream and downstream primers of the P62 gene are shown in sequence 26 and sequence 27: Sequence 26: CACTTGAGGTGCTGCTCTGA; Sequence 27: TTAACTTCGGACAGACGGGC; The upstream and downstream primers of the GRP78 gene are shown in Sequence 28 and Sequence 29: Sequence 28: CACGCCCTTGAGATTACTG; Sequence 29: GCTGGATGTGAGGCTTGTT; The upstream and downstream primers of the ATG5 gene are shown in sequence 30 and sequence 31: Sequence 30: TGTTGTTTGACCTCCACGCT; Sequence 31: CGCATCGGCCTCTTTAATGC; The upstream and downstream primers of the ATG8 gene are shown in sequence 32 and sequence 33: Sequence 32: CTCGGCTCTCAGGTGGATTC; Sequence 33: GCTGTGTGTGAGAGAAGCCT; The upstream and downstream primers of the HSP27 gene are shown in sequence 34 and sequence 35: Sequence 34: CCCGACATGCCCTCCCTTAAT; Sequence 35: CACCACCCCATCTTTGGTCT; The upstream and downstream primers of the Caspase-3 gene are shown in sequence 36 and sequence 37: Sequence 36: AGATGGTGTGGGAGATGGAG; Sequence 37: CCAGTTGCTTGCCGTATTTT; The upstream and downstream primers of the Caspase-8 gene are shown in sequence 38 and sequence 39: Sequence 38: TTGTCTGCTGTGTCCTCTCG; Sequence 39: ATCGTTCCCTTGTCCATCTG; The inner reference gene is β-actin, and the upstream and downstream primers are shown in sequence 40 and sequence 41: Sequence 40: TCGTCCACCGCAAATGCTTCTA; Sequence 41: CCGTCACCTTCACCGTTCCAGT.

7. The application of a miR-144-3p inhibitor to alleviate intestinal damage caused by oxidative fish oil induced by fish intestinal injury according to claim 5, Its characteristics are: After fish consumed oxidized fish oil, the expression level of miR-144-3p in intestinal tissue was significantly upregulated, and the transcription level of miR-144-3p intestinal injected with miR-144-3p inhibitor was significantly reduced.

8. The application of a miR-144-3p inhibitor to alleviate intestinal damage caused by oxidative fish oil induced by fish intestinal injury according to claim 5, Its characteristics are: The application of miR-144-3p inhibitors to alleviate intestinal damage caused by oxidative fish oil can improve intestinal damage in freshwater fish, including reducing intestinal reactive oxygen level, repairing the tight junction structure between intestinal epithelial cells, and downregulating Intestinal cell inflammation levels, autophagy levels, and apoptosis levels.

9. The application of a miR-144-3p inhibitor to alleviate intestinal damage caused by oxidative fish oil induced by fish intestinal injury according to claim 5, Its characteristics are: The dose of the miR-144-3p inhibitor injected into the abdominal cavity is 1-3 nmol·g -1 body mass / fish, injection cycle is 5-7 days.

Images