Beta-glucuronidase and application thereof in bilirubin production

Abstract

The invention discloses beta-glucuronidase and application thereof in bilirubin production, and belongs to the technical field of biological medicine. A product containing beta-glucuronidase is obtained through construction of recombinant plasmids, transformation, expression, separation and purification and can be used for preparing bilirubin through pig bile reaction. The beta-glucuronidase provided by the invention has relatively high enzyme activity and thermal stability, relatively large adaptive pH range and temperature range and strong adaptability, and in addition, a metal ion solution containing Fe < 2 + > and Mg < 2 + > has a promoting effect on the beta-glucuronidase and is beneficial to improving the enzyme activity. The yield and purity of bilirubin produced by the beta-glucuronidase are high, and the beta-glucuronidase can be widely applied to the production process of bilirubin.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and specifically relates to a beta-glucuronidase and an application thereof in the production of bilirubin. Background Art

[0002] Bilirubin is an important lipid drug and the main ingredient of more than 100 Chinese patent medicine preparations in the 2020 edition of the Pharmacopoeia, such as Angong Niuhuang Pills, Niuhuang Jiedu Pills and Dahuoluo Pills. The market demand is huge and the current market price is expensive. Bilirubin is also one of the main components of the rare and precious Chinese medicinal material natural bezoar, which has extremely high medicinal value. At present, bilirubin is mainly extracted from animal bile (such as pig bile), but more than 90% of bilirubin in pig bile is combined with glucuronic acid to form a bound bilirubin form. The traditional bilirubin production process uses chemical methods such as high temperature and strong alkali to remove the glucuronic acid group of bound bilirubin, but it is easy to cause bilirubin oxidation, low yield, and serious environmental pollution. Foreign pharmaceutical leading companies such as Roche, Novartis, and Merck have carried out research on the enzymatic preparation of bilirubin technology, while domestic research has just started. It is necessary to carry out key technology research and industrial development of green preparation of bilirubin lipid drugs. Summary of the invention

[0003] The object of the present invention is to provide a β-glucuronidase and its application in the production of bilirubin. The β-glucuronidase has high enzyme activity and thermal stability and can improve the yield and purity of the preparation of bilirubin.

[0004] The purpose of the present invention can be achieved through the following technical solutions:

[0005] The present invention provides a beta-glucuronidase, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0006] Furthermore, the preparation steps of the β-glucuronidase are as follows:

[0007] (1) Construction of recombinant plasmid: The β-glucuronidase CP076 gene was inserted into the pET28a expression plasmid using restriction endonucleases BamHI and XhoI, and positive clones were screened by Kan resistance. The recombinant plasmid was obtained by PCR amplification and restriction digestion identification, and the recombinant plasmid pET28a-CP076 was verified by sequencing;

[0008] (2) Transformation of recombinant plasmid: The recombinant plasmid was used to transform E. coli BL21 (DE3) competent cells to obtain the recombinant strain E. coli BL21 (DE3)-pET28a-CP076;

[0009] (3) Induced expression:

[0010] The recombinant strain E. coli BL21 (DE3)-pET28a-CP076 carrying the β-glucuronidase gene was activated in an LB plate containing Kan resistance and cultured overnight at 37°C; after the colonies grew, the monoclonal strain was picked and inoculated into 5 mL of liquid LB medium containing 50 μg / mL Kan antibiotic, at a temperature of 37°C and an oscillation rate of 220 r / min, and the shaking culture was carried out for 12-14 h; then the inoculum was transferred to 500 mL of liquid LB medium containing 50 μg / mL Kan antibiotic at a temperature of 37°C and an oscillation rate of 220 r / min until the OD 600 When the pH value reaches 0.6-0.8, IPTG (final concentration 0.1 mM) is added, and the temperature is 16°C and the shaking rate is 220 rpm for 16-18 hours; after the culture is completed, the fermentation liquid is obtained, and the fermentation liquid is centrifuged at 8000 rpm for 10 minutes, the supernatant is discarded, and the bacteria are collected and stored at -80°C for later use;

[0011] (4) Separation and purification:

[0012] The bacteria were mixed with lysis buffer at a ratio of 1 g: 10 mL, resuspended by shaking until there were no obvious lumps, and disrupted with an ultrasonic disruptor to obtain a cell disruption solution. The cell disruption solution was centrifuged at 8000 rpm for 10 min at 4°C, and the supernatant was taken to obtain the cell disruption solution supernatant, i.e., the crude enzyme solution. The crude enzyme solution was purified by column chromatography to obtain an eluate, and the eluate was further dialyzed to obtain a concentrated enzyme solution for SDS-PAGE detection and enzyme activity determination.

[0013] Furthermore, the restriction endonucleases are BamHI and XhoI.

[0014] Furthermore, the content of Kan antibiotic in the liquid LB culture medium containing Kan antibiotic is 50 μg / mL.

[0015] Furthermore, the shaking culture temperature is 37°C and the shaking rate is 220r / min.

[0016] Furthermore, the inducer is IPTG, the final concentration is 0.1 mM, the temperature of low-temperature shaking culture is 16° C., and the shaking rate is 220 r / min.

[0017] The present invention also provides a use of the beta-glucuronidase as described above in the production of bilirubin, wherein the beta-glucuronidase reacts with substrate pig bile to prepare bilirubin.

[0018] Further, the steps of preparing bilirubin are as follows:

[0019] The collected fermentation broth was divided into two parts, one of which was used as the whole-cell conversion liquid, and the other was resuspended in a buffer solution after centrifugation and then crushed as a crude enzyme solution. 1.5L of pig bile was measured, the pH was slowly adjusted with acetic acid at 30°C, 0.05wt% promoter and 0.1wt% antioxidant were added, the whole-cell conversion liquid (the amount added by volume fraction was 50%) or the crude enzyme solution (the amount added by volume fraction was 6%) was added, and the conversion reaction was carried out at the optimal temperature. After 4 hours of reaction, the bilirubin content was detected by liquid phase and ultraviolet.

[0020] Furthermore, the pig bile is adjusted to have a pH of 4.5-5.5 and an optimum temperature of 30-50°C.

[0021] Furthermore, the antioxidant is sodium bisulfite, and the promoter is one of MgSO4 and FeSO4.

[0022] Beneficial effects of the present invention:

[0023] The β-glucuronidase prepared by the present invention has high enzyme activity and thermal stability, is adaptable to a wide pH range and temperature range, and has a high metal ion Fe 2+ and Mg 2+ The β-glucuronidase can be used to prepare bilirubin with pig bile as raw material, the preparation steps are simple, the yield and purity of bilirubin are high, and the β-glucuronidase can be widely used in the production process of bilirubin. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The present invention will be further described below in conjunction with the accompanying drawings.

[0025] Figure 1 It is a schematic diagram of the recombinant plasmid structure of the present invention;

[0026] Figure 2 It is the SDS-PAGE detection analysis diagram of the present invention;

[0027] In the figure: M, protein marker; channel 1, total amount of no-load crushing; channel 2, supernatant of no-load crushing; channel 3, precipitate of no-load crushing; channel 4, total amount of cell crushing solution; channel 5, supernatant of cell crushing solution; channel 6, precipitate of cell crushing solution; channel 7, flow-through solution; channel 8, 100mM imidazole eluent; channel 9, 150mM imidazole eluent; channel 10, 200mM imidazole eluent; channel 11, 500mM imidazole eluent.

[0028] Figure 3 is a standard curve diagram of p-nitrophenol of the present invention;

[0029] Figure 4 This is a graph showing the optimum pH test result of the β-glucuronidase of the present invention;

[0030] Figure 5 This is a graph showing the pH stability test results of the β-glucuronidase of the present invention;

[0031] Figure 6 This is a graph showing the results of detecting the optimum reaction temperature of the β-glucuronidase of the present invention;

[0032] Figure 7 This is a graph showing the results of a thermal stability test of the β-glucuronidase of the present invention;

[0033] Figure 8 This is a graph showing the results of detecting the effect of metal ions on the activity of β-glucuronidase according to the present invention.

[0034] Fig. 9 It is the bilirubin standard curve diagram of the present invention.

[0035] Fig.10 It is a product diagram of the bilirubin extraction of the present invention. DETAILED DESCRIPTION

[0036] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0037] Example 1

[0038] Preparation of β-glucuronidase:

[0039] The nucleotide sequence of β-glucuronidase is shown in SEQ ID NO:1.

[0040] (1) Construction of recombinant plasmid: The glucuronidase CP076 gene was inserted into the pET28a expression plasmid using restriction endonucleases BamHI and XhoI. Positive clones were screened by Kan resistance, PCR amplification and restriction digestion were performed to obtain the recombinant plasmid, and sequencing was used to verify the recombinant plasmid pET28a-CP076.

[0041] (2) Transformation of recombinant plasmid: The recombinant plasmid was used to transform E. coli BL21 (DE3) competent cells to obtain the recombinant strain E. coli BL21 (DE3)-pET28a-CP076.

[0042] (3) Induced expression:

[0043] The recombinant strain E. coli BL21 (DE3)-pET28a-CP076 with the β-glucuronidase gene was activated in an LB plate containing Kan resistance and cultured overnight at 37°C. After the colonies grew, the monoclonal strain was picked and inoculated into 5 mL of liquid LB medium containing 50 μg / mL Kan antibiotics at 37°C and a shaking rate of 220 r / min for 12-14 hours. Then, the inoculum was transferred to 500 mL of liquid LB medium containing 50 μg / mL Kan antibiotics at a temperature of 37°C and a shaking rate of 220 r / min until the OD 600 When the pH reaches 0.6-0.8, IPTG (final concentration 0.1 mM) is added, and the temperature is 16°C and the shaking rate is 220 rpm for 16-18 hours. After the culture is completed, the fermentation liquid is obtained, and the fermentation liquid is centrifuged at 8000 rpm for 10 minutes, the supernatant is discarded, and the bacterial cells are collected and stored at -80°C for later use.

[0044] (4) Separation and purification:

[0045] The bacteria were mixed with lysis buffer at a ratio of 1 g: 10 mL, resuspended by shaking until there were no obvious lumps, and disrupted with an ultrasonic disruptor to obtain a cell disruption solution. The cell disruption solution was centrifuged at 8000 rpm for 10 min at 4°C, and the supernatant was taken to obtain the cell disruption solution supernatant, i.e., the crude enzyme solution. The crude enzyme solution was purified by column chromatography to obtain an eluate, and the eluate was further dialyzed to obtain a concentrated enzyme solution for SDS-PAGE detection and enzyme activity determination.

[0046] SEQ ID NO: 1:

[0047] GGATCCATGCTGTACCCGATCATCACCGAATCCCGTCAGCTGATCGACCTGTCTGGCATCTGGAAATTCAAACTGAACGAAGGTAACGGCCTGACTGAAGAACTGTCTAAAACCCCGCTGGAAGATACCATCGAAATGGCGGTGCCGAGCTCCTACAACGACCTGGTGGAAAGCCAGGAAGTTCGTGACCACGTTGGCTGGGTGTGGTATGAACGTAACTTTACCATCCCGAAAACGCTGCTGAACGAACGTATCGTTCTGCGTTTCGGCTCTGCAACCCACGAAGCGAAAGTTTATCTGAACGGTGAACTGCTGGTTGAACACAAAGGCGGTTTTACCCCGTTCGAAGCAGAAATCAACGACCTGCTGGTTAGCGGCGACAACCGCCTGACTGTGGCAGTGAACAACATCATCGATGAAACCACCCTGCCGGTTGGCCTGGTGAAAGAAGTTGAAGTTGATGGCAAAAAGATTATCAAAAACAGCGTGAACTTCGATTTCTTCAACTATGCGGGTATTCATCGCCCGGTGAAAATCTACACTACTCCGAAAA

[0048] GCTACGTGGAGGACATCACCATCGTGACCGACTTCAAAGAAAACAA

[0049] CGGTTACGTAAACTACGAAGTTCAGGCCGTTGGCAAATGCAACATC

[0050] AAAGTTACCATCATCGACGAAGAGAACAACATCGTTGCGGAAGGCG

[0051] AAGGCAAAGAAGGTAAACTGACCATCAACAACGTGCACCTGTGGGA

[0052] ACCGATGAACGCGTACCTGTACAAACTGAAAGTTGAACTGCTGGAT

[0053] GATGAAGAAATCATCGATACCTACTTCGAAGAATTCGGCGTCCGTA

[0054] CCGTTGAAGTTAAAGATGGTAAATTCCTGATTAACAACAAACCGTTC

[0055] TACTTTAAAGGCTTTGGCAAACACGAAGATTCCTATGTGAACGGCC

[0056] GCGGCATCAACGAAGCCATCAACATTAAAGACTTCAACCTGATGAA

[0057] ATGGATTGGTGCCAACTCTTTCCGCACCAGCCACTACCCGTACTCCG

[0058] AAGAAATCATGCGCCTGGCGGACCGTGAAGGCATCGTTGTTATCGA

[0059] TGAAACCCCGGCTGTGGGTCTGCACCTTAACTTCATGGCTACCGGCT

[0060] TCGGCGGCGACGCCCCGAAACGCGACACCTGGAAAGAAATTGGTAC

[0061] CAAAGAAGCCCATGAACGCATCCTGCGCGAACTGGTTTCCCGTGAT

[0062] AAAAACCACCCGTGCGTGGTGATGTGGTCTGTTGCGAACGAACCGG

[0063] ATTCCGATTCCGAAGGTGCGAAAGAATACTTCGAACCGCTGATTAA

[0064] ACTGACGAAAGAACTGGACCCGCAGAAACGTCCGGTTACCGTGGTG

[0065] ACTTACCTGATGTCTACCCCGGATCGCTGCAAAGTGGGCGATATCGT

[0066] TGACGTGCTGTGCCTGAACCGTTATTACGGTTGGTACGTTGCGGGTG

[0067] GTGATCTGGAAGAAGCGAAACGTATGCTGGAAGATGAACTGAAAG

[0068] GCTGGGAAGAACGTTGTCCGAAAACCCCGATCATGTTCACCGAATA

[0069] CGGCGCGGACACCGTTGCAGGCCTGCACGATACCGTTCCGGTGATG

[0070] TTCACCGAAGAATACCAGGTAGAATACTACAAAGCCAACCACGAAG

[0071] TGATGGACAAATGCAAAAACTTCGTTGGCGAACAGGTTTGGAACTT

[0072] TGCAGACTTCGCGACCAGCCAGGGCATCATCCGTGTGCAGGGTAAC

[0073] AAAAAAGGCATCTTCACCCGCGAACGTAAACCGAAAATGATCGCTC

[0074] ACTCTCTGCGTGAACGTTGGACCAACATCCCGGAATTCGGTTATAAA

[0075] AAATAACTCGAG.

[0076] Example 2

[0077] SDS-PAGE detection:

[0078] Pipette 20 μL of sample (total cell disruption solution, supernatant of cell disruption solution, precipitate of cell disruption solution, elution solution of each concentration of imidazole), add 5 μL of 5X electrophoresis buffer and mix evenly, boil in a boiling water bath for 10 min, cool to room temperature, and centrifuge at 10000 rpm for 5 min.

[0079] Take out two electrophoresis glass plates, clean and install them, fill the space between the two glass plates with pure water, let it stand for 15-20 minutes, and observe whether there is any liquid seeping out or the liquid level drops. If there is no water seeping out or the liquid level remains unchanged, pour out the water and proceed to the next step; otherwise, reinstall it and check for leaks.

[0080] Install the electrophoresis device, add 1X electrophoresis buffer to the inner tank until it is full, add an appropriate amount of 1X electrophoresis buffer to the outer tank, and then add the treated samples and protein electrophoresis gel to the protein gel channels in sequence, turn on the power, set the voltage to 80V and run electrophoresis for 30 minutes, then increase the voltage to 120V and continue running until the protein bands run to the bottom of the gel plate.

[0081] After electrophoresis, carefully remove the protein gel from the glass plate, wash it with water, add Coomassie Brilliant Blue dye, and place it on a horizontal shaker for 1-2 hours. After staining, wash it with water 2-3 times, add an appropriate amount of decolorizing solution until the bands are clear, and the test results are shown in the table. Figure 2 SDS-PAGE analysis showed that CP076 could be expressed in large quantities in E. coli BL21 (DE3), and most of it was soluble and eluted at an imidazole concentration of 150 mM. Comparison of protein electrophoresis bands showed that the molecular weight of β-glucuronidase was about 70 KDa.

[0082] Example 3

[0083] Determination of the optimal pH of β-glucuronidase:

[0084] Preparation of p-nitrophenol standard curve: Weigh 15.762 mg of p-nitrophenol and dissolve it in 100 mL of pure water to make a 500 μM p-nitrophenol stock solution, and dilute it to 450 μM, 400 μM, 350 μM, 300 μM, 250 μM, 200 μM, 150 μM, 100 μM, and 50 μM, and measure the absorbance at 405 nm. The absorbance (OD) is plotted on the horizontal axis with the p-nitrophenol concentration (μmol / L) as the horizontal axis. 405 ) is used as the ordinate to draw the standard curve. See Figure 3 .

[0085] With 4-nitrobenzene-β-D glucuronide as substrate, β-glucuronidase can react with substrate 4-nitrobenzene-β-D glucuronide (pNPG) to generate p-nitrophenol. To determine the activity of β-glucuronidase, accurately pipette 10 μL of the concentrated enzyme solution prepared in Example 1 and add it to 40 μL of buffer containing 1.25 mM 4-nitrobenzene-β-D glucuronide at different pH values ​​(buffer: 50 mM acetic acid-sodium acetate buffer at pH 4.0-6.0, 50 mM Tris-HCl buffer at pH 6.5-10.0), and react at 40°C for 10 min. After the reaction is completed, 200 μL of 0.4 M Na2CO3 solution is added to terminate the reaction. After the sample after the termination reaction is diluted by multiples, the content of p-nitrophenol is detected at 405 nm using a spectrophotometer. Water is used instead of the concentrated enzyme solution as the CK control group, and three parallel experiments are set up. The test results are shown in Tables 1 and Figure 4 .

[0086] Table 1

[0087]

[0088]

[0089] The enzyme activity is defined as: under certain conditions, the amount of enzyme required to catalyze the production of 1 μmol of p-nitrophenol per minute per 1 μL of enzyme solution is one activity unit (U / μL). The enzyme activity is calculated using the standard curve. The enzyme activity calculation formula is:

[0090] Enzyme activity (U / μL) = (OD 405 ×V1×D) / (t×V2)

[0091] OD 405 : Substitute the concentration value corresponding to the standard curve of p-nitrophenol; V1: total volume of the reaction system; D: dilution factor; t: reaction time; V2: volume of concentrated enzyme solution participating in the reaction.

[0092] From Table 1 and Figure 4 It can be seen that the optimum pH of β-glucuronidase is 5.0. At pH = 5.0, the enzyme activity of β-glucuronidase reaches the maximum value of 3994U / μL. Between pH 4-5, the enzyme activity of β-glucuronidase shows an upward trend, and between pH 5.5-10, the enzyme activity of β-glucuronidase generally shows a downward trend.

[0093] pH stability assay of β-glucuronidase:

[0094] The concentrated enzyme solution was added to buffer solutions of different pH values ​​and mixed evenly. The solution was incubated at 40°C for 30 min. The residual activity of the concentrated enzyme solution was determined according to the above method. Water was used instead of the concentrated enzyme solution prepared in Example 1 as the CK control group. Three parallel experiments were set up. The test results are shown in Tables 2 and Figure 5 .

[0095] Table 2

[0096]

[0097]

[0098] From Table 3 and Figure 5 It can be seen that the β-glucuronidase is prone to lose its activity under peracid conditions for a long time, but can maintain its enzyme activity well under other pH conditions for a long time.

[0099] Example 4

[0100] Determination of the optimal reaction temperature of β-glucuronidase:

[0101] The temperature gradient was set at 30°C, 40°C, 50°C, 60°C, 70°C, 80°C, and 90°C. 10 μL of the concentrated enzyme solution prepared in Example 1 was added to 40 μL of pH 5.0 buffer and reacted for 10 min at different temperatures. The enzyme activity was detected according to the above method. Water was used instead of the concentrated enzyme solution prepared in Example 1 as the CK control group, and three parallel experiments were set up. The test results are shown in Table 3 and Figure 6 .

[0102] Table 3

[0103]

[0104]

[0105] Temperature has a great influence on the activity and stability of enzymes, as shown in Table 3 and Figure 6 It can be seen that the optimal reaction temperature of the β-glucuronidase is 40°C. At T=40°C, the enzyme activity reaches a maximum value of 3952U / μL.

[0106] Thermal stability assay of β-glucuronidase:

[0107] The concentrated enzyme solution prepared in Example 1 was taken and added to the buffer solution with the optimum pH and mixed evenly. The mixture was incubated at different temperatures for 30 min, and then placed on ice for cooling. The residual activity of the enzyme solution was then determined according to the above method. Water was used instead of the concentrated enzyme solution prepared in Example 1 as the CK control group, and three parallel experiments were set up. The test results are shown in Tables 4 and Figure 7 .

[0108] Table 4

[0109]

[0110]

[0111] From Table 4 and Figure 7 It can be seen that the β-glucuronidase exhibits good thermal stability in the temperature range of 30-60°C and can maintain a high enzyme activity for a long time; above 60°C, the β-glucuronidase denatures and inactivates due to the high temperature, and the enzyme activity decreases significantly.

[0112] Example 5

[0113] Detection of the effect of metal ions on β-glucuronidase activity:

[0114] A certain concentration of MnSO4, KCl, NaCl, MgSO4, FeSO4, CuSO4, and CaCl2 solution was prepared, and the concentrated enzyme solution prepared in Example 1 was mixed evenly with each ion solution to make the final concentration of each ion in the mixed solution reach 2mM, and incubated at 40°C for 30min. The residual activity of the concentrated enzyme solution was determined according to the above method, and water was used instead of ion solution as a CK control group, and three parallel experiments were set up. The test results are shown in Tables 5 and Figure 8 .

[0115] Table 5

[0116]

[0117]

[0118] The catalytic activity of enzymes can be affected by metal ions, either inhibiting or promoting them. Figure 8 It can be seen that compared with the control group, Fe 2+ Mg 2+ It has a promoting effect on the β-glucuronidase, while Cu 2+ It has a significant inhibitory effect on the β-glucuronidase.

[0119] Example 6

[0120] Preparation of bilirubin:

[0121] Weigh 10.0 mg of bilirubin standard, dissolve it in chloroform in a 100 mL brown volumetric flask, add chloroform to the scale and shake well. Transfer 10 mL of chloroform solution to a 50 mL brown bottle, add 95% ethanol to dilute to the scale, this is the standard solution. Each milliliter of standard solution is equivalent to 0.00002 g of bilirubin. Measure 0, 1, 2, 3, 4, and 5 mL of the standard solution into a stoppered colorimetric tube, add 9, 8, 7, 6, 5, and 4 mL of 95% ethanol respectively, so that the amount of liquid in each colorimetric tube is 9 mL, then add 1 mL of diazotizing reagent respectively and mix well. After standing in the dark at 30°C for 30 minutes, measure the absorbance at a wavelength of 520 nm. OD 520 The vertical axis is the bilirubin concentration in each tube and the horizontal axis is the standard curve. Fig. 9 .

[0122] The concentrated enzyme solution prepared in Example 1 was collected and divided into two parts, one of which was used as a whole cell conversion solution, and the other was centrifuged, resuspended in a buffer solution, and then crushed as a crude enzyme solution. 1.5L of pig bile was measured, and the pH was slowly adjusted to 5.0 with acetic acid at 30°C, and 0.1wt% sodium bisulfite and 0.05wt% anhydrous magnesium sulfate were added. One group added the whole cell conversion solution, and the addition amount was 50% (volume fraction), and the other group added the crude enzyme solution, and the addition amount was 6% (volume fraction). The conversion reaction was carried out at pH = 5.0 and 40°C. After the reaction for 4 hours, the liquid phase and ultraviolet detection of bilirubin content were performed. The bilirubin yield of adding the whole cell conversion solution was 85%, and the bilirubin yield of adding the crude enzyme solution was 90%.

[0123] After the conversion, adjust the pH of the pig bile to 6.0, add 50% chloroform (volume fraction), stir for 3 minutes and then let it stand for 10 minutes, stir again for 3 minutes and then let it stand for 30 minutes, use a separatory funnel to separate the lower layer of liquid, and repeat this process twice. Put the lower layer of liquid into a rotary evaporator for rotary evaporation (the temperature must not exceed 85°C). After the rotary evaporation is completed, use boiling anhydrous ethanol to dissolve and collect bilirubin, filter, dry and weigh. The product after bilirubin extraction is shown in the figure Fig.10 , where 1 is the product after adding whole cell transformation solution, and 2 is the product after adding crude enzyme solution.

[0124] The purity of bilirubin obtained by extracting the product of the whole cell conversion solution is 95%, and the purity of bilirubin obtained by extracting the product of the crude enzyme solution is 98%.

[0125] The yield of bilirubin converted by crude enzyme is higher than that of bilirubin converted by whole cells, and the purity of bilirubin obtained by crude enzyme conversion is higher than that of bilirubin obtained by whole cells conversion.

[0126] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device.

[0127] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A β-glucuronidase, characterized in that The nucleotide sequence thereof is shown in SEQ ID NO:

1.

2. A β-glucuronidase according to claim 1, characterized in that The preparation steps of the β-glucuronidase are as follows: (1) Construction of recombinant plasmid: Use restriction endonucleases to insert the β-glucuronidase gene into the pET28a expression plasmid, screen positive clones, perform PCR amplification and enzyme digestion identification, and obtain the recombinant plasmid; (2) Transformation of recombinant plasmid: Transform BL21(DE3) competent cells with the recombinant plasmid to obtain a recombinant strain; (3) Induced expression: After activation culture, the recombinant strain was transferred to liquid LB medium containing Kan antibiotics and cultured with shaking until OD 600 The pH value is 0.6-0.8, and the inducer is added to perform low-temperature shaking culture to obtain the fermentation liquid, and the bacterial cells are collected after centrifugation; (4) Isolation and purification: Mix the bacteria with lysis buffer, resuspend by vortexing, and disrupt by ultrasonication; The cell disrupted liquid is centrifuged and the supernatant is taken to obtain a crude enzyme solution, which is then purified and dialyzed to obtain a finished product.

3. A β-glucuronidase according to claim 1, characterized in that The restriction endonucleases are BamHI and XhoI.

4. A β-glucuronidase according to claim 1, characterized in that The content of Kan antibiotic in the liquid LB culture medium containing Kan antibiotic is 50 μg / mL.

5. A β-glucuronidase according to claim 1, characterized in that: The shaking culture temperature was 37° C. and the shaking rate was 220 r / min.

6. A β-glucuronidase according to claim 1, characterized in that: The inducing agent is IPTG, the final concentration is 0.1 mM, the temperature of low-temperature shaking culture is 16° C., and the shaking rate is 220 r / min.

7. Use of the β-glucuronidase according to any one of claims 1 to 6 in the production of bilirubin, characterized in that: Bilirubin is prepared by the reaction of β-glucuronidase with the substrate pig bile.

8. The use of β-glucuronidase in bilirubin production according to claim 7, characterized in that: The steps for preparing bilirubin are as follows: The pH of pig bile was slowly adjusted with acetic acid, and a promoter, an antioxidant and β-glucuronidase were added. The conversion reaction was carried out at the optimal temperature. After 4 hours of reaction, the bilirubin content was detected by liquid phase and ultraviolet.

9. The use of β-glucuronidase in bilirubin production according to claim 8, characterized in that: The pH of the pig bile is adjusted to 4.5-5.5, and the optimum temperature is 30-50°C.

10. The use of β-glucuronidase in bilirubin production according to claim 8, characterized in that: The promoter is one of MgSO4 and FeSO4, and the antioxidant is sodium bisulfite.

Images