Method for improving high-temperature tolerance of pleurotus eryngii and application
By overexpressing the PeHMG12 gene in the cervix lateral ear, the problem of the bacteria's growth restriction under high temperature conditions was solved, which significantly improved its high temperature tolerance and antioxidant enzyme activity, and reduced energy consumption in production.
Patent Information
- Application Number
- CN202411647763.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-18
- Publication Date
- 2025-02-14
AI Technical Summary
The growth of the celery lateral ear is limited under high temperature conditions, resulting in the need of a large amount of energy for the temperature regulation of the mushroom room in factory production, which increases energy consumption and production costs.
The PeHMG12 gene was amplified by designing specific PCR amplification primers, constructed an overexpression vector, and introduced it into the protoplasts through PEG-mediated genetic transformation method to achieve high expression of the PeHMG12 gene.
Overexpression of PeHMG12 gene significantly improves the tolerance of the celestial lateral ear to high temperature, increases the growth rate of mycelium, improves antioxidant enzyme activity, and reduces the energy demand for the temperature regulation of mushroom room.
Smart Images
Figure CN119432895A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular breeding, and particularly relates to a method for improving the high temperature tolerance of Pleurotus eryngii and its application. Background Art
[0002] Pleurotus eryngii, also known as Pleurotus eryngii, belongs to the Basidiomycetes, Hymenomycetes, Agaricales, Pleurotaceae, and Pleurotus genus. It is a large, fleshy agaric with high quality and high edible value. In recent years, with people's pursuit of health and natural food, the market demand for Pleurotus eryngii has gradually increased, and the industry has an urgent need to update the cultivated strains.
[0003] The cultivation of edible fungi usually requires simulating their natural growth environment. Suitable temperature is a key factor in the growth of mycelium. Therefore, a lot of energy is consumed in controlling the temperature of the mushroom house during the production of edible fungi. Especially in the factory production of low-temperature edible fungi such as Flammulina velutipes, Pleurotus eryngii, and Agaricus nitida, the energy cost of regulating the temperature of the mushroom house may exceed more than one-third of the total production cost.
[0004] The suitable growth temperature of Pleurotus eryngii mycelium is 20℃ to 28℃. Cultivating new varieties that can grow normally in a wider temperature range and can tolerate temperature stress in low temperatures in winter and high temperatures in summer can significantly reduce the energy consumption caused by controlling the temperature in the mushroom house, making the factory production of Pleurotus eryngii more green, environmentally friendly and sustainable. Summary of the invention
[0005] The purpose of this section is to summarize some aspects of embodiments of the present invention and to briefly introduce some preferred embodiments.
[0006] The method for improving the high temperature tolerance of Pleurotus eryngii of the present invention comprises the following steps:
[0007] 1. Amplify the PeHMG12 gene by specific primers to construct an overexpression vector:
[0008] Specific PCR primers were designed (forward primer sequence: ATGCCCAAAGATACGAGCA, reverse primer sequence: TTAGGCATCAAAATCGCGAG), the genomic DNA of Pleurotus eryngii monokaryotic strain was used as a template to amplify the PeHMG12 gene, the carboxin resistance gene was used as a screening marker, and the Pleurotus eryngii GPD gene promoter was used to drive the PeHMG12 gene to construct the following sequence: Figure 1 The indicated genes were overexpressed in the vector p023-Pgpd-MRP1.
[0009] 2. PEG-mediated transformation of p023-Pgpd-MRP1 vector into protoplasts of Pleurotus eryngii:
[0010] This experiment used the PEG-mediated protoplast genetic transformation method. First, monokaryotic protoplasts were prepared, and then the DNA of the p023-Pgpd-PeHMG12 vector was obtained by plasmid extraction. The p023-Pgpd-MRP1 was introduced into the protoplast cells for genetic transformation through PEG mediation. The transformed strains resistant to carboxin obtained after transformation were tested by PCR. The results showed that all the transformed strains resistant to carboxin had the introduced exogenous DNA ( Figure 2 ).
[0011] 3. Obtaining strains with high expression of PeHMG12 gene through detection of transcription and translation levels:
[0012] We designed a Flag tag on the transformation vector that is expressed in the same frame as the PeHMG12 gene. We extracted proteins from mycelia of different transformed strains and separated them by polyacrylamide gel. We then used antibodies against the Flag tag to perform protein western detection. The results showed that all transformed strains could obtain hybridization bands of the expected size ( Figure 3 ), indicating that the PeHMG12 gene in the transformed strains we obtained can successfully express protein. In order to detect the expression level of PeHMG12 in the transformed strains, we performed qPCR detection on the transformed strains, and the results showed that the expression of PeHMG12 in all transformed strains was upregulated ( Figure 4 ).
[0013] 4. Overexpression of the PeHMG12 gene improves the tolerance of Pleurotus eryngii to high temperature stress:
[0014] We placed the PeHMG12 overexpression transformed strains 1, 4, 7 and the wild-type strain "183" in PDA medium and cultured them at 25°C for 20 days. Then, we punched holes on the outer edge (the diameter of the puncher was 6 mm) and inoculated them in the center of the PDA medium. We cultured them in a 33°C incubator, with three replicates for each strain. The results showed that the growth rate of the wild-type strain was basically stagnant at 33°C, while the growth rate of the PeHMG12 gene overexpression transformed strain was much faster than that of the wild-type strain ( Figure 5 The optimal growth temperature of Pleurotus eryngii is 25℃. When the temperature exceeds 30℃, its hyphae will hardly grow. Our experimental results show that the overexpression of PeHMG12 gene has a significant effect on the high temperature tolerance of Pleurotus eryngii, and has very good application prospects.
[0015] Beneficial effects of the present invention:
[0016] HMG (high mobility group)-box transcription factor is a special protein with a high mobility in polyacrylamide gel electrophoresis. As an important regulatory element in the cell, the transcription factor responds to external environmental signals to start downstream gene expression, thereby improving the adaptation of the organism to the external environment. The present invention systematically analyzes the HMG-box gene family members encoded in the genome of Pleurotus eryngii, identifies its role in high temperature response, and discovers a candidate gene PeHMG12 that can significantly improve the resistance of Pleurotus eryngii to high temperature stress. Overexpression of this gene in wild-type Pleurotus eryngii strains can accelerate the growth rate of mycelium, improve the activity of antioxidant enzymes, and more importantly, significantly improve the tolerance of Pleurotus eryngii to high temperature. Pleurotus eryngii is a low-temperature edible fungus. Factory production in summer requires a lot of energy to cool the mushroom house, and the energy cost exceeds one-third of the total cost. Applying the PeHMG12 gene discovered by the present invention to cultivated varieties through molecular breeding methods can significantly improve its high temperature tolerance, reduce energy consumption in production, and has good market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] In order to more clearly illustrate the technical solution of the embodiment of the present invention, the following briefly introduces the drawings required for describing the embodiment, wherein:
[0018] Figure 1 Figure 1 is a genetic transformation plasmid map for overexpressing the PeHMG12 gene;
[0019] Figure 2 Detection of exogenous DNA in transformed strains overexpressing the PeHMG12 gene;
[0020] Figure 3 Protein western hybridization verification of the transformed strains overexpressing the PeHMG12 gene;
[0021] Figure 4 Transcriptional expression detection of transformed strains overexpressing PeHMG12 gene;
[0022] Figure 5 Overexpression of the PeHMG12 gene improves the tolerance of Pleurotus eryngii to high temperature stress;
[0023] Figure 6 Phylogenetic tree of HMG-box family members in Pleurotus eryngii;
[0024] Figure 7 Protein domains of HMG-box family members of Pleurotus eryngii;
[0025] Figure 8 The distribution of HMG-box family members in the genome of Pleurotus eryngii;
[0026] Fig. 9 Gene structure analysis of HMG-Box family members in Pleurotus eryngii;
[0027] Fig.10 The conserved motif information of amino acid sequences of HMG-Box family members of Pleurotus eryngii;
[0028] Fig.11 Conserved motifs in the amino acid sequences of HMG-Box family members of Pleurotus eryngii;
[0029] Fig.12 Transcriptional expression analysis of HMG-box family members in Pleurotus eryngii;
[0030] Fig.13 Overexpression of the PeHMG12 gene accelerated the growth rate of the transformed strain;
[0031] Fig.14 Determination of antioxidant-related enzyme activities in the transformed strain overexpressing the PeHMG12 gene. DETAILED DESCRIPTION
[0032] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with specific embodiments.
[0033] 1. Amplify the PeHMG12 gene by specific primers to construct an overexpression vector:
[0034] Specific PCR primers were designed (forward primer sequence: ATGCCCAAAGATACGAGCA, reverse primer sequence: TTAGGCATCAAAATCGCGAG), the genomic DNA of Pleurotus eryngii monokaryotic strain was used as a template to amplify the PeHMG12 gene, the carboxin resistance gene was used as a screening marker, and the Pleurotus eryngii GPD gene promoter was used to drive the PeHMG12 gene to construct the following sequence: Figure 1 The indicated genes were overexpressed in the vector p023-Pgpd-MRP1.
[0035] (The selection marker carboxin resistance gene refers to Efficient transformation of Pleurotuseryngii with a safe selective marker mutated from the Pesdi1 gene, Journal of Microbiological Methods, 152 (2018) 7-9). The p023-Pgpd-MRP1 plasmid vector sequence is shown in SEQ ID NO: 1:
[0036]
[0037]
[0038]
[0039]
[0040] 2. PEG-mediated transformation of p023-Pgpd-MRP1 vector into protoplasts of Pleurotus eryngii:
[0041] This experiment used the PEG-mediated protoplast genetic transformation method. First, mononuclear protoplasts were prepared, and then the DNA of the p023-Pgpd-PeHMG12 vector was obtained by plasmid extraction. The p023-Pgpd-MRP1 was introduced into the protoplast cells for genetic transformation through PEG mediation. The transformed strains resistant to carboxin obtained after transformation were tested by PCR. The results showed that the transformed strains resistant to carboxin all had the introduced exogenous DNA ( Figure 2 ).
[0042] The steps for protoplast transformation are as follows:
[0043] 1. Mycelium culture: 100 ml YMG liquid culture medium was prepared in a 250 ml Erlenmeyer flask, and the mycelium plate was punched with holes for inoculation. The plate was cultured at 28°C and 120 rpm for 5 days.
[0044] 2. Use a sterilized homogenizer to break up the mycelium, repeat four times, 7 seconds each time, and culture overnight at 28°C and 120 rpm.
[0045] 3. Filter the mycelium with sterile non-woven fabric, wash twice with 0.5M sucrose, absorb the excess liquid, weigh 1g of mycelium into a 10ml sterile centrifuge tube, add 10ml of 1.5% cell-melting enzyme (dissolved in 0.5M sucrose), and digest at 31 degrees and 50rpm for 3 hours.
[0046] 4. Filter the protoplasts through sterile non-woven fabric into a 10 ml centrifuge tube, centrifuge at 2500 rpm for 5 minutes, resuspend with 0.5 M sucrose and STC solution respectively, and centrifuge at 2500 rpm for 5 minutes to collect the protoplasts.
[0047] 5. Resuspend the protoplasts with 0.2 ml STC, transfer to a 1.5 ml centrifuge tube, add 20 ul of plasmid DNA, and place on ice for 40 minutes, gently mixing several times.
[0048] 6. Add 1 ml of room temperature PTC, mix gently, and incubate at room temperature for 20 minutes, mixing gently several times.
[0049] 7. Take 300 μl of the transformation mixture and spread it on the YMG regeneration plate containing 2 μg / ml carboxin. After drying, place it upside down in a 25-degree incubator for culture. Positive transformants will appear in about a week.
[0050] 8. The reagents used in the following transformations were prepared with double distilled water and sterilized at 121°C for 20 minutes.
[0051] 0.5M sucrose
[0052] YMG: 10g / L glucose, 4g / L yeast extract, 10g / L malt extract, pH 7.0
[0053] YMGA: YMG with 2% agar
[0054] Screening medium: YMG containing 1.5% agar, 0.5M sucrose, 2μg / ml carboxin
[0055] STC: 18.2 g sorbitol, 5 ml 1M Tris-HCl pH 8.0, 5 ml 1M CaCl2, 0.5 M sucrose added to 100 ml
[0056] PTC: 40g PEG4000, 5ml 1M Tris-HCl pH8.0, 5ml 1MaCl2, 0.5M sucrose added to 100ml
[0057] 1.5% wall-melting enzyme: Prepared with 0.5 M sucrose and sterilized by filtration.
[0058] 3. Obtaining strains with high expression of PeHMG12 gene through detection of transcription and translation levels:
[0059] We designed a Flag tag on the transformation vector that is expressed in the same frame as the PeHMG12 gene. We extracted proteins from mycelia of different transformed strains and separated them by polyacrylamide gel. We then used antibodies against the Flag tag to perform protein western detection. The results showed that all transformed strains could obtain hybridization bands of the expected size ( Figure 3 ), indicating that the PeHMG12 gene in the transformed strains we obtained can successfully express protein. In order to detect the expression level of PeHMG12 in the transformed strains, we performed q PCR detection on the transformed strains, and the results showed that the expression of PeHMG12 in all transformed strains was upregulated ( Figure 4 ).
[0060] 4. Overexpression of the PeHMG12 gene improves the tolerance of Pleurotus eryngii to high temperature stress:
[0061] We placed the PeHMG12 overexpression transformed strains 1, 4, 7 and the wild-type strain "183" in PDA medium and cultured them at 25°C for 20 days. Then, we punched holes on the outer edge (the diameter of the puncher was 6 mm) and inoculated them in the center of the PDA medium. We cultured them in a 33°C incubator, with three replicates for each strain. The results showed that the growth rate of the wild-type strain was basically stagnant at 33°C, while the growth rate of the PeHMG12 gene overexpression transformed strain was much faster than that of the wild-type strain ( Figure 5 ). According to the known art, the optimal growth temperature of Pleurotus eryngii is 25°C, and when the temperature exceeds 30°C, its hyphae will hardly grow. The experimental results of the present invention show that the overexpression of the PeHMG12 gene has a significant effect on the high temperature tolerance of Pleurotus eryngii, and has a very good application prospect.
[0062] Embodiment 1:
[0063] Bioinformatics analysis of HMG-box transcription factor family members in Pleurotus eryngii:
[0064] 1. Sequence acquisition of HMG-box family members of Pleurotus eryngii
[0065] The fungal HMG-box domain (PF00505.21) model seed file was downloaded from the Pfam database (http: / / pfam.xfam.org / ). Based on the whole genome data of Pleurotus eryngii (MAZY00000000.1), the Pleurotus eryngii protein sequence file was compared with the seed file through the hidden Markov model constructed by the HMMER software, and the Pleurotus eryngii protein sequence containing the HMG-box structure was obtained. The sequences containing the HMG-box structure were further verified in the fungal transcription factor database TFDB (http: / / ftfd.snu.ac.kr / ). The results showed that the Pleurotus eryngii genome encodes 12 sequences containing the HMG-box structure, and the corresponding gene sequences were named PeHMG1 to PeHMG12 (Table 1).
[0066] 2. Sequence identification and physicochemical properties of each member of the HMG-box family of Pleurotus eryngii
[0067] According to the DNA and cDNA sequences of HMG-box family members of Pleurotus eryngii, CSDS (http: / / gsds.gao-lab.org / ) was used to analyze the gene structure. Click the GSDA2.0 option in the website, select Sequence (FASTA) in Format, enter the base sequence of CDS in the CDS Sequence dialog box, and enter the base sequence of the whole genome in the Genomic Sequence (FASTA) dialog box. Click Submit to get the results. The physicochemical characteristics, subcellular localization and signal peptide of HMG-box protein were analyzed using the online software Plant-mPLoc (http: / / www.csbio.sjtu.edu.cn / ), ProtParam tool (https: / / www.expasy.org / ), and SignalP-5.0 (https: / / services.healthtech.dtu.dk / services / SignalP-5.0 / ). The results showed that the length of the protein sequence ranged from 304 to 951 aa, the molecular weight was 34.1976 to 99.9785 kD, the isoelectric point was 5.32 to 11.26, the average isoelectric point was 7.3, and the overall properties of the protein were close to neutral. Among them, the isoelectric point of one protein exceeded 10, with a value of 11.26; there were also four proteins with isoelectric points lower than 6, with values of 5.32, 5.43, 5.91, and 5.86. The isoelectric points of these proteins are too high or too low, which is usually related to the types of amino acids contained in the protein. For example, if there are a large number of basic amino acids (such as lysine, arginine, and histidine), the isoelectric point of the protein is alkaline; if there are a large number of acidic amino acids (such as aspartic acid and glutamic acid), the isoelectric point of the protein will be acidic. The total average hydrophilicity of the HMG-box members of Pleurotus eryngii is less than 1, indicating that all Pleurotus eryngii proteins are hydrophilic proteins. Subcellular localization results showed that all HMG-box proteins were located in the nucleus, which is consistent with the characteristics of transcription factors that require the nucleus to bind to DNA to exert transcriptional regulation. Signal peptide analysis of HMG-box proteins revealed that all proteins had no signal peptides and were non-secretory proteins.
[0068] 3. Phylogenetic tree analysis of each member of the HMG-box family of Pleurotus eryngii
[0069] In order to understand the evolutionary relationship between its family members, the MAGE10 software was used to construct an evolutionary tree of the protein sequences of the HMG-box gene family using the neighbor-joining method. The results showed that PeHMG1, PeHMG7, PeHMG11, PeHMG1, PeHMG4, PeHMG3, and PeHMG12 were clustered together, while PeHMG2, PeHMG6, PeHMG5, PeHMG10, PeHMG9, and PeHMG9 were clustered together. PeHMG8 was distantly related to the other members ( Figure 6 ).
[0070] 4. Structural domain analysis of HMG-box family members in Pleurotus eryngii
[0071] The protein sequences containing HMG-box structure were extracted using TBtools software, and the conserved domains of the protein sequences obtained by the search were further verified using NCBI's Batch CD-Search search tool, and the domain distribution map of HMG-box family members was drawn using TBtools software. The results showed that the protein sequences of the 12 HNG-box family members had the conserved domains of HMG-box-SF-superfamily (cl00082) and HMG-box (cd01390390), which are typical of HMG-box transcription factors. There were two HMG-box-related conserved domains in the PeHMG4 gene, and the remaining 11 proteins contained only one HMG-box-related conserved domain ( Figure 7 ).
[0072] 5. Distribution and structural analysis of HMG-box family members in the genome of Pleurotus eryngii
[0073] Gene Structure Display Server (http: / / gsds.gao-lab.org / ) was used to analyze the gene structure. Click the GSDA2.0 option in the website, select Sequence (FASTA) in Format, enter the base sequence of CDS in the CDSSequence dialog box, and enter the base sequence of the whole genome in the Genomic Sequence (FASTA) dialog box. The analysis results showed that the HMG-box family members were distributed on 11 scaffolds in the genome, and only PeHMG2 and PeHMG10 were distributed on the same scaffold with an interval greater than 100Kb ( Figure 8 ). Its gene family is dispersed in the genome, which may lead to different expression regulation patterns for each member.
[0074] The gene structure analysis diagram shows the exon-intron structure of HMG-box transcription factors. The HMG-box gene family contains 2 to 5 exons, of which PeHMG4 and PeHMG6 contain 5 exons, PeHMG2, PeHMG3, PeHMG5 and PeHMG7 contain 4 exons, PeHMG1, PeHMG8 and PeHMG9 contain 3 exons, PeHMG10, PeHMG11 contain PeHMG12 contains 2 exons. The number of exons and introns of transcription factors in the same subfamily is the same, and the structure is relatively similar, indicating that the gene structure of transcription factors with similar affinity is highly conserved ( Fig. 9 ).
[0075] 6. Motif analysis of HMG-box family members in Pleurotus eryngii
[0076] The online analysis tool MEME (https: / / meme-suite.org / meme / ) was used to perform motif analysis on the HMG-box transcription factor gene family of Pleurotus eryngii. The motif diagram of the transcription factor was drawn using the TBtools software, and the amino acid conservation was analyzed by observing the map. The results showed 10 motifs of the HMG-box transcription factor protein of Pleurotus eryngii, which were named Motif1 to Motif10 ( Fig.10 ), and in the protein sequence of the Pleurotus eryngii transcription factor, each protein sequence contains Motif1 and Motif2 ( Fig.11 ), indicating that Motif1 and Motif2 are the most widely distributed and most conserved in the protein sequence of Pleurotus eryngii HMG-box transcription factors. The proteins of HMG-box transcription factors with close genetic relationship almost have the same Motif, but the distribution position of their Motif is different. There are also some HMG-box transcription factor proteins with large differences in Motif, which are generally proteins in different subfamily and have distant genetic relationship, resulting in different numbers of protein Motifs.
[0077] 7. Analysis of cis-acting elements in promoters of HMG-box family members of Pleurotus eryngii
[0078] The cis-acting elements were analyzed using the online analysis software PlantCARE (PlantCARE, a database of plant promoters and their cis-acting regulatory elements (ugent.be)). The results showed that the promoter region of the HMG-box gene family of Pleurotus eryngii contained common elements in the promoter and enhancer regions. Among them, 11 genes contained methyl jasmonate response regulatory elements, 9 genes contained light response regulatory elements, abscisic acid response elements and meristem expression regulatory elements, 6 genes contained zein metabolism regulatory elements and anaerobic induction regulatory elements, 5 genes contained temperature response elements, 4 genes contained salicylic acid response elements and gibberellin response elements, and 2 genes contained endosperm expression regulatory elements. In addition, only one gene contained auxin response regulatory elements and circadian rhythm control regulatory elements.
[0079] Expression analysis of transcriptional levels of members of the HMG-box transcription factor family in Pleurotus eryngii:
[0080] Transcriptome sequencing and q-PCR were used to analyze the expression pattern of the HMG-box gene family in the monokaryotic strain 183 (A2B2) and the dikaryotic strain XH (A1B1+A2B2). The primers used for qPCR analysis are shown in Table 2. The actin gene of Pleurotus eryngii was used as the internal reference gene for fluorescence quantitative detection. The total reaction volume was 20 μL: (TB Greenll 10 μL, forward and reverse 10 μm primers 0.8 μL each, 50×ROX 0.4ul, ddH2O 6.0 μL, cDNA 2.0 μL) Reaction conditions: 95℃ pre-denaturation for 20s; 95℃ denaturation for 5s, 60℃ annealing for 15s, 72℃ extension for 15s, 40 cycles; 3 replicates were set for each sample, using 2 -ΔΔCT The relative gene expression was calculated and converted into log2FC.
[0081] The results of transcriptome sequencing and q-PCR analysis showed that the HMG-box gene was expressed in both mononuclear and binuclear forms of Pleurotus eryngii, and the transcriptome sequencing and q-PCR performance trends were consistent ( Fig.12). The expression levels of genes PeHMG2, PeHMG4, PeHMG5 and PeHMG8 in monokaryons were significantly higher than those in binucleons. The expression levels of genes PeHMG1, PeHMG3, PeHMG6, PeHMG9, PeHMG10, PeHMG11 and PeHMG12 in binucleons were significantly higher than those in monokaryons. The difference in the expression levels of PeHMG12 between monokaryons and binucleons was particularly significant. We speculated that this gene is likely to play an important role in the growth, development and environmental response of binucleate strains of Pleurotus eryngii. Next, we constructed an overexpression vector for the PeHMG12 gene for genetic transformation analysis.
[0082] Overexpression of PeHMG12 in Pleurotus eryngii increased the antioxidant-related enzyme activities of the transformed strain:
[0083] 1. Comparison of growth rates of transformed strains
[0084] We selected some transformed strains with high expression levels and wild-type strains for growth rate comparison. A 0.6 cm sterile punch was used to punch holes at the edge of the culture dish hyphae of the cultured strains, and then inoculated onto PDA solid medium and placed in an incubator at 25°C. The growth status of the hyphae was continuously observed and measured. The results showed that the growth rate of the strain after PeHMG12 overexpression was significantly accelerated, with a significant difference compared with the wild-type strain ( Fig.13 ).
[0085] 2. Determination of antioxidant-related enzyme activities in PeHMG12 overexpression transformed strains
[0086] We measured the antioxidant enzyme activities of the transformed strains overexpressing the PeHMG12 gene and the wild-type monokaryotic strain "183" and found that the activities of POD, SOD, and PPO enzymes were significantly higher than those of the wild-type strain "183" ( Fig.14 Previous studies have shown that increased antioxidant enzyme activity can promote cell resistance to adverse stress. The increased activity of antioxidant-related enzymes in PeHMG12 overexpression transformed strains may be the reason for the transformed strains' tolerance to adverse stress.
[0087] Table 1 Basic properties of Pleurotus eryngii HMG-box transcription factor family
[0088]
[0089] Table 2 Primers used for qRT-PCR analysis of HMG-box gene family members in Pleurotus eryngii
[0090]
[0091]
[0092] The nucleotide sequence of the HMG-box transcription factor encoding gene PeHMG12 is shown in SEQ ID NO: 2:
[0093] SEQ ID NO: 2
[0094]
[0095] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.
Claims
1. A method for improving the high temperature tolerance of Pleurotus eryngii, characterized in that: The HMG-box transcription factor encoding gene is overexpressed in Pleurotus eryngii, wherein the HMG-box transcription factor encoding gene is the PeHMG12 gene, and the PeHMG12 gene sequence is shown in SEQ ID NO:
1.
2. The method for improving the high temperature tolerance of Pleurotus eryngii according to claim 1, characterized in that: The overexpression includes utilizing the Pleurotus eryngii GPD gene promoter to drive the overexpression of the PeHMG12 gene.
3. The method for improving high temperature tolerance of Pleurotus eryngii according to claim 1 or 2, characterized in that: The plasmid vector containing the PeHMG12 gene was used to genetically transform the protoplasts of Pleurotus eryngii to obtain a transformed strain overexpressing the PeHMG12 gene.
4. The method for improving the high temperature tolerance of Pleurotus eryngii according to claim 3, characterized in that: The plasmid vector containing the PeHMG12 gene uses the carboxin resistance gene as a screening marker.
5. The method for improving the high temperature tolerance of Pleurotus eryngii according to claim 3, characterized in that: The protoplast genetic transformation includes PEG-mediated protoplast genetic transformation.
6. The method for improving high temperature tolerance of Pleurotus eryngii according to claim 1 or 2, characterized in that: The PeHMG12 gene amplification primer sequences are: forward primer sequence: ATGCCCAAAGATACGAGCA, reverse primer sequence: TTAGGCATCAAAATCGCGAG.
7. Use of the method for improving high temperature tolerance of Pleurotus eryngii according to claim 1 in breeding of Pleurotus eryngii.
8. The use according to claim 7, characterized in that: The Pleurotus eryngii overexpressing the PeHMG12 gene was inoculated into a culture medium and cultured at 30-33°C.
9. The use according to claim 8, characterized in that: The culture medium includes potato dextrose agar medium.