Primer probe combination for rapidly detecting T4-type acanthamoeba protozoa by using RPA-LFS and use method of primer probe combination

Abstract

The invention relates to the technical field of microbiological detection, in particular to a primer and probe combination for rapidly detecting T4 type acanthamoeba protozoa by using RPA-LFS and a use method of the primer and probe combination. A downstream primer is [5 '-biotin]-GACTTGATGTTGTTGGGGGATCCACTCGAC; the method comprises the following steps of: designing a probe, wherein the probe is [FITC]-TGG CCGAGATTACCCAGCAAATCTTCGATG [dSpacer] CCAAGAACATATGG [3 'C3Spacer], and the probe is used for detecting the temperature of the probe; an upstream primer is not needed. According to the primer probe combination for rapidly detecting the T4-type acanthamoeba protozoa by using the RPA-LFS and the use method thereof, the established RPA-LFS detection method only needs a very small amount of DNA templates, the lowest DNA template dosage detected at present is 15.5 * 10 <-4 > ng per reaction, the dependence on laboratory equipment is overcome, field detection can be performed under bedside and home conditions, the operation is simple, the cost is low, and the primer probe combination is suitable for large-scale popularization and application. The method does not depend on high-quality technicians, so that patients and the masses can carry out detection, the detection process is simplified, and the detection period is shortened.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial detection, and in particular to a primer-probe combination for rapidly detecting T4 type Acanthamoeba by using RPA-LFS and a method for using the same. Background Art

[0002] Acanthamoeba is a protozoan widely distributed in nature. When it infects the cornea, it can cause Acanthamoeba keratitis, a serious blinding eye disease with the main clinical features of severe eye pain, annular stromal keratitis and corneal radial neuritis. The diagnosis and treatment of this disease are often difficult. Literature reports that 52% to 88.9% of patients with Acanthamoeba keratitis are contact lens wearers. In recent years, with the popularity of orthokeratology lenses used for myopia prevention and control and cosmetic contact lenses worn by adults when putting on makeup, the incidence of Acanthamoeba keratitis has increased year by year. Amebas in contact lenses, lens cases, contact lens care solutions and household tap water are often the source of amebas, and timely and convenient detection may provide effective prevention for the occurrence of this disease.

[0003] Most strains of Acanthamoeba that infect the cornea belong to a specific genotype, among which the T4 type is the most common, accounting for about 96% of the total. Laboratory examination methods for Acanthamoeba mainly include corneal scraping examination, pathogen culture and molecular diagnosis. Among them, the corneal scraping method requires sampling on the diseased cornea and then observing it after special staining, while pathogen culture requires special culture conditions. Molecular diagnosis uses PCR detection as an internationally recognized rapid and sensitive method for detecting Acanthamoeba, but this method requires laboratory equipment such as PCR gene amplification instruments and professional technicians, and it often takes more than an hour to complete more than 30 high-temperature and low-temperature switching, which is difficult to meet the rapid on-site detection of pathogenic microorganisms or even the public's own home detection. Compared with PCR, recombinase polymerase amplification (RPA) technology is simpler and faster, and its specificity and sensitivity are comparable to PCR. This technology not only overcomes the defects of traditional PCR technology in obtaining single-stranded templates through high-temperature denaturation, but also avoids the process of heating and cooling, and does not require temperature control equipment, which greatly reduces the cost of detection. Lateral flow strips (LFS) are easy-to-use paper-based devices that can visualize test results. Therefore, it is crucial to establish a simple and rapid molecular detection method using RPA-LFS technology for the rapid diagnosis of Acanthamoeba. Summary of the invention

[0004] The object of the present invention is to provide a primer-probe combination for rapid detection of T4-type Acanthamoeba using RPA-LFS and a method of using the same. The primer-probe combination has high sensitivity and specificity, and can provide a diagnostic basis for bedside and home rapid detection. The detection method of T4-type Acanthamoeba RPA-LFS only requires a water bath or a hand-held reaction tube to control the temperature for detection, which reduces dependence on laboratory conditions and labor costs, shortens the detection time cost, and has high sensitivity and specificity, and can provide a diagnostic basis for rapid detection.

[0005] To achieve the above object, the present invention provides the following technical solution: a primer-probe combination for rapid detection of T4-type Acanthamoeba using RPA-LFS, wherein the primers are designed as follows: Downstream primer: [5'-biotin]-GACTTGATGTTGTTGGGGATCCACTCGAC Probe design: Probe: [FITC]-TGGCCGAGATTACCCAGCAAATCTTCGATG[dSpacer]CCAAGAACATCATGG [3'C3spacer] No upstream primer is required.

[0006] Preferably, the 5' end of the probe is labeled with FITC, a 3C-spacer is introduced at the 3' end for end blocking, and THF (dSpacer) is introduced in the middle of the probe, that is, a purine-free and pyrimidine-free site (AP site).

[0007] Preferably, the 5' end of the downstream primer is labeled with biotin.

[0008] A method for using a primer-probe combination for rapid detection of T4-type Acanthamoeba using RPA-LFS, which is used for RPA-LFS specific detection, RPA-LFS reaction temperature optimization, RPA-LFS hand-held reaction tube temperature sensitivity detection, RPA-LFS reaction time optimization, and RPA-LFS minimum detection limit determination.

[0009] Compared with the prior art, the present invention has the following beneficial effects: 1. The primer-probe combination and the use method for rapid detection of T4-type Acanthamoeba using RPA-LFS scientifically and effectively combine the RPA technology and the LFS technology, and establish an RPA-LFS method for rapid on-site detection of T4-type Acanthamoeba. The established RPA-LFS detection method can complete the detection within 20 minutes. Compared with the detection method based on PCR technology, it simplifies the detection conditions and shortens the detection time. 2. The primer-probe combination and its use method for rapid detection of T4-type Acanthamoeba using RPA-LFS. The established RPA-LFS detection method only requires a very small amount of DNA template. The minimum amount of DNA template currently detected is 15.5*10 -4 ng, which is equivalent to one thousandth of the template required for the detection method of PCR technology. It overcomes the dependence on laboratory equipment and can be tested on-site at the bedside or at home. It only needs a water bath or a hand-held reaction temperature controller to perform the test. It is simple to operate and does not rely on highly qualified technicians, allowing patients and the public to perform the test and simplifying the detection process. 3. The primer-probe combination and the method of using the RPA-LFS for rapid detection of T4-type Acanthamoeba realize visual detection, and the test results can be determined by color development reaction, so that doctors and ordinary people can judge the results without the aid of any instruments or facilities. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0011] Figure 1 This is a graph showing the detection results of clinical specimens using the RPA-LFS method of the present invention; Figure 2 This is a diagram of the RPA-LFS probe and primer reaction results of the present invention; Figure 3 This is a graph showing the specific detection results of RPA-LFS of the present invention; Figure 4 This is a graph showing the minimum detection limit of the RPA-LFS reaction when the genomic DNA is above 3.1×10-4 ng / μL in the present invention; Figure 5 This is a graph showing the minimum detection limit of the RPA-LFS reaction under 33°C of the present invention; Figure 6 This is a graph comparing the detection results of the qPCR method of the present invention and this method. DETAILED DESCRIPTION

[0012] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0013] The present invention provides a technical solution: a primer-probe combination for rapid detection of T4-type Acanthamoeba using RPA-LFS, wherein the primers are designed as follows: Downstream primer: [5'-biotin]-GACTTGATGTTGTTGGGGATCCACTCGAC Probe design: Probe: [FITC]-TGGCCGAGATTACCCAGCAAATCTTCGATG[dSpacer]CCAAGAACATCATGG [3'C3spacer] No upstream primer is required.

[0014] The 5' end of the probe was labeled with FITC, a 3C-spacer was introduced at the 3' end for end blocking, and THF (dSpacer) was introduced in the middle of the probe, i.e., a purine-free and apyrimidine-free site (AP site); The 5' end of the downstream primer is labeled with biotin.

[0015] Standard strains and clinical isolates: Taking T4 Acanthamoeba as the research object, a primer-probe combination for RPA-LFS detection of Acanthamoeba was established. The longest exon fragment 150082-150689 of tubulin beta chain of Acanthamoeba castellanii str.Neff strain ATCC30010 in Pubmed-Gene database was used as template (Gene ID: 14925210) to design detection primers and probes.

[0016] One T4-type Acanthamoeba standard strain and six T4-type Acanthamoeba clinical isolates were collected, which were mainly from eye swabs and corneal tissues of patients diagnosed with Acanthamoeba keratitis, provided by Beijing Institute of Ophthalmology. In addition, DNA samples of seven other common clinical pathogenic microorganisms causing ocular surface infections were collected, including human herpesvirus type 1, varicella zoster virus, human herpesvirus type 2, Staphylococcus aureus, Pseudomonas aeruginosa, Fusarium solani, and Candida albicans for specific analysis of the RPA-LFS detection system. These seven strains were provided by Beina Biotechnology.

[0017] Table 1 lists the strains used in the study.

[0018] Extraction of microbial genomes: Purified genomic DNA was used as a template to construct the RPA-LFS system. Genomic DNA was extracted from clinical microbial samples using the DNA extraction kit QIAamp DNA Mini Kit (Qiagen, Beijing, China) and stored at -20°C for future use.

[0019] (1) Primer design for RPA reaction: The tubulin beta gene of Acanthamoeba castellanii str. Neff was used as the specific target of the detection system. Primers were designed using Primer Premier 6 software. The parameters were set as follows: the primer length was generally controlled within the range of 29-35bp, the product size was controlled within the range of 100-500bp, and the GC content was 20%-70%. Based on this standard, three pairs of primers were designed and screened for synthesis.

[0020] (2)RPA reaction: RPA reaction was performed using RPA amplification kit (basic type, Ampo Future). According to the product manual, 50μL RPA reaction system was prepared, and 29.4μL A buffer, 2μL upstream and downstream primers (10μM), 5μL genomic DNA template, 9.1μL enzyme-free water were added to each dry powder reaction tube. Finally, 2.5μL B buffer was added to the lid of the reaction tube. The solution in the reaction tube was fully mixed by turning it upside down for 1 second, and centrifuged for 1 second, alternating 3 times. The reaction tube was placed in a 37℃ metal bath and incubated for 30 minutes. After the RPA reaction was completed, an equal volume of Tris-saturated phenol-chloroform-isoamyl alcohol (25:24:1) mixture was added, and centrifuged at 12000rpm for 15 minutes at 4℃. 10μL supernatant was taken and added to 2μL DNA loading buffer (6x, Thermo Fisher). 1XTBE was used to heat and dissolve high-resolution agarose (Wobo Bio) to prepare a 2% gel, and the DNA sample was added to the gel sample well, and the RPA reaction product was observed by electrophoresis.

[0021] (3) Design of probe for RPA-LFS reaction: Probe design was performed for the three sets of primers selected for the RPA reaction. The 5' end of the front primer was modified with the fluorescent group FITC, the 3' end was connected to the THF group, and then continued 15 bases backward and ended with a C3 blocker C3-spacer. The 5' end of the rear primer was labeled with biotin.

[0022] (4)RPA-LFS program: RPA-LFS reaction was performed using the RPA amplification kit (colloidal gold probe type, Anpu Future). According to the product manual, 50μL RPA reaction system was prepared. 29.4μL A buffer, 0.4 probe (10μM), 2μL biotin-modified downstream primer (10μM), 5μL genomic DNA template, 10.7μL enzyme-free water were added to each dry powder reaction tube. Finally, 2.5μL Bbuffer was added to the lid of the reaction tube. Mix the solution in the reaction tube upside down for 1 second, centrifuge for 1 second, and alternate 3 times. According to the instructions, the reaction tube was placed in a 37℃ metal bath and incubated for 15 minutes. Take 5μL of the amplified product and add 45μL double distilled water to dilute 10 times, insert the single target Hybrid Detect lateral chromatography test strip (rainbow type, Wobo Bio), and read the test results within 2 minutes. If a blue band is observed on the quality control line and a red band is observed on the detection line at the same time, it is positive; if only a blue band is observed on the quality control line, it is negative.

[0023] (5) Optimization of RPA-LFS reaction conditions: The RPA-LFS system is affected by reaction time and temperature. To determine the optimal reaction conditions, the reaction system was incubated at a certain temperature for 0, 4, 8, 12, 14, 16, and 20 minutes to screen the optimal reaction time of RPA-LFS; the reaction system was incubated at 24, 27, 30, 33, 36, 39, 42, and 44°C for 14 minutes to screen the optimal reaction temperature of RPA-LFS.

[0024] (6) Minimum detection limit analysis: The RPA-LFS reaction was carried out at the optimal reaction temperature and 33℃ with 10-fold serial dilution of Acanthamoeba genomic DNA, and the minimum detection limit of the method was determined under the two conditions.

[0025] (7) Clinical sample testing: Clinical samples were detected using RPA-LFS and qPCR methods respectively to evaluate the practical application value of RPA-LFS in clinical specimen detection.

[0026] The results are as follows: RPA primer design and screening: Three pairs of primers were designed based on the specific target of the Acanthamoeba tubulin beta gene as the detection system (Table 2). Using the T4-type Acanthamoeba genomic DNA as the template, the three primer pairs were subjected to basic RPA reaction. The DNA samples after the reaction were extracted and electrophoresed by 2% high-resolution agarose gel. The amplification primers of the three primer pairs were between 100-300bp, and no primer dimers were generated. In the no template control group (No Template Control, NTC) without primers, there were no obvious amplification product bands ( Figure 1 A). All three primer sets can amplify efficiently and specifically, so probe modification was performed on all three primer pairs, and the amplification efficiency of the probes was tested by RPA-LFS test.

[0028] Table 2 Primer sequences for RPA reaction

[0029] Note: F represents the upstream primer; R represents the downstream primer Improvement and determination of the optimal primer-probe combination in the RPA-LFS system: Design probes according to the upstream primers of the three primer pairs (Table 3), such as Figure 1 B. In the presence of DNA template, blue and red bands can be observed on the quality control line and detection line of the LFS test strips of the three primer-probe combinations, indicating that the three primer-probe combinations can effectively amplify positive bands with both Biotin and FITC. In the control group without template, the LFS test strip of group 3 (F3 / Probe 3) also showed positive results, indicating that this group of primers and probes had false positive results. In contrast, the positive results of group 1 (F1 / Probe 1) and group 2 (F2 / Probe 2) were true, and both the LFS and electrophoresis bands of group 1 showed higher amplification efficiency, that is, more concentrated amplification bands and deeper detection line signals. Therefore, the results of group 1 and group 2 were consistent with expectations, and the amplification efficiency of group 1 was the best. In this way, a primer-probe combination for the specific detection of Acanthamoeba was obtained.

[0030] Table 3 RPA-LFS probe and primer sequences

[0031] Note: Probe stands for probe; R stands for downstream primer.

[0032] Optimization of RPA-LFS reaction conditions: Adjust the reaction time and temperature to optimize the RPA-LFS reaction conditions. According to the RPA kit instructions, the reaction temperature was controlled at 37°C, and the reaction time was set to 0-24 minutes, with an interval of 4 minutes, for a total of 8 groups. Figure 2 As shown in A, positive bands can be seen in the detection strips in the 8-minute and 12-minute reaction groups, while the bands in the 14-minute group and subsequent longer reaction time groups are clear and bright, so 14 minutes is the optimal reaction time.

[0033] Under the condition that the reaction time is controlled at 14 minutes, the optimal reaction temperature is detected at a temperature gradient of 24, 27, 30, 33, 36, 39, 42, and 44°C. Figure 2 As shown in B, the reaction had a relatively obvious positive band in the 30℃ group, and clear and bright reaction bands were present in the 36℃-42℃ reaction groups, so 36℃ was the optimal reaction temperature.

[0034] RPA-LFS Detection Specificity Analysis: To verify the detection specificity of the RPA-LFS reaction system for T4-type Acanthamoeba, 7 other common pathogens that cause corneal infection and 6 T4-type Acanthamoeba genomic DNA samples from clinical samples were tested. Figure 3 As shown in A, when the genomic DNA of non-target pathogens was used as the RPA-LFS reaction template, no positive reaction signal was observed on the detection line; on the contrary, Figure 3 As shown in B, when the T4-type Acanthamoeba genomic DNA was used as a template for detection, all samples produced a clearly visible positive signal on the detection line. The results showed that the RPA-LFS detection system we constructed has a high degree of specific recognition ability for T4-type Acanthamoeba, while eliminating the potential risk of cross-reaction with other common pathogens that cause corneal infections.

[0035] RPA-LFS detection sensitivity analysis: To evaluate the sensitivity of the RPA-LFS reaction system, 10-fold serial dilutions of Acanthamoeba genomic DNA (3.1×10, 3.1×10 0 , 3.1×10 -1 , 3.1×10 -2 , 3.1×10 -3 , 3.1×10 -4 ng / μL) as the template for detection. Figure 4 As shown, when the genomic DNA is 3.1×10 -4 ng / μL, the detection line showed positive signals, indicating that the minimum detection limit of RPA-LFS reaction can reach 15.5*10 -4 ng.

[0036] RPA-LFS detection sensitivity analysis under the condition of holding the reaction tube: The temperature inside a single 200 μL centrifuge tube is generally 27-36°C. To evaluate the detection sensitivity of the RPA-LFS reaction system under home conditions, 10-fold gradient dilutions of Acanthamoeba genomic DNA (3.1×10 2 , 3.1×10, 3.1×10 0 , 3.1×10 -1 , 3.1×10 -2 , 3.1×10 -3 , 3.1×10 -4 ng / μL) as the template, and the detection was performed at the general temperature of the hand-held reaction tube, 33°C. Figure 5 As shown, when the genomic DNA is 3.1×10 -3 to 3.1×10 -2 ng / μL, the detection line showed a weak positive signal, indicating that the minimum detection limit of RPA-LFS reaction at 33°C was 3.1×10 -3 When the concentration is above ng / μL, the test line shows a positive signal.

[0037] Application of RPA-LFS in clinical specimen testing: The detection results of qPCR method and this method were compared. Figure 6 As shown in the figure, the clinical specimens of genomic DNA of 9 pathogenic microorganisms were subjected to RPA-LFS and qPCR respectively. The results showed that both methods detected 6 positive Acanthamoeba, but the minimum detection limit of this RPA-LFS method was 3.1×10 -4 ng / μL level, while the minimum detection limit of qPCR method is 3.1ng / μL.

[0038] By utilizing recombinase polymerase amplification (RPA) combined with lateral flow strips (LFS) technology, the present invention has developed a simple and easy method for detecting T4-type Acanthamoeba. The present invention uses the tubulin beta gene of Acanthamoeba castellanii str. Neff as the specific target of the detection system to design RPA reaction primers, which are further transformed into RPA-LFS reaction probes to screen out the most efficient and specific primer-probe combination. The optimal detection time and the optimal reaction temperature were optimized respectively, and it was determined that the optimal reaction conditions for the RPA-LFS reaction were 14 minutes and 36°C. The specificity and sensitivity of the detection method of the present invention were evaluated respectively, and it was clarified that the detection method developed by the present invention does not react with other common corneal pathogenic microorganisms, and the minimum detection template amount is 15.5*10-4 ng. Under the conditions of home testing, the minimum template amount detected when the reaction temperature is lowered to 33°C is 15.5*10 -3 By comparing the consistency between the RPA-LFS method and the qPCR test results, it was confirmed that the detection system has the same positive rate as the PCR test and has a lower requirement for the amount of template, which shows that it has good prospects for clinical application.

[0039] As a room temperature and efficient nucleic acid amplification method, RPA technology, combined with LFS technology, can break the dependence of nucleic acid detection on laboratory conditions, and achieve the effect of rapid amplification and instant visualization of test results in a short time. Acanthamoeba is a protozoan with strong vitality widely distributed in nature. In recent years, it has been reported that the infection rate of Acanthamoeba keratitis has increased due to its presence in contact lenses, lens cases, contact lens care solutions and household tap water. The users of products such as contact lenses, orthokeratology lenses and cosmetic lenses are often children and young people. The vision threat caused by Acanthamoeba infection is serious and far-reaching. Most strains of Acanthamoeba that infect the cornea belong to specific genotypes, among which T4 is the most common, accounting for about 96% of the total. The method for rapid detection of T4-type Acanthamoeba established by the present invention is expected to be completely free from dependence on laboratory conditions and realize home detection under the condition of appropriate DNA extraction reagents.

[0040] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, the elements defined by the statement "comprise a ..." do not exclude the presence of other identical elements in the process, method, article or device including the elements.

[0041] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A primer-probe combination for rapid detection of T4-type Acanthamoeba using RPA-LFS, characterized in that: Primer design: Downstream primer: [5'-biotin]-GACTTGATGTTGTTGGGGATCCACTCGAC Probe design: Probe: [FITC]-TGGCCGAGATTACCCAGCAAATCTTCGATG[dSpacer]CCAAGAACATCATGG [3'C3spacer] No upstream primer is required.

2. The primer-probe combination for rapid detection of T4-type Acanthamoeba using RPA-LFS according to claim 1, characterized in that: The 5' end of the probe is labeled with FITC, a 3C-spacer is introduced into the 3' end for terminal blocking, and THF (dSpacer) is introduced into the middle of the probe, namely, a purine and apyrimidine site (AP site).

3. The primer-probe combination for rapid detection of T4-type Acanthamoeba using RPA-LFS according to claim 1, characterized in that: The 5' end of the downstream primer is labeled with biotin. The primer-probe combination is used for the RPA-LFS detection of T4-type Acanthamoeba and is the best primer-probe combination.

4. The primer-probe combination for rapid detection of Acanthamoeba using RPA-LFS and the method for using the same according to any one of claims 1 to 3, characterized in that: It is highly specific for the detection of T4-type Acanthamoeba. The interpretation of LFS results is simple and intuitive. The optimal reaction temperature of RPA-LFS is 36°C. The optimal reaction time of RPA-LFS is 14 minutes. The minimum detection template amount of RPA-LFS for T4-type Acanthamoeba is 15.5*10 -4 ng.

Images