Portable field tobacco root black rot protogen rapid diagnosis and identification kit

Abstract

The invention discloses a portable field tobacco root black rot protogen rapid diagnosis and identification kit, belongs to the technical field of tobacco root black rot detection, and discloses an upstream primer, a downstream modified primer and a multi-site modified probe, the nucleotide sequences of which are respectively SEQ ID NO.1-SEQ ID NO.7, and the nucleotide sequences of which are respectively SEQ ID NO.2-SEQ ID NO.7. Meanwhile, a simple kit for detecting the black root rot of tobacco is prepared by utilizing the probe and the primer, and the problem that the pathogen of the black root rot of tobacco is difficult to detect in the field without complex equipment at present is solved.

Description

Technical Field

[0001] The invention relates to the technical field of tobacco root black rot detection, and in particular to a portable field tobacco root black rot pathogen rapid diagnosis method and primers, probes and a kit. Background Art

[0002] Tobacco root black rot is a soil-borne rhizome disease caused by the mycorrhizal fungus Thielaviopsis basicola infecting tobacco roots. It is highly concealed and difficult to distinguish from Fusarium root rot. There is also an incubation period during the infection process. Accurate identification and monitoring of it are the primary conditions for achieving precise prevention and control of tobacco root black rot.

[0003] Early and rapid diagnosis of tobacco root black rot can provide an important basis for precise application of pesticides for tobacco root black rot prevention and control, and is an important foundation for the promotion and application of green prevention and control technologies. Traditional detection methods for tobacco root black rot are mainly based on the morphology and physiological and biochemical characteristics of pathogens. With the development of molecular biology technology, polymerase chain reaction (PCR) based on nucleic acid detection has been widely adopted. Traditional detection methods and conventional PCR detection methods both require high professional qualities of operators and require professional instruments, and cannot complete the rapid detection of tobacco root black rot fungi in the field. The recombinase polymerase amplification (RPA) technology is based on the T4 phage nucleic acid replication mechanism. The recombinase protein of the T4 phage is used to

[0004] The isothermal amplification reaction of nucleic acids is completed in vitro through the action of uvsX, single-strand binding protein (SSB) and DNA polymerase (Bsu). Primer design is a key factor affecting the amplification of recombinase polymerase. RPA primer design is different from general PCR primer design. If the primer is too long, it is easy to produce primer dimers and hairpin structures. If the primer is too short, the recombination rate will be reduced, affecting the amplification speed and detection sensitivity. At present, there is no relevant software to assist primer screening, which brings certain difficulties to primer screening. It can be seen that in the primer design stage, the design principles and screening principles of primers need to be obtained through a large number of experiments.

[0005] Based on this, early and rapid diagnosis of tobacco black root rot can provide an important basis for precise pesticide application for tobacco black root rot prevention and control, and is an important foundation for the promotion and application of green control technology. Therefore, there is an urgent need for a method that can quickly detect tobacco black root rot in the wild or in the field. Summary of the invention

[0006] In view of this, the purpose of the present invention is to provide a portable rapid diagnosis method for field tobacco root black rot pathogens and primers, probes and kits to solve the current problems of complex tobacco root black rot detection operation, cumbersome procedures, low sensitivity and high false positives.

[0007] A primer and a probe for rapid detection of tobacco root black rot pathogens, the primers comprising an upstream primer and a downstream modified primer, the nucleotide sequences of the upstream primers are respectively shown as SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, the nucleotide sequences of the downstream modified primers are respectively shown as SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6; the nucleotide sequence of the probe is shown as SEQ ID NO.7.

[0008] Specifically, the nucleotide sequences of the upstream primers are as follows:

[0009] SEQ ID NO.1(TbF1): CACATACGACCATAGCCTGTAGAAAGCACG;

[0010] SEQ ID NO.2(TbF2): CATACGACCATAGCCTGTAGAAAGCACGGG;

[0011] SEQ ID NO.3(TbF3): TACGACCATAGCCTGTAGAAAGCACGGGAT;

[0012] The nucleotide sequence of the downstream modified primer is as follows:

[0013] SEQ ID NO.4(TbR1): ATATAGTCAAGTCAAGCCGGATTGGGGGAG;

[0014] SEQ ID NO.5(TbR2):TTAAATATAGTCAAGTCAAGCCGGATTGGG;

[0015] SEQ ID NO.6 (TbR3): CGTTAAATATAGTCAAGTCAAGCCGGATTG;

[0016] The nucleotide sequence of the probe is as follows:

[0017] SEQ ID NO.7 (Tb Probe):

[0018] TGTTGTATGTCATCTTTTTACATGGTCAGTCTGCTTACTGTGGGGG;

[0019] Furthermore, the 5' end of the downstream modified primer is labeled with biotin, the 5' end of the probe is labeled with fluorescence, and the probe further comprises at least one of the following features:

[0020] (1) The middle sequence of the probe contains nucleotide analogs;

[0021] (2) The nucleotide analogue comprises a tetrahydrofuran residue;

[0022] (3) The 3' end of the probe has a polymerase extension blocking group;

[0023] (4) The polymerase extension blocking group includes any one of a C3-spacer, a phosphate group, and a dideoxynucleotide.

[0024] Preferably, the fluorescent label is FAM.

[0025] Furthermore, one of the upstream primers and one of the downstream modified primers described in the present invention are combined with a probe for use in detecting tobacco root black rot.

[0026] Any upstream primer disclosed in the present invention can be combined with any downstream modified primer and used together with a probe to detect tobacco root black rot, and the detection limit of pathogenic bacteria DNA can reach 100 fg level, with high sensitivity and accuracy.

[0027] The present invention also discloses a method for rapidly detecting tobacco root black rot pathogens, and the method is as follows:

[0028] After extracting the DNA of the plant tissue to be tested, a DNA extract is obtained, and the DNA extract is subjected to RPA amplification reaction, and then the result is read using an immunocolloidal gold lateral flow chromatography test strip; the RPA amplification reaction system is 50 μL, including 2 μL of DNA extract, 2 μL of 10 μM upstream primer, 2 μL of 10 μM downstream modified primer, 0.6 μL of 10 μM probe, 40.9 μL of Buffer A buffer, 2.5 μL of Buffer B buffer, and 1 tube of RPA reaction amplification enzyme and exonuclease dry powder (Jun Nord, product number A4631); the reaction conditions are to keep warm at 25-40°C for more than 15 minutes.

[0029] The detection method of the invention is quick, convenient and can be used for detecting early tobacco root black rot in the field.

[0030] Based on the disclosed upstream primers, downstream modified primers, probes and detection methods, the present invention also discloses a kit for rapidly detecting tobacco root black rot pathogens, wherein the kit also includes a lysate, a reaction solution a, a reaction solution b, an RPA reaction amplification enzyme and a nuclease exonuclease dry powder tube, an ultrapure water diluent and a test strip, wherein the reaction solution a includes an upstream primer, a downstream modified primer, a probe and a Buffer A buffer; and the reaction solution b includes a Buffer B buffer.

[0031] In order to make the operation more convenient, it also includes a grinding rod, a micropipette, and a centrifuge tube device to facilitate grinding, aspirating or loading reactants.

[0032] Further, the upstream primer is selected from one of the upstream primers whose nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively, the downstream modified primer is selected from one of the downstream modified primers whose nucleotide sequences are shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively, and the nucleotide sequence of the probe is shown in SEQ ID NO.7.

[0033] The upstream and downstream modified primers added to the kit disclosed in the present invention can be any disclosed combination of an upstream primer and a downstream modified primer.

[0034] Furthermore, the lysate is prepared from 4% PEG 2000, 24mM NaOH, and 1mM EDTA, with a total volume of 300μL; the total volume of the reaction solution a is 45.5μL, including 2μL of 10μM upstream primer, 2μL of 10μM downstream modified primer, 0.6μL of 10μM probe, and the rest is Buffer A buffer; the ultrapure water diluent is 400μL, and the total volume of the reaction solution b is 2.5μL.

[0035] Further, the method of using the kit is as follows:

[0036] S1: Take the diseased plant tissue to be tested, add lysis solution and grind it, wait for 2 minutes after grinding to fully lyse, wherein the lysis time does not exceed 5 minutes, to obtain a DNA extract;

[0037] S2: Add reaction solution a to the dry powder tube containing RPA reaction amplification enzyme and nuclease exonuclease, pipette DNA extraction solution into the reaction tube, and then pipette reaction solution b to start RPA reaction, and react in an environment of 25-40℃ for more than 15 minutes;

[0038] S3: Pipette all the reaction solution into a tube containing diluent for dilution, insert the test strip into the tube, and read the result after 3-5 minutes.

[0039] The reaction temperature required for this kit is between 25-40°C, and the temperature condition can be met by just holding it in your hand, without the need for additional temperature control equipment, which is convenient for field detection. In addition, this kit optimizes the addition process of primers, probes, buffers, and various enzymes, making the detection operation easier. The entire test can be completed within 25 minutes, which is time-saving.

[0040] The invention discloses an application of the kit in detecting tobacco root black rot.

[0041] Beneficial effects:

[0042] 1. The detection limit of the detection method disclosed in the present invention for pathogen DNA can reach 100 fg level. When the pathogen DNA content reaches 1 pg or above, the detection band (positive band) will be very obvious. Therefore, the sample amount is small, and the early tobacco root black rot can be detected.

[0043] 2. The portable tobacco root black rot pathogen diagnostic kit prepared according to the above method has the advantages of simple and fast operation, no restrictions on the detection site and no need for additional equipment, and has high sensitivity and good specificity. The specific sequence used is significantly different from the genome sequences of all other species currently known, and has no cross-reaction with other common pathogens in tobacco. The accuracy of detection using this kit is close to 100%. In addition, the reaction temperature required for the use of this kit can be between 25-40°C, and the temperature conditions can be met by just holding it in your hand, without the need for additional temperature control equipment, which is convenient for field detection.

[0044] 3. The kit disclosed in the present invention optimizes the addition process of primers, probes, buffers and various enzymes, making the detection operation simpler and the entire detection can be completed within 25 minutes, which is time-saving. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 :Product picture of the test kit; including ① lysis solution, ② disposable plastic grinding rod, ③ reaction solution a, ④ reaction solution b, ⑤ dry powder tube, ⑥ plastic micropipette, ⑦ diluent, ⑧ test strip;

[0046] Figure 2 :Detection results after different combinations of upstream primers, downstream modified primers and probes;

[0047] Figure 3 :Test results under different temperature conditions;

[0048] Figure 4 : Kit detection specificity test;

[0049] Figure 5 :Test kit detection sensitivity test;

[0050] Figure 6 : Detection situation in field scenes. DETAILED DESCRIPTION

[0051] The present invention will be described in detail below with reference to specific embodiments and accompanying drawings:

[0052] Example 1: Gene sequences, probes and primers

[0053] Specificity and sensitivity are two key indicators of pathogen detection technology. There are many factors that affect the specificity and sensitivity of nucleic acid detection, such as the nucleic acid quality of the test sample, the design of primers, the optimization of the reaction system, and the specificity and copy number of the target sequence. Species-specific, multi-copy repeat sequences in the genome of organisms are ideal target sequences for nucleic acid molecule detection and are widely used in the detection of medical pathogens. The higher the copy number of the target sequence, the higher the sensitivity of the detection system based on it.

[0054] In order to find novel multicopy sequences suitable for tobacco root black rot pathogens, the reference genome of Thielavia radicifolia (GenBank accession number ASM367143v1) was used for genome sequence alignment. A self-alignment strategy was used with BLASTN (v2.10.1) under default parameters to identify potential multicopy sequences. Multicopy sequences were screened by two rounds of BLAST searches. Sequences with a length of more than 150 bp and more than two high confidences (E value < 0.01) were retained through genome comparison. The overlapping multicopy sequences were then combined using bedtools (v 2.30.0) software, and potential multicopy sequences were collected based on these folding regions using samtools (1.9) software. Finally, the multicopy sequences were used as query sequences in the NCBI database for BLAST alignment with the genomes of all known species to obtain highly specific multicopy sequences.

[0055] According to the multi-copy specific sequence screening process described above, a multi-copy specific sequence was obtained. The sequence length is 204bp, the copy number in the Thielaviopsis basicola genome is 135, and the sequence alignment shows that it only exists specifically in the Thielaviopsis basicola genome. The obtained multi-copy specific sequence is as follows:

[0056] CACATACGACCATAGCCTGTAGAAAGCACGGGATCCCGTCCCGCTCTCCCTTAGTTAACCTACAGA

[0057] GCGCCGGACTAGTACTACGGTGGGTGACCACGTGGGAATCCCCGGTGTTGTATGTCATCTTTTTACATG

[0058] GTCAGTCTGCTTACTGTGGGGGTTGTTTTTTGCTCTCCCCCAATCCGGCTTGACTTGACTATATTTAACG.

[0060] In view of the application of the multi-copy sequence in the detection of tobacco root black rot, specific primers and probes were designed by using the characteristics of RPA amplification enzyme and Primer5, and the obtained sequences are shown in the sequence table SEQ ID NO.1-SEQ ID NO.7, and a tobacco root black rot pathogen monitoring test kit based on the LF-RPA strategy was established. Then the 5' end of the obtained downstream modified primer is labeled with biotin, the 5' end of the probe is labeled with FAM fluorescence, the middle sequence of the probe contains tetrahydrofuran residues, and the 3' end has a spacerC3 blocking group, as shown in Table 1:

[0061] Table 1

[0062]

[0063]

[0064] Example 2: Diagnostic Method and Kit

[0065] According to the upstream primers, downstream modified primers and probes disclosed in Example 1, a rapid diagnosis method and kit for tobacco root black rot for use in the field were constructed.

[0066] The detection method is as follows:

[0067] The DNA extract of the diseased plant tissue to be tested is added to the reaction system to perform RPA amplification reaction, and then the result is read using an immunocolloidal gold lateral flow chromatography test strip.

[0068] Specifically, Figure 1 The kit shown consists of the following:

[0069] ① Lysis solution: 4% PEG 2000 + 24mM NaOH + 1mM EDTA, total volume 300μL;

[0070] ②Disposable plastic grinding rod;

[0071] ③ Reaction solution: upstream primer (10 μM, 2 μL), downstream modified primer (10 μM, 2 μL), probe (10 μM, 0.6 μL), commercial RPA reaction buffer A (Jun Nord, product number A4631, 40.9 μL), total volume 45.5 μL;

[0072] ④ Reaction solution b: commercial RPA reaction buffer B (Jun Nord, product number A4631);

[0073] ⑤ Dry powder tube: RPA reaction amplification related enzymes and nuclease exonuclease nfo, after being prepared into dry powder, it is more stable and convenient for transportation and storage;

[0074] ⑥Plastic micropipette;

[0075] ⑦ Diluent: 400 μL of sterile ultrapure water;

[0076] ⑧Small paper strip: Commercial “double antibody sandwich” immune colloidal gold lateral flow chromatography test strip for 6-FAM and Biotin.

[0077] The specific method of using the kit is as follows:

[0078] (1) Take about 0.05 g of the diseased plant tissue to be tested, the size of half a fingernail, add lysis solution, and grind. After grinding and lysis, wait for 2 minutes to fully lyse (the lysis time cannot exceed 5 minutes) to obtain a DNA extract;

[0079] (2) Add reaction solution a to the tube of RPA reaction amplification enzyme and nuclease exonuclease powder, use a pipette to extract DNA extract solution (the liquid is sucked to the thin black line of the pipette) into the reaction tube, and then perform RPA reaction after sucking reaction solution b into the reaction tube. Hold it with your hand or put it in your pocket to keep the temperature above 30°C for 15 minutes;

[0080] () Use a pipette to draw all the reaction solution into a 1.5 mL tube containing diluent for dilution. Insert the test strip (with the arrow end immersed in the liquid) into the tube and read the result after 3-5 minutes.

[0081] When both the C line and the T line on the lateral flow chromatography test strip have bands, the test sample is positive; when the C line on the lateral flow chromatography test strip has a band and the T line has no band, the test sample is negative.

[0082] The kit disclosed in the present invention has the advantages of being portable, easy to operate, not limited by the detection site and not requiring additional equipment, and is very suitable for use in the field or outdoors.

[0083] Example 3: Detection of tobacco root black rot using different primer combinations

[0084] Referring to the detection method of Example 2, Thielaviopsis basicola genomic DNA was used as the reaction template (1 ng), the reaction time was 20 min, and the reaction temperature was 37°C. The RPA combined with immunocolloidal gold flow chromatography detection under different primer combinations (upstream primers and downstream modified primers were combined respectively, and the probe remained unchanged) was compared.

[0085] The primer combinations used for the experiments are as follows:

[0086] The results obtained were as follows: no primer, TbF1+TbR1, TbF1+TbR2, TbF1+TbR3, TbF2+TbR1, TbF2+TbR2, TbF2+TbR3, TbF3+TbR1, TbF3+TbR2, and TbF3+TbR3. Figure 2 shown.

[0087] The analysis results show that any different upstream primers and downstream modified primers are suitable for the detection of Thielaviopsis basicola, and the T-line bands are obvious. Among them, the detection effects of the primer combinations TbF1+TbR3 and TbF3+TbR1 are the best. This shows that the primers disclosed in the present invention can flexibly pair the upstream primers and the downstream modified primers.

[0088] Example 5: Detection of tobacco root black rot at different reaction temperatures

[0089] Referring to the method of Example 2, Thielaviopsis basicola genomic DNA was used as the reaction template (1 ng), the reaction time was 20 min, and the primer combination was TbF1+TbR3. It was verified that the reaction could be carried out at a temperature of 25-40°C. The RPA reaction temperatures were set at 25°C, 30°C, 35°C, 40°C and 45°C, respectively. The results were as follows: Figure 3 shown.

[0090] The analysis results show that the RPA reaction can be carried out well within the reaction temperature range of 25-40°C, indicating that the detection method disclosed in the present invention is suitable for different outdoor environments. Considering that the climate temperature during the tobacco root black rot season is within the range of 23-35°C, the method of covering the reaction tube with hands can be used to provide a suitable RPA reaction temperature.

[0091] Example 6: Specificity test

[0092] The method of Example 2 was followed, and the specificity experiments were performed using TbF1+TbR3 as the primer combination, the reaction temperature was 37°C, and the DNA template was 1 ng. The first three were isolated from different regions of tobacco root thallus (Thielaviopsis basicola), followed by tobacco Corynespora cassioha, tobacco bacterial wilt (Ralstonia solanacearum), tobacco black leg pathogen (Phytophthora nicotianae), tobacco anthracnose pathogen (Colletotrichummicotianae) and tobacco wildfire pathogen (Pseudomonas syringae pv. tabaci) specificity experiments, and the results obtained were as follows: Figure 4 shown.

[0093] The analysis results show that the detection method of the present invention only specifically detects Thielavia radicifolia and will not produce false positives when detecting other common tobacco diseases, indicating that the primers and probes are highly specific and can only be used to detect tobacco black root rot.

[0094] Example 7: Sensitivity test

[0095] Referring to the method of Example 2, different concentrations of Thielaviopsis basicola genomic DNA were used as reaction templates, the reaction time was set to 15 min, the reaction temperature was set to 37° C., and RPA amplification was performed. The template amounts were 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg and NTC (no genomic template), respectively. The results are shown in FIG. Figure 5 shown.

[0096] The analysis results show that the detection limit of the present invention for Phytophthora parasitica is 100 fg, and the detected bands are very obvious in the case of 1 pg or more of genomic template.

[0097] Example 8: Unequipped Detection Experiment of Artificially Inoculated Disease Samples

[0098] In order to verify the actual use effect of the kit in the field, the kit was used in the field without any additional equipment to detect the pathogens of 6 tobacco rhizomes inoculated with Thielavia radicifolia by referring to the method of Example 2. The results are as follows: Figure 6 shown.

[0099] The analysis results show that from left to right they are: negative control, disease samples 1 to 6. The results show that the bands detected in all disease samples are very clear, and the accuracy of detection is 100%.

[0100] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions of the present invention, which should be included in the scope of the claims of the present invention. The techniques, shapes, and structural parts not described in detail in the present invention are all known technologies.

Claims

1. A primer and probe for rapid detection of tobacco root black rot pathogens, characterized in that: The primers include upstream primers and downstream modified primers, the nucleotide sequences of the upstream primers are shown as SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively, and the nucleotide sequences of the downstream modified primers are shown as SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively; the nucleotide sequence of the probe is shown as SEQ ID NO.

7.

2. A primer and probe for rapid detection of tobacco root black rot pathogens according to claim 1, characterized in that: The 5' end of the downstream modified primer is labeled with biotin, the 5' end of the probe is labeled with fluorescence, and the probe further comprises at least one of the following features: (1) The middle sequence of the probe contains nucleotide analogs; (2) The nucleotide analogue comprises a tetrahydrofuran residue; (3) The 3' end of the probe has a polymerase extension blocking group; (4) The polymerase extension blocking group includes any one of a C3-spacer, a phosphate group, and a dideoxynucleotide.

3. A primer and probe for rapid detection of tobacco root black rot pathogens according to claim 2, characterized in that: The fluorescent label is FAM.

4. Use of one of the upstream primers and one of the downstream modified primers according to any one of claims 1 to 3 in combination with a probe in detecting tobacco root black rot.

5. A method for rapidly detecting tobacco root black rot pathogens, characterized in that: The method is as follows: After extracting DNA from the plant tissue to be tested, a DNA extract is obtained, the DNA extract is subjected to RPA amplification reaction, and then the result is read using an immunocolloidal gold lateral flow chromatography test strip; The RPA amplification reaction system is 50 μL, including 2 μL of DNA extract, 2 μL of 10 μM upstream primer, 2 μL of 10 μM downstream modified primer, 0.6 μL of 10 μM probe, 40.9 μL of Buffer A, 2.5 μL of Buffer B, and RPA reaction amplification enzyme and exonuclease dry powder tube; the reaction conditions are to keep warm at 25-40°C for more than 15 minutes.

6. A kit for rapid detection of tobacco root black rot pathogens, characterized in that: The kit also includes lysis solution, reaction solution a, reaction solution b, RPA reaction amplification enzyme and exonuclease dry powder, ultrapure water diluent, and test strips. The reaction solution a includes mixed upstream primers, downstream modified primers, probes, and Buffer A buffer; the reaction solution b includes Buffer B buffer.

7. A kit for rapid detection of tobacco root black rot pathogens according to claim 6, characterized in that: The upstream primer is selected from one of the upstream primers whose nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively; the downstream modified primer is selected from one of the downstream modified primers whose nucleotide sequences are shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively; and the nucleotide sequence of the probe is shown in SEQ ID NO.

7.

8. A kit for rapid detection of tobacco root black rot pathogens according to claim 7, characterized in that: The lysate is composed of 4% PEG 2000, 24mM NaOH, and 1mM EDTA, with a total volume of 300μL; the total volume of the reaction solution a is 45.5μL, including 2μL of 10μM upstream primer, 2μL of 10μM downstream modified primer, 0.6μL of 10μM probe, and the rest is Buffer A buffer; the ultrapure water diluent is 400μL, and the total volume of the reaction solution b is 2.5μL.

9. A kit for rapid detection of tobacco root black rot pathogens according to claim 8, characterized in that: The method of using the kit is as follows: S1: Take the diseased plant tissue to be tested, add lysis solution and grind it, wait for 2 minutes after grinding to fully lyse, wherein the lysis time does not exceed 5 minutes, to obtain a DNA extract; S2: Add reaction solution a to the tube containing RPA reaction amplification enzyme and exonuclease powder, pipette DNA extraction solution into the reaction tube, and then pipette reaction solution b to start RPA reaction, and react in an environment of 25-40℃ for more than 15 minutes; S3: Pipette all the reaction solution into a tube containing diluent for dilution, insert the test strip into the tube, and read the result after 3-5 minutes.

10. Use of the kit according to any one of claims 6 to 9 in detecting tobacco root black rot.

Images