Portable field tobacco black shank pathogen rapid diagnosis and identification kit

Abstract

The invention discloses a portable field tobacco black shank pathogen rapid diagnosis and identification kit, belongs to the technical field of tobacco black shank detection, and discloses an upstream primer, a downstream modified primer and a multi-site modified probe which have nucleotide sequences as shown in SEQ ID NO.1-SEQ ID NO.7, meanwhile, a kit for detecting the tobacco black shank is prepared by utilizing the probe and the primer, and the problems that the existing tobacco black shank pathogen detection is difficult to carry out in the field without complex equipment, and the existing detection method is complex in operation, tedious in procedure, low in sensitivity and the like are solved.

Description

Technical Field

[0001] The invention relates to the technical field of tobacco black shank disease detection, and in particular to a portable rapid diagnosis method for tobacco black shank disease in the field, as well as primers, probes and a kit. Background Art

[0002] Tobacco black shank is caused by infection with Phytophthora parasitica (also known as tobacco phytophthora, an oomycete, Latin name Phytophthora parasitica or Phytophthora nicotianae), which can harm tobacco from seedlings to adult plants, and can infect from roots to leaves. It is a semi-live parasitic soil-borne rhizome disease. The host range of Phytophthora parasitica is very wide, and it can infect plants of more than 250 genera. Disease prevention and control through methods such as crop rotation has limited effect. In the process of Phytophthora parasitica infecting tobacco and causing tobacco black shank, there is an undetectable incubation period. After the symptoms appear, the disease develops rapidly. When obvious symptoms appear, it is difficult to save the plant by using drugs. It often causes large economic losses in the process of tobacco cultivation. It is one of the main diseases in tobacco cultivation, so the early diagnosis of tobacco black shank is particularly important. Therefore, it is of great significance to establish efficient, rapid and practical pathogen detection technology for the monitoring and diagnosis of tobacco black shank.

[0003] Recombinase polymerase amplification (RPA) technology is based on the T4 phage nucleic acid replication mechanism. Through the action of T4 phage recombinase protein (uvsX), DNA single-strand binding protein (SSB) and DNA polymerase (Bsu), the isothermal amplification reaction of nucleic acid is completed in vitro. Primer design is a key factor affecting recombinase polymerase amplification. RPA primer design is different from general PCR primer design. If the primer is too long, it is easy to produce primer dimers and hairpin structures. If the primer is too short, the recombination rate will be reduced, affecting the amplification speed and detection sensitivity. At present, there is no relevant software to assist primer screening, which brings certain difficulties to primer screening. It can be seen that in the primer design stage, the design principles and screening principles of primers need to be obtained through a large number of experiments.

[0004] Based on this, early and rapid diagnosis of tobacco black shank disease can provide an important basis for precise pesticide application for tobacco black shank disease prevention and control, and is an important foundation for the promotion and application of green control technology. Therefore, there is an urgent need for a method that can quickly detect tobacco black shank disease in the wild or in the field. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide a portable rapid diagnosis method for tobacco black shank disease in the field, as well as primers, probes and kits, to solve the current problems of complex operation, cumbersome procedures, low sensitivity and high false positives in tobacco black shank disease detection.

[0006] A primer and a probe for rapid detection of tobacco black shank disease, the primers comprising an upstream primer and a downstream modified primer, the nucleotide sequences of the upstream primers are respectively shown as SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, the nucleotide sequences of the downstream modified primers are respectively shown as SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6; the nucleotide sequence of the probe is shown as SEQ ID NO.7.

[0007] Specifically, the nucleotide sequences of the upstream primers are as follows:

[0008] SEQ ID NO.1(NFO-PPM25F1):CAGTAGATCGAATCCTTGGAGGAGATCGTGT;

[0009] SEQ ID NO.2(NFO-PPM25F2):GTAGATCGAATCCTTGGAGGAGATCGTGTAT;

[0010] SEQ ID NO.3(NFO-PPM25F3):AGATCGAATCCTTGGAGGAGATCGTGTATCC;

[0011] The nucleotide sequence of the downstream modified primer is as follows:

[0012] SEQ ID NO.4(NFO-PPM25R1):GAAGCGCCAGTTGGCCTTTGTGAACAAGAAA;

[0013] SEQ ID NO.5(NFO-PPM25R2):GCGCCAGTTGGCCTTTGTGAACAAGAAAGC;

[0014] SEQ ID NO.6(NFO-PPM25R3):CCAGTTGGCCTTTGTGAACAAGAAAGCTGATC;

[0015] The nucleotide sequence of the probe is as follows:

[0016] SEQ ID NO.7 (NFO probe):

[0017] ACTCCGAGGATTACGTAATCTTCACAGATGATGACGTAATCACTG;

[0018] Furthermore, the 5' end of the downstream modified primer is biotin-labeled, the 5' end of the probe is fluorescently labeled, and the probe further comprises at least one of the following features:

[0019] (1) The middle sequence of the probe contains nucleotide analogs;

[0020] (2) The nucleotide analogue comprises a tetrahydrofuran residue;

[0021] (3) The 3' end of the probe has a polymerase extension blocking group;

[0022] (4) The polymerase extension blocking group includes any one of a C3-spacer, a phosphate group, and a dideoxynucleotide.

[0023] Preferably, the fluorescent label of the present invention is FAM.

[0024] One of the upstream primers and one of the downstream modified primers disclosed in the present invention are combined with a probe for use in detecting tobacco black shank disease, and the detection limit of pathogenic bacteria DNA can reach 100 fg level, with high sensitivity and accuracy.

[0025] Based on the above probes and primers, the present invention also discloses a method for rapid detection of tobacco black shank disease, which is as follows:

[0026] After extracting the DNA of the plant tissue to be tested, a DNA extract is obtained, and the DNA extract is subjected to RPA amplification reaction, and then the result is read using an immunocolloidal gold lateral flow chromatography test strip; the RPA amplification reaction system is 50 μL, including 2 μL of DNA extract, 2 μL of 10 μM upstream primer, 2 μL of 10 μM downstream modified primer, 0.6 μL of 10 μM probe, 40.9 μL of Buffer A buffer, 2.5 μL of Buffer B buffer, and 1 tube of RPA reaction amplification enzyme and exonuclease dry powder tube (Jun Nord, product number A4631); the reaction conditions are to keep warm at 30-45°C for more than 15 minutes.

[0027] Among them, the RPA reaction amplification enzyme and nuclease dry powder tube contains recombinase protein, DNA polymerase, nuclease nfo and single-stranded binding protein.

[0028] The detection method of the invention is quick, convenient and can be used to detect early tobacco black shank disease in the field.

[0029] The present invention also discloses a kit, which further comprises a lysate, a reaction solution a, a reaction solution b, a tube of RPA reaction amplification enzyme and exonuclease dry powder, an ultrapure water diluent, and a test strip. The reaction solution a comprises an upstream primer, a downstream modified primer, a probe, and a Buffer A buffer; and the reaction solution b comprises a Buffer B buffer.

[0030] Of course, in order to make the operation more convenient, grinding rods, micropipettes, and centrifuge tubes are also included to facilitate grinding, aspirating or loading of reactants.

[0031] Further, the upstream primer is selected from one of the upstream primers whose nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively, the downstream modified primer is selected from one of the downstream modified primers whose nucleotide sequences are shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively, and the nucleotide sequence of the probe is shown in SEQ ID NO.7.

[0032] The upstream and downstream modified primers added to the kit disclosed in the present invention can be any disclosed combination of an upstream primer and a downstream modified primer.

[0033] Furthermore, the lysate is prepared from 3% PEG 2000, 24mM NaOH, and 2mM EDTA, with a total volume of 300μL; the total volume of the reaction solution a is 45.5μL, including 2μL of 10μM upstream primer, 2μL of 10μM downstream modified primer, 0.6μL of 10μM probe, and the rest is Buffer A buffer; the ultrapure water diluent is 400μL, and the total volume of the reaction solution b is 2.5μL.

[0034] Further, the method of using the kit is as follows:

[0035] S1: Take the diseased plant tissue to be tested, add lysis solution and grind it, wait for 2 minutes after grinding to fully lyse, wherein the lysis time does not exceed 5 minutes, to obtain a DNA extract;

[0036] S2: Add reaction solution a to the RPA reaction amplification enzyme and exonuclease powder tube, pipette DNA extraction solution into the reaction tube, and then pipette reaction solution b to start the RPA reaction, and react at 30-45℃ for 15 minutes;

[0037] S3: Pipette all the reaction solution into a tube containing diluent for dilution, insert the test strip into the tube, and read the result after 3-5 minutes.

[0038] Furthermore, the kit of the present invention is used for detecting tobacco black shank disease.

[0039] Beneficial effects:

[0040] 1. The detection limit of the detection method disclosed in the present invention for pathogen DNA can reach 100 fg level. When the pathogen DNA content reaches 1 pg or above, the detection band (positive band) will be very obvious. Therefore, the sample amount used is small, and the earlier tobacco black shank disease can be detected.

[0041] 2. The specific sequence segment targeted by the kit of the present invention will not match the genome sequence p of all other species known so far. Test experiments show that the detection reaction of the kit has no cross-reaction with closely related species of Phytophthora parasitica and other common pathogens in tobacco. The detection accuracy of the kit under simulated field conditions is close to 100%.

[0042] 2. The portable tobacco black shank disease diagnostic kit prepared according to the above method has the advantages of being easy and quick to operate, not limited by the detection site and not requiring additional equipment, and has high sensitivity and good specificity. In addition, the required reaction temperature for the use of the kit can be between 30-45°C, and the temperature condition can be met by just holding it in your hand, without the need for additional temperature control equipment, which is convenient for field detection.

[0043] 3. The kit disclosed in the present invention optimizes the addition process of primers, probes, buffers and various enzymes, making the detection operation simpler and the entire detection can be completed within 15 minutes, which is time-saving. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 :Product picture of the test kit; including ① lysis solution, ② reaction solution a, ③ reaction solution b, ④ dry powder tube, ⑤ diluent, ⑥ test strip, ⑦ disposable plastic grinding rod, ⑧ plastic micropipette;

[0045] Figure 2 :Detection results after different combinations of upstream primers, downstream modified primers and probes;

[0046] Figure 3 :Test results under different temperature conditions;

[0047] Figure 4 : Kit detection specificity test;

[0048] Figure 5 :Test kit detection sensitivity test;

[0049] Figure 6 : Cross-reactivity test of closely related species of Phytophthora parasitica;

[0050] Figure 7 : Detection situation in field scenes. DETAILED DESCRIPTION

[0051] The present invention will be described in detail below with reference to specific embodiments and accompanying drawings:

[0052] Example 1: Gene sequences, probes and primers

[0053] Specificity and sensitivity are two key indicators of pathogen detection technology. There are many factors that affect the specificity and sensitivity of nucleic acid detection, such as the nucleic acid quality of the test sample, the design of primers, the optimization ratio of the reaction system, and the specificity and copy number of the target sequence. The higher the copy number of the target sequence, the higher the sensitivity of the detection system based on it.

[0054] To find novel multicopy sequences suitable for tobacco blackleg pathogen, the reference genome of Phytophthora parasitica (GenBank accession number GCA_000247585.2) was used for genome sequence alignment. A self-alignment strategy was used with BLASTN (v2.10.1) under default parameters to identify potential multicopy sequences. Multicopy sequences were screened by two rounds of BLAST searches. Sequences with a length of more than 150 bp and more than two high confidences (E value < 0.01) were retained through genome comparison. The overlapping multicopy sequences were then combined using bedtools (v 2.30.0) software, and potential multicopy sequences were collected based on these folding regions using samtools (1.9) software. Finally, the multicopy sequences were used as query sequences to perform BLAST alignment with the genomes of all known species in the NCBI database to obtain highly specific multicopy sequences.

[0055] According to the multi-copy specific sequence screening process described above, a multi-copy specific sequence was obtained. The sequence length is 193bp, the copy number in the Phytophthora parasitica genome is 13, and the sequence alignment shows that it only exists specifically in the Phytophthora parasitica genome. The obtained multi-copy specific sequence is as follows:

[0056] CAGTAGATCGAATCCTTGGAGGAGATCGTGTATCCAAATGATTGCATCATGCCGATCCACTCCGA GGATTACGTAATCTTCACAGATGATGACGTAATCACTGACGCGCCGTCGTCGACCACGAGTCTCAGGGC TGGATCGGGTCACTTCCCATCGATCAGCTTTCTTGTTCACAAAGGCCAACTGGCGCTTC.

[0057] Candidate primers and probes were designed with the help of Primer5 and other software, and the obtained sequences are shown in the sequence table SEQ ID NO.1-SEQ ID NO.7. The 5' end of the downstream modified primer is labeled with biotin, and the 5' end of the probe is labeled with FAM fluorescence. The middle sequence of the probe contains tetrahydrofuran residues, and the 3' end has a spacerC3 blocking group, as shown in Table 1:

[0058] Table 1

[0059]

[0060] Example 2: Diagnostic method and kit

[0061] A rapid diagnosis method and kit for tobacco black shank disease for use in the field were constructed based on the upstream primers, downstream modified primers and probes disclosed in Example 1.

[0062] The detection method is as follows:

[0063] The DNA extract of the diseased plant tissue to be tested is added to the reaction system to perform RPA amplification reaction, and then the result is read using an immunocolloidal gold lateral flow chromatography test strip.

[0064] Specifically, Figure 1 The kit shown consists of the following:

[0065] ① Lysis solution: 3% PEG 2000 + 25mM NaOH + 2mM EDTA, total volume 300μL;

[0066] ② Reaction solution a: upstream primer (10 μM, 2 μL), downstream modified primer (10 μM, 2 μL), probe (10 μM, 0.6 μL), commercial RPA reaction buffer A (Jun Nord, product number A4631, 40.9 μL), total volume 45.5 μL;

[0067] ③ Reaction solution b: commercial RPA reaction buffer B (Jun Nord, product number A4631, 2.5 μL);

[0068] ④ Dry powder tube: RPA reaction amplification enzyme and exonuclease dry powder tube composed of recombinase protein (uvsX), DNA polymerase Bsu, exonuclease nfo and SSB (the finished product was purchased from Jun Nord, product number A4631). After being prepared into dry powder, it is more stable and convenient for transportation and storage;

[0069] ⑤ Dilution solution: 400 μL of sterile ultrapure water;

[0070] ⑥ Test strips: commercial "double antibody sandwich" immunocolloidal gold lateral flow chromatography test strips for 6-FAM and Biotin (finished product purchased from Milenia Biotec, catalog number MGHD1);

[0071] ⑦Disposable plastic grinding rod;

[0072] ⑧Plastic micropipette.

[0073] The specific method of using the kit is as follows:

[0074] (1) Take about 0.05 g of the diseased plant tissue to be tested, the size of half a fingernail, add lysis solution and grind, wait for 2 minutes after grinding and lysis to fully lyse (the lysis time should not exceed 5 minutes), and obtain a DNA extract;

[0075] (2) Add reaction solution a to the dry powder tube, use a pipette to extract the DNA extract (the liquid is sucked up to the thin black line on the pipette) into the reaction tube, and then perform the RPA reaction after sucking reaction solution b into the reaction tube. Hold it with your hand or put it in your pocket and keep the temperature above 30-45°C for 15 minutes;

[0076] () Use a pipette to draw all the reaction solution into a 1.5 mL tube containing diluent for dilution. Insert the test strip (with the arrow end immersed in the liquid) into the tube and read the result after 3-5 minutes.

[0077] When both the C line and the T line on the lateral flow chromatography test strip have bands, the test sample is positive; when the C line on the lateral flow chromatography test strip has a band and the T line has no band, the test sample is negative.

[0078] The kit disclosed in the present invention has the advantages of being portable, easy to operate, not limited by the detection site and not requiring additional equipment, and is very suitable for use in the field or outdoors.

[0079] Example 3: Detection of tobacco black shank with different primer combinations

[0080] Referring to the detection method of Example 2, Phytophthoraparasitica genomic DNA was used as the reaction template (1 ng), the reaction time was 15 min, the reaction temperature was 37°C, and RPA combined with immunocolloidal gold flow chromatography detection under different primer combinations (upstream primers and downstream modified primers were combined respectively, and the probe remained unchanged) was compared.

[0081] The primer combinations used for the experiments are as follows:

[0082] The results obtained were as follows: no primers, PPM25-F1 + PPM25-R1, PPM25-F1 + PPM25-R2, PPM25-F1 + PPM25-R3, PPM25-F2 + PPM25-R1, PPM25-F2 + PPM25-R2, PPM25-F2 + PPM25-R3, PPM25-F3 + PPM25-R1, PPM25-F3 + PPM25-R2, and PPM25-F3 + PPM25-R3. Figure 2 shown.

[0083] The analysis results show that any different upstream primers and downstream modified primers are suitable for the detection of Phytophthoraparasitica, and the T-line bands are obvious, which shows that the primers disclosed in the present invention can flexibly pair the upstream primers and the downstream modified primers.

[0084] Example 5: Detection of tobacco black shank at different reaction temperatures

[0085] Referring to the method of Example 2, Phytophthoraparasitica genomic DNA was used as the reaction template (1 ng), the reaction time was 15 min, and the primer combination was PPM25-F1 + PPM25-R1. It was verified that the reaction could be carried out at a temperature of 30-45°C. The RPA reaction temperatures were set at 25°C, 30°C, 35°C, 40°C and 45°C, respectively. The results were as follows: Figure 3 shown.

[0086] The analysis results show that the RPA reaction can be carried out well within the reaction temperature range of 30-45°C, indicating that the detection method disclosed in the present invention is suitable for different outdoor environments. Considering that the climate temperature during the onset of tobacco black shank disease is within the range of 23-35°C, the method of covering the reaction tube with hands can be used to provide a suitable RPA reaction temperature.

[0087] Example 6: Specificity test

[0088] The method of Example 2 was followed, and PPM25-F1+PPM25-R1 was selected as the primer combination, the reaction temperature was 37°C, and the DNA template was 1 ng for specific experiments. The first three were tobacco black shank pathogens (Phytophthora parasitica) isolated from different regions, followed by tobacco Corynespora cassioha, tobacco bacterial wilt pathogens (Ralstonia solanacearum), tobacco brown spot pathogens (Alternaria alternate), tobacco anthracnose pathogens (Colletotrichum micotianae), tobacco root black rot pathogens (Thielaviopsis basicola), and tobacco wildfire pathogens (Pseudomonas syringaepv.tabaci) specific experiments. When detecting tobacco black shank pathogens, pathogens isolated from three different regions were selected for detection, and the results obtained are as follows. Figure 4 shown.

[0089] The analysis results show that the selected detection sequences, primers and probes are highly specific. Except for the Phytophthora parasitica genome, they will not match any other species' genome sequences, indicating that the detection method of the present invention only specifically detects tobacco black shank pathogens and will not produce false positives when detecting other common tobacco diseases. This indicates that the primers and probes are highly specific and are only used to detect tobacco black shank.

[0090] Example 7: Cross-reactivity testing in closely related species of Phytophthora parasitica

[0091] In order to further clarify the specificity of the diagnostic kit for the detection of Phytophthora parasitica, we also selected 5 different related species of Phytophthora parasitica for cross-reaction testing. Figure 5 As shown, from left to right, the first three are parasitic phytophthora (Phytophthora parasitica) isolated from different regions, followed by five different phytophthora: Phytophthora infestans, Phytophthora capsici, Phytophthora sojae, Phytophthora palmivora and Phytophthora cactorum.

[0092] The analysis results show that the diagnostic kit of the present invention only detects positive bands in Phytophthoraparasitica, and has no cross-reaction in other closely related species, which further indicates that the diagnostic kit has a high specificity.

[0093] Example 8: Sensitivity test

[0094] Referring to the method of Example 2, different concentrations of Phytophthora parasitica genomic DNA were used as reaction templates, the reaction time was set to 15 min, the reaction temperature was set to 37°C, and RPA amplification was performed. The template amounts were 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg and NTC (no genomic template), respectively. The results are as follows: Figure 6 shown.

[0095] The analysis results show that the detection limit of the present invention for Phytophthora parasitica is 100 fg, and the detected bands are very obvious in the case of 1 pg or more of genomic template.

[0096] Example 9: Unequipped Detection Experiment of Artificially Inoculated Disease Samples

[0097] In order to verify the actual use effect of the kit in the field, the kit was used in the field without any additional equipment to detect the pathogen on 6 tobacco rhizomes inoculated with Phytophthora parasitica. The results are as follows: Figure 7 shown.

[0098] The analysis results show that from left to right they are: negative control, disease samples 1 to 6. The results show that the bands detected in all disease samples are very clear and the accuracy of detection is 100%.

[0099] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions of the present invention, which should be included in the scope of the claims of the present invention. The techniques, shapes, and structural parts not described in detail in the present invention are all known technologies.

Claims

1. A primer and probe for rapid detection of tobacco black shank disease, characterized in that: The primers include upstream primers and downstream modified primers, the nucleotide sequences of the upstream primers are shown as SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively, and the nucleotide sequences of the downstream modified primers are shown as SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively; the nucleotide sequence of the probe is shown as SEQ ID NO.

7.

2. A primer and probe for rapid detection of tobacco black shank according to claim 1, characterized in that: The 5' end of the downstream modified primer is labeled with biotin, the 5' end of the probe is labeled with fluorescence, and the probe further comprises at least one of the following features: (1) The middle sequence of the probe contains nucleotide analogs; (2) The nucleotide analogue comprises a tetrahydrofuran residue; (3) The 3' end of the probe has a polymerase extension blocking group; (4) The polymerase extension blocking group includes any one of a C3-spacer, a phosphate group, and a dideoxynucleotide.

3. A primer and probe for rapid detection of tobacco black shank according to claim 2, characterized in that: The fluorescent label is FAM.

4. Use of one of the upstream primers and one of the downstream modified primers according to any one of claims 1 to 3 in combination with a probe in detecting tobacco black shank.

5. A method for rapid detection of tobacco black shank disease, characterized in that: The method is as follows: After extracting DNA from the plant tissue to be tested, a DNA extract is obtained, the DNA extract is subjected to RPA amplification reaction, and then the result is read using an immunocolloidal gold lateral flow chromatography test strip; The RPA amplification reaction system is 50 μL, including 2 μL of DNA extract, 2 μL of 10 μM upstream primer, 2 μL of 10 μM downstream modified primer, 0.6 μL of 10 μM probe, 40.9 μL of Buffer A, 2.5 μL of Buffer B, and RPA reaction amplification enzyme and exonuclease dry powder tube; the reaction conditions are to keep warm at 30-45°C for more than 15 minutes.

6. A kit for rapid detection of tobacco black shank disease, characterized in that: The kit also includes a lysis solution, a reaction solution a, a reaction solution b, an RPA reaction amplification enzyme and a nuclease exonuclease dry powder tube, an ultrapure water diluent, and a test strip. The reaction solution a includes an upstream primer, a downstream modified primer, a probe, and a Buffer A buffer; the reaction solution b includes a Buffer B buffer.

7. A kit for rapid detection of tobacco black shank according to claim 6, characterized in that: The upstream primer is selected from one of the upstream primers whose nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively; the downstream modified primer is selected from one of the downstream modified primers whose nucleotide sequences are shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively; and the nucleotide sequence of the probe is shown in SEQ ID NO.

7.

8. A kit for rapid detection of tobacco black shank according to claim 7, characterized in that: The lysate is composed of 3% PEG 2000, 24mM NaOH, and 2mM EDTA, with a total volume of 300μL; the total volume of the reaction solution a is 45.5μL, including 2μL of 10μM upstream primer, 2μL of 10μM downstream modified primer, 0.6μL of 10μM probe, and the rest is Buffer A buffer; the ultrapure water diluent is 400μL, and the total volume of the reaction solution b is 2.5μL.

9. A kit for rapid detection of tobacco black shank according to claim 8, characterized in that: The method of using the kit is as follows: S1: Take the diseased plant tissue to be tested, add lysis solution and grind it, wait for 2 minutes after grinding to fully lyse, wherein the lysis time does not exceed 5 minutes, to obtain a DNA extract; S2: Add reaction solution a to the RPA reaction amplification enzyme and exonuclease powder tube, pipette DNA extraction solution into the reaction tube, and then pipette reaction solution b to start the RPA reaction, and react at 30-45℃ for 15 minutes; S3: Pipette all the reaction solution into a tube containing ultrapure water diluent for dilution, insert the test strip into the tube, and read the result after 3-5 minutes.

10. Use of the kit according to any one of claims 6 to 9 in detecting tobacco black shank.

Images