Breeding method of high-quality disease-resistant large-grain two-line sterile line

Abstract

The invention belongs to the field of rice genetic breeding, and discloses a breeding method of high-quality disease-resistant large-grain two-line sterile line rice, which ingeniously fuses two major technical fields of molecular biology and rice genetic breeding. A two-line sterile line A with an excellent genetic background is selected as a female parent and a restorer line B is selected as a male parent for hybridization, and then individuals carrying target disease-resistant and grain weight genes are accurately screened by using a molecular marker-assisted selection technology. By combining strict resistance inoculation test and appearance quality evaluation, the bred sterile line not only has excellent disease resistance (resistance to rice blast and bacterial blight), but also has large grain shape and high appearance quality. In addition, through multi-generation shuttling and generation-adding propagation, the hereditary character is further stabilized. The breeding method disclosed by the invention is efficient and accurate, provides a new thought and technical means for the field of rice genetic breeding, and is of great significance for improving the yield and quality of rice.

Description

Technical Field

[0001] The invention belongs to the field of rice genetic breeding and discloses a method for breeding high-quality disease-resistant large-grain two-line sterile rice. Background Art

[0002] As one of the most important food crops in the world, the stable and high yield of rice is crucial to ensuring global food security and meeting the growing food demand. In the process of rice breeding, two-line sterile lines have attracted much attention because they can flexibly regulate fertility and use hybrid vigor to improve yield and quality. However, the existing two-line sterile line breeding technology still has some problems that need to be solved, which limits its wide application in agricultural production.

[0003] First, insufficient disease resistance is a major challenge facing the current two-line sterile rice. Rice is susceptible to a variety of diseases during its growth, such as rice blast and bacterial blight, which not only lead to reduced rice production or even total crop failure, but also seriously affect rice quality. Although some disease-resistant varieties have been bred by traditional breeding methods, they often have problems such as narrow disease resistance spectrum and unstable disease resistance. At the same time, with the continuous mutation of pathogens, the disease resistance of existing disease-resistant varieties is also facing severe tests. Secondly, grain size is also an important factor affecting rice yield and quality. Large-grain rice usually has higher thousand-grain weight and yield potential, and is more popular in the market. However, among the existing two-line sterile rice, large-grain varieties are relatively rare, and often have defects in other traits such as disease resistance and stress resistance. Furthermore, the traditional two-line sterile breeding method mainly relies on phenotypic observation and artificial selection, which is not only time-consuming and inefficient, but also easily affected by environmental factors, resulting in unstable breeding results. At the same time, traditional methods are difficult to accurately select and breed complex traits such as disease resistance and grain size, and it is difficult to meet the high requirements of modern agriculture for rice varieties.

[0004] In summary, the existing two-line sterile rice breeding technology has obvious deficiencies in disease resistance, grain size and breeding efficiency. Therefore, a new breeding method is urgently needed to quickly and accurately breed two-line sterile rice lines with both high-quality disease resistance and large grain characteristics, so as to overcome the limitations of existing technologies and promote the progress and development of rice breeding technology. Summary of the invention

[0005] In response to the above problems, the present invention discloses a method for breeding high-quality disease-resistant large-grain two-line sterile rice. The method combines molecular marker-assisted selection technology with traditional rice genetic breeding technology to quickly and accurately breed two-line sterile rice that meets the needs of modern agricultural production.

[0006] The present invention includes the following technical solutions: A method for breeding high-quality disease-resistant large-grain two-line sterile line comprises the following steps: a. The two-line sterile line A with high quality, resistance to rice blast and excellent agronomic traits is used as the female parent, and the restorer line B with high quality, resistance to bacterial blight and large grains is used as the male parent to obtain the hybrid F1; b planting the hybrid F1, and mixed harvest at maturity to obtain F2 seeds; c. Planting F2 under short-day and low-temperature conditions, extracting DNA from leaves of sterile plants with excellent agronomic traits after heading, and detecting the rice blast resistance gene Pib, the bacterial blight resistance gene Xa39, the grain weight gene GW8, and the gelatinization temperature control gene ALK by molecular marker technology, and harvesting seeds of the F3 generation sterile lines containing the genes; d. Under long-day and high-temperature conditions, the F3 generation homozygous single plant seeds were planted according to the strains, and the resistance inoculation test of bacterial blight and rice blast was carried out, and the strains with good resistance performance were selected. At the same time, the F3 generation homozygous sterile strain seeds were ground into brown rice to observe the appearance quality and grain size of the brown rice, and the strains with good appearance quality and larger grains were selected; e. Combine the genotypic and phenotypic screening results to carry out multiple generations of breeding of the F4 sterile plants with high quality, resistance to rice blast and bacterial blight, and large grains until they are basically stable; f. Establish a strain nursery and select stable strains with excellent agronomic traits and uniform traits; g. Carry out extensive testing and mating with self-selected restorer lines to propagate the original stock; h. Observe fertility in the identification nursery, produce core seeds, plant hybrids, and select sterile lines with good general compatibility for group application. Further, in the above-mentioned method for breeding high-quality disease-resistant large-grain two-line sterile lines, the molecular marker technology includes designing specific primers for GW8, Xa39, Pib and ALK genes, performing PCR amplification on the extracted DNA, and performing electrophoresis detection on gel.

[0007] Furthermore, in the above-mentioned method for breeding high-quality disease-resistant large-grain two-line sterile lines, the specific primers of the GW8 gene are GW8-F=TTTCAGTGTCCTCCTGTCTG and GW8-R=ACCACTAAACCAGGTGCTAC; The specific primers of the Xa39 gene are Xa39-F=CACAAGACAACCTTCAATGG and Xa39-R=GGCTTAGGAGCGTTTATAGG; The specific primers of the Pib gene are Pib-F=GAACAATGCCCAAACTTGAGA and Pib-R=GGGTCCACATGTCAGTGAGC; The specific primers of the ALK gene are ALK-F=ACTTTTAGTTCAGCAATTTCTC and ALK-R=ACACAAAAAAAGTACTCCCCGGCC.

[0008] Furthermore, in the above-mentioned method for breeding high-quality disease-resistant large-grain two-line sterile line, the PCR reaction system includes template DNA, MgCl2, primers, dNTPs, buffer, Taq DNA polymerase and ddH2O, and the PCR reaction procedure includes pre-denaturation, denaturation, annealing, extension and final insulation steps.

[0009] Furthermore, in the above-mentioned method for breeding high-quality disease-resistant large-grain two-line sterile lines, in step d, bacterial blight is inoculated through a bacterial suspension, rice blast is inoculated through a mixed spore liquid spray, and strains with good resistance performance are selected for subsequent reproduction.

[0010] Furthermore, in the above method for breeding high-quality disease-resistant large-grain two-line sterile lines, in step e, the multi-generation reproduction includes shuttle generation in Hefei and Lingshui, Hainan, until the sterile lines are basically stable. Furthermore, the above-mentioned method for breeding high-quality disease-resistant large-grain two-line sterile line also includes, after step g, further evaluating the genetic stability and agronomic traits of the original seeds for reproduction.

[0011] Furthermore, the above-mentioned method for breeding high-quality disease-resistant large-grain two-line sterile lines can quickly breed rice two-line sterile lines that have both high-quality disease-resistant characteristics and large-grain characteristics, and is suitable for the field of rice genetic breeding.

[0012] Compared with the prior art, the present invention has the following beneficial effects: One of the core advantages of the present invention is that it significantly improves breeding efficiency and accuracy, which is mainly due to the development of gene-specific molecular markers (primers) for resistance to bacterial blight, grain shape, etc. and the corresponding breeding strategies.

[0013] Specifically, the present invention has successfully developed gene-specific molecular markers (primers) for rice resistance genes and grain shape-related genes through in-depth research on the genetic characteristics of rice. These molecular markers (primers) are like precise "navigators" that can quickly locate genetic loci in the rice genome that are closely related to the target traits.

[0014] More importantly, the present invention realizes the simultaneous screening of phenotype and genotype in the early stage of breeding. Traditional breeding methods often rely on the observation and evaluation of phenotypes in the later stage, which is not only time-consuming and labor-intensive, but also easily affected by environmental factors. However, the present invention can accurately predict and screen key traits such as disease resistance and grain shape of rice in the early stage of rice growth through molecular marker-assisted selection, thereby greatly shortening the breeding cycle and improving the accuracy and efficiency of breeding.

[0015] In summary, the present invention has constructed a set of efficient and accurate breeding system by developing specific molecular markers (primers), inoculation identification, and simultaneous screening of early-stage phenotypes and genotypes. This system can not only quickly breed high-quality disease-resistant large-grain rice two-line sterile lines, but also provide strong technical support for technological innovation and variety improvement in the field of rice breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the electropherogram for the identification of GW gene; Figure 2 This is the electrophoresis diagram for the identification of the Xa39 gene; Figure 3 This is the electrophoresis diagram for the identification of Pib gene; Figure 4 This is the electrophoresis diagram for the identification of ALK gene; Figure 5 Comparison of plants of Guangzhan 63S and 5308S; Figure 6 Comparison of grain shapes of Guangzhan 63S (top) and 5308S (bottom); Figure 7 Comparison of particle shapes of Guangzhan 63S (top) and 5308S (bottom). DETAILED DESCRIPTION

[0017] The present invention is further described below in conjunction with the accompanying drawings and embodiments, and the contents of the embodiments are not intended to limit the protection scope of the present invention.

[0018] Table 1 shows the primer pairs corresponding to the molecular markers targeted in the present invention.

[0019] Gene Primers sequence SEQ ID.No GW8 GW8-F TTTCAGTGTCCTCCTGTCTG 1 GW8-R ACCACTAAACCAGGTGCTAC 2 XA39 Xa39-F CACAAGACAACCTTCAATGG 3 Xa39-R GGCTTAGGAGCGTTTATAGG 4 Pib Pib-F GAACAATGCCCAAACTTGAGA 5 Pib-R GGGTCCACATGTCAGTGAGC 6 ALK ALK-F ACTTTTAGTTCAGCAATTTCTC 7 ALK-R ACACAAAAAAAGTACTCCCCGGCC 8 The terms involved in this invention are: Restorer line: refers to a line that, after hybridization with a sterile line, can restore the male fertility characteristics of the offspring.

[0020] Two-line sterile line: that is, the photothermosensitive nuclear sterile rice sterile line, which is male fertile under short-day and low-temperature conditions and can reproduce seeds; it is male sterile under long-day and high-temperature conditions and can be used for seed production.

[0021] A method for breeding high-quality disease-resistant large-grain two-line sterile rice comprises the following steps: The hybrid F1 was obtained by crossing the high-quality, rice blast-resistant, and excellent agronomic traits two-line sterile line Guangzhan 63S (containing ALK and Pib genes, sourced from the Rice Research Institute of Anhui Academy of Agricultural Sciences) as the female parent and the high-quality, bacterial blight-resistant, large-grain restorer line 4M036 (containing ALK, Xa39, GW8 genes, sourced from the Rice Research Institute of Anhui Academy of Agricultural Sciences) as the male parent.

[0022] 2. Plant F1 and harvest them together at maturity to obtain F2 seeds.

[0023] 3. Plant F2 under short-day and low-temperature conditions (early November in Lingshui, Hainan, the same below). After heading, cut and regenerate sterile plants with excellent agronomic traits, and take leaves from each plant to extract leaf DNA. Analyze the sequences of the rice blast resistance gene Pib, the bacterial blight resistance gene Xa39, the grain weight gene GW8, and the gelatinization temperature control gene ALK, design molecular markers, and perform PCR amplification and electrophoresis on the DNA extracted in step 3. Harvest seeds of sterile lines containing Pib, Xa39, GW8, and ALK genes at maturity.

[0024] PCR reaction system 10 μL, containing 20 ng·uL -1 Template DNA 1 μL, 25 mmol·L -1 MgCl2 0.6 μL, 2 pmol·uL -1 Primer 0.7 μL, 2.5 mmol·L -1 dNTP 0.2 μL, 10 × buffer 1 μL, 5 U·μL -1 Taq DNA polymerase 0.1 μL, ddH2O 6.4 μL.

[0025] The reaction was carried out on a PTC2000 PCR instrument (MJ Research Inc1, USA). The PCR reaction program was: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, 35 cycles; 72℃ extension for 7 min, and finally storage at 15℃. The PCR amplification products were electrophoresed on 8% polyacrylamide gel or 1.5% agarose. The results are shown in Figure 1-4 shown.

[0026] 4. Under long-day and high-temperature conditions (early May in Hefei), plant a portion of the F3 homozygous single-plant seeds in rows according to the strains. When the sword leaves grow out, dip the dissecting scissors in the bacterial suspension, cut off a section of the leaf tip of the inoculated leaf, and inoculate with white leaf blight. At the heading stage of rice, spray the mixed spore liquid to inoculate rice blast fungi, wrap the inoculated rice ears with rice leaves, and keep the sprinkler system moisturized regularly. Select those with good resistance performance, cut the stubble and regenerate after the heading stage, and harvest the seeds at maturity. Grind the seeds of the F3 homozygous sterile strains into brown rice, observe the appearance quality and grain size of the brown rice, including length, width, transparency and chalkiness, and select the strains with good appearance quality and larger grains.

[0027] 5. Combining the genotypes of step 3 and the phenotypes of step 4, the high-quality, large-grained F4 sterile plants resistant to rice blast and bacterial blight were shuttled between Hefei and Lingshui, Hainan until they were basically stable.

[0028] 6. Establish a strain nursery and select stable strains with excellent agronomic traits and uniform traits.

[0029] 7. Extensively test and mate with self-selected restorer lines to propagate the original stock.

[0030] 8. Observe fertility in the identification field and produce core seeds. Plant hybrids and select sterile lines with good general compatibility for mating application.

[0031] Through the careful implementation of the above breeding methods, we successfully obtained a high-quality, disease-resistant, large-grained two-line sterile rice (5308S). Figure 5-7 The figure shows a comparison of the traits of the sterile line 5308S obtained by the present invention and its female parent Guangzhan 63S. It can be seen from the figure that the sterile line obtained by the breeding method of the present invention not only exhibits outstanding agronomic traits, but also achieves significant breakthroughs in disease resistance and yield.

[0032] In terms of disease resistance, the sterile lines have shown good resistance to rice blast and bacterial blight due to the successful introduction of Pib and Xa39 genes into them. In field trials, these sterile lines were able to maintain a steady growth trend even in the face of severe challenges in disease-prone areas, effectively reducing the use of pesticides and production costs while ensuring the quality and safety of rice.

[0033] In terms of yield, thanks to the introduction of the GW8 gene, the grain size of the sterile line has been significantly increased, and the thousand-grain weight has been significantly improved. This not only directly increases the yield per unit area of ​​rice, but also makes the appearance quality of rice better, meeting the market demand for high-quality rice.

[0034] In addition, through the shuttle breeding in Hefei and Lingshui, Hainan, the genetic traits of the sterile lines have become more stable and adaptable. In different ecological regions and planting conditions, they can show stable high-yield and high-quality characteristics, providing a strong guarantee for the widespread planting of rice and high and stable yields.

[0035] In terms of mating application, the mating results of these new varieties with self-selected restorer lines showed excellent results, generally have good compatibility, and are easy to hybridize with other excellent varieties, providing rich genetic resources for further innovation and development in the field of rice breeding.

[0036] In summary, the method for breeding high-quality disease-resistant large-grain two-line sterile rice of the present invention not only improves the disease resistance and yield of rice, but also optimizes the quality of rice, making important contributions to the advancement of rice breeding technology and the development of agricultural production. The promotion and application of these new varieties are expected to inject new vitality into global food security and sustainable agricultural development.

[0037] The above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the embodiments of the present invention. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is impossible to list all the embodiments here. Any obvious changes or modifications derived from the technical solution of the present invention are still within the scope of protection of the present invention.

Claims

1. A method for breeding high-quality disease-resistant large-grain two-line sterile rice, characterized in that: The following steps are involved: a. The two-line sterile line A with high quality, resistance to rice blast and excellent agronomic traits is used as the female parent, and the restorer line B with high quality, resistance to bacterial blight and large grains is used as the male parent to obtain the hybrid F1; b planting the hybrid F1, and mixed harvest at maturity to obtain F2 seeds; c. Planting F2 under short-day and low-temperature conditions, extracting DNA from leaves of sterile plants with excellent agronomic traits after heading, and detecting the rice blast resistance gene Pib, the bacterial blight resistance gene Xa39, the grain weight gene GW8, and the gelatinization temperature control gene ALK by molecular marker technology, and harvesting seeds of the F3 generation sterile lines containing the genes; d. Under long-day and high-temperature conditions, the F3 generation homozygous single plant seeds were planted according to the strains, and the resistance inoculation test of bacterial blight and rice blast was carried out, and the strains with good resistance performance were selected. At the same time, the seeds of the F3 generation homozygous sterile strains were ground into brown rice, and the appearance quality and grain size of the brown rice were observed, and the strains with good appearance quality and larger grains were selected; e. Combine the genotypic and phenotypic screening results to carry out multiple generations of breeding of the F4 sterile plants with high quality, resistance to rice blast and bacterial blight, and large grains until they are basically stable; f. Establish a strain nursery and select stable strains with excellent agronomic traits and uniform traits; g. Carry out extensive testing and mating with self-selected restorer lines to propagate the original stock; h. Observe fertility in the identification nursery, produce core seeds, plant hybrids, and select sterile lines with good general combining ability for pairing application.

2. The breeding method according to claim 1, characterized in that: The molecular marker technology includes designing specific primers for GW8, Xa39, Pib and ALK genes, performing PCR amplification on the extracted DNA, and performing electrophoresis detection on gel.

3. The breeding method according to claim 2, characterized in that: The specific primers for the GW8 gene are GW8-F=TTTCAGTGTCCTCCTGTCTG and GW8-R=ACCACTAAACCAGGTGCTAC; The specific primers of the Xa39 gene are Xa39-F=CACAAGACAACCTTCAATGG and Xa39-R=GGCTTAGGAGCGTTTATAGG; The specific primers of the Pib gene are Pib-F=GAACAATGCCCAAACTTGAGA and Pib-R=GGGTCCACATGTCAGTGAGC; The specific primers of the ALK gene are ALK-F=ACTTTTAGTTCAGCAATTTCTC and ALK-R=ACACAAAAAAAGTACTCCCCGGCC.

4. The breeding method according to claim 2, characterized in that: The PCR reaction system includes template DNA, MgCl2, primers, dNTPs, buffer, Taq DNA polymerase and ddH2O, and the PCR reaction procedure includes pre-denaturation, denaturation, annealing, extension and final incubation steps.

5. The breeding method according to claim 1, characterized in that: In step d, bacterial suspension is inoculated with Xanthoceras oryzae, mixed spore liquid is sprayed with rice blast, and strains with good resistance performance are selected for subsequent breeding.

6. The breeding method according to claim 1, characterized in that: In step e, the multi-generation breeding includes shuttling generations between Hefei and Lingshui, Hainan, until the sterile line is basically stable.

7. The breeding method according to claim 1, characterized in that: The breeding method further comprises, after step g, conducting further genetic stability and agronomic trait evaluation on the original stock of the reproduction.

8. The breeding method according to any one of claims 1 to 7, characterized in that: The breeding method can quickly breed a two-line sterile rice line that has both high-quality disease resistance and large grain characteristics, and is suitable for the field of rice genetic breeding.

Images