Targeting epitope near-infrared brain function imager and use method thereof

Abstract

The invention discloses a near-infrared brain function imager for targeting epitopes and a use method of the near-infrared brain function imager. A near-infrared fluorescent molecular probe is applied to target the epitopes of brain tissues and specific cells of a human body and accurately develop latent focuses. Fluorescence penetrates through mucosa muscle layers, tube wall muscle layers or enveloping layers by 8 mm, the signal-to-noise ratio exceeds 20, and the optimal targeted binding time is 4-48 h. The ligand of the fluorescent molecular probe has high specificity, high affinity and high stability and is accurately matched with the epitope, so that the medical image shows high signal-to-noise ratio, high accuracy and high definition. The supportive evidence comprises cytology, animal experiment and clinical research results. The ligands relate to nucleic acid sequences 1-255. The high-frequency expression human leukocyte antigen HLA-A11 is targeted, and the clinical requirements of Chinese species are accurately and efficiently focused. Accurate targeting and real-time positioning are achieved, and neurodegenerative diseases such as cognitive impairment, Alzheimer's disease and Parkinson's disease are diagnosed and treated.

Description

Technical Field

[0001] The patent of this invention involves molecular imaging, medical imaging diagnosis, antigen immunology, medicinal chemistry, and molecular biology. Fluorescent molecular probes bind to antigen epitopes with high specificity and high affinity. Near-infrared brain function imagers achieve precise targeting through fluorescent molecular probes combined with antigen epitopes, providing near-infrared real-time medical images with high signal-to-noise ratio and high definition, which can be used to diagnose and treat cognitive dysfunction, Alzheimer's disease, Parkinson's disease and other neurodegenerative diseases. Background Art

[0002] Functional Magnetic Resonance Imaging (fMRI) is developing rapidly. Near-infrared Spectroscopy (fNIRS) uses near-infrared light to collect the outgoing light intensity of brain tissue to produce brain functional medical images. Near-infrared brain imagers can measure changes in local cerebral blood oxygen. According to the Beer-Lambert law, the concentration of hemoglobin in the blood of the cerebral cortex is estimated based on the known incident light intensity and the measurable outgoing light intensity. It is used to infer brain neural activity and even the degree of coordination between brain regions when the human brain performs tasks.

[0003] Brain blood oxygen signal and blood oxygen level dependence (BOLD) are used to diagnose neurodegenerative diseases (NDD) such as cognitive dysfunction, Alzheimer's disease, Parkinson's disease, etc. The material and energy metabolism of brain nerves and the inhibition or activation of neural function correspond to a variety of biochemical signals (such as changes in electromagnetic fields, increased protease activity, changes in membrane potential or ion concentration, production of immune markers, changes in metabolic pathways, and accumulation of metabolic end products). Local brain blood oxygen is affected by many factors, which means that medical images from near-infrared brain function imaging devices do not always have the characteristics of high accuracy.

[0004] The range of clinical indications is very wide, among which neurodegenerative diseases include but are not limited to cognitive dysfunction, Alzheimer's disease, Parkinson's disease, etc. Near-infrared brain functional imaging and molecular biology technology of targeted antigen epitopes are integrated and developed. Improving the accuracy and reliability of medical imaging equipment requires the acquisition of accurate and reliable target signals (too low signal-to-noise ratio makes it difficult to locate and accurately target in real time). There are many types of cell surface antigens, and there are significant differences in antigen expression levels. Targeting antigen epitopes involves screening antigen epitopes, testing the ability to target and bind antigen epitopes, and evaluating clinical effects. After selecting the antigen epitope, it is necessary to further confirm the targeting binding characteristics (specificity, affinity) of the antigen epitope. Improving the targeting performance of near-infrared brain functional imaging involves the following steps: screening antigen epitopes; constructing fluorescent molecular probes for identifying targeted antigen epitopes; testing the specificity and affinity of fluorescent molecular probes in recognizing and binding antigen epitopes; fluorescent molecular probe navigation near-infrared brain functional imager: applying fluorescent molecular probes and confirming that they recognize and bind antigen epitopes, and then collecting the excited fluorescence signals of fluorescent molecular probes for real-time medical imaging and accurate targeting.

[0005] The expression of specific antigens is not significant (low content), specific antigens are also expressed in small amounts in normal tissues (specificity is not significant), and specific antigens have multiple epitopes (large individual differences). Antibody proteins are degraded and cleared in normal tissues, increasing the amount of residual antibody proteins in normal tissues. The slow degradation process leads to a strong background signal. The immunogenicity of antibody proteins may trigger an immune response. It is hydrolyzed in the body by proteases or peptide enzymes. Antibody macromolecules are not easy to penetrate cell membranes, and their long half-life reflects the existence of transmission resistance during metabolism.

[0006] Screening for specific targeted antigen epitopes is of great significance for physical examination screening, drug development and clinical treatment. The binding process of targeted antigen epitopes is subject to the characteristics of the antigen, the amount of antigen, and the binding kinetics. The process of antigen binding to antibody has the characteristics of high specificity and high affinity. The real-time fluorescence imaging method of tumor tissue can confirm that fluorescent molecular probes can target specific tumor antigen epitopes and screen for high sensitivity and high specificity, which can enhance immune recognition (IR) and weaken tissue retention enhancement (EPR). Complexes that appear in a combined form, such as fluorescent molecular probes coupled to multiple receptors with specific binding ability or with multiple functional groups at the end, are expected to be used to simultaneously detect multiple antigen epitopes on the cell surface.

[0007] Accurate real-time medical imaging diagnosis is more convenient and efficient than cytological analysis of pathological biopsy. The technical characteristics of near-infrared brain functional imaging with high accuracy, high definition and high signal-to-noise ratio are derived from the molecular mechanism of highly selective targeted binding to antigen epitopes. Near-infrared brain functional imaging is in great need of matching fluorescent molecular probes (FMP) with targeting performance. The optical molecular probes of fluorescent-linked antigen epitope recognition components have the characteristics of high specificity and high selectivity. The fluorescent signals generated by the excitation are collected in real time, which is conducive to real-time tracking and precise positioning of antigen epitopes. The generated precise medical images can navigate personalized precision treatment. The patents on near-infrared brain functional imaging involve imaging methods and systems, but do not involve antigen immunology and molecular biology, and do not explore in depth how to target antigen epitopes and improve the precision and accuracy of near-infrared brain functional imaging. The patent (CN202111353222.8) discloses an RSVP target recognition system and method that integrates multimodal fatigue monitoring and regulation. The fatigue state of the human brain is jointly evaluated through multimodal indicators and the image presentation frequency is adaptively adjusted. CN201980001075.2 discloses an integrated TMS coil beat for brain function detection and treatment.

[0008] In the application field of near-infrared brain function imagers, existing patents involve the physiological functions of the brain or nerves. CN201310724679.4 quickly solves the partial coherence coefficient of large-channel physiological signals and reflects physiological indicators such as brain oxygenated hemoglobin content and electromagnetic signals of neural activity. CN202110839503.8 analyzes the changing trend of brain waves to predict the brain health and psychological state. CN202110451999.1 involves a 3D analysis system of a near-infrared brain function imager based on HCT. CN202010891516.5 discloses a target recognition training system and method based on EEG-NIRS.

[0009] Patents on near-infrared brain function imaging involve the acquisition of non-targeted signals (such as EEG signals and blood oxygen concentration), but do not involve the selective or specific acquisition of signals at target locations. Noise signals mixed in the target signal are difficult to remove. The precise imaging performance of near-infrared brain function imagers is severely restricted by noise signals. Existing patents do not solve the problem of serious interference caused by noise signals from the source of the signal. The optical signals collected by near-infrared brain function imagers are already mixed with many complex noise signals based on the complexity of biological tissues and the complexity of physiological and pathological mechanisms.

[0010] Near-infrared brain function imagers ignore or remove noise signals generated by human tissue through medical image processing software, but noise signals mixed in the target signal are not easy to identify and remove. Medical image processing software faces a dilemma: if the threshold is high, the overall signal volume will drop sharply, and if the threshold is low, a large amount of noise signals will interfere with the target signal. CN201811608519.2 discloses a quantitative evaluation and recognition system for fabric tactile texture based on a multimodal brain-computer interface.

[0011] Near-infrared brain function imagers involve medical imaging and near-infrared spectroscopy (NIRS) technology in the field of medical devices. Existing patents apply near-infrared brain function imagers, but do not involve cell biology or antigen immunology technology. CN201711382497.8 discloses a method for automatically adjusting the light source intensity for near-infrared brain function imagers.

[0012] Antigen immunology and molecular biology techniques help to lock specific target locations of tissues or cells and achieve targeted binding. Existing patents involve high-affinity targeted imaging agents, but do not involve near-infrared brain function imagers, let alone the use of near-infrared brain function imagers for precise medical imaging diagnosis and treatment of cognitive dysfunction, Alzheimer's disease, Parkinson's disease and other neurodegenerative diseases. CN202180077617.1 application includes a targeting moiety, a connector and a NIR-II dye to detect target cells.

[0013] Existing patents involve the treatment of neurological or neurological diseases, but do not apply near-infrared brain function imagers, nor achieve the high signal-to-noise ratio, high accuracy and high definition of medical images of near-infrared brain function imagers, nor further promote the diagnosis and treatment of cognitive dysfunction, Alzheimer's disease, Parkinson's disease and other neurodegenerative diseases. CN202111240318.3 relates to an immune probe based on anti-tyrosine hydroxylase antibodies and its preparation and application. CN202180071697.X relates to methods and compositions for detecting circulating tumor cells (CTCs) using compounds comprising a targeting moiety and a fluorescent imaging agent.

[0014] Existing patents involve targeted fluorescent tracers and increasing the contrast between cancerous sites and normal tissues, but no near-infrared brain function imagers have been applied to the diagnosis and treatment of neurodegenerative diseases. CN202110312697.6 discloses a targeted probe combined with an in vivo fluorescent tracer for highly expressed targets in colorectal cancer and a preparation method. Near-infrared fluorescent dyes can accurately bind to carcinoembryonic antigens in cancer cells and enrich in cancerous sites, increasing the contrast between cancerous sites and normal tissues.

[0015] Existing patents involve targeted fluorescent tracers and near-infrared fluorescence imaging at cancer sites, but no near-infrared brain function imagers have been applied to the diagnosis and treatment of neurodegenerative diseases. CN202010535225.2 indicates that anti-GPC3 antibodies or antigen-binding fragments thereof have improved specificity and affinity for GPC3-positive tumor cells. Immunoconjugates containing the antibodies or antigen-binding fragments thereof demonstrate the ability of near-infrared fluorescence imaging and photothermal therapy at cancer sites.

[0016] Existing patents involve targeting peptides in targeted fluorescent tracers and near-infrared fluorescence imaging at cancer sites, but no near-infrared brain function imager has been applied to the diagnosis and treatment of neurodegenerative diseases. CN202010528796.3 discloses tumor targeting peptides targeting carcinoembryonic antigen-associated adhesion molecule CEACAM and its application.

[0017] CN202210210793.4 relates to an antibody-coupled near-infrared II region fluorescent probe, a construction method and an application thereof, and discloses the application of a substance targeting CaSR in the preparation of a developer, especially a parathyroid positive developer. The substance targeting CaSR is an antibody, which is covalently coupled to a fluorescent molecule through a linker and can target specific parathyroid tissue.

[0018] Existing patents involve fluorescent probes and targeted imaging, but no near-infrared brain function imager is used for the diagnosis and treatment of neurodegenerative diseases. CN202310472683.X discloses a fluorescent probe for tumor targeted imaging. The compound provided by CN201910411681.3 is used as a hypoxia and EGFR dual-targeted near-infrared fluorescent probe and targets the tumor marker EGFR and the hypoxic state of tumor cells. CN201380074692.8 relates to a compound used as a near-infrared fluorescent probe.

[0019] Existing patents involve the diagnosis and treatment of neurodegenerative diseases and specific structures that can target antigens (such as antigenic peptides, antibodies or antibody fragments, nucleotides), but near-infrared brain function imagers have not been applied to the diagnosis and treatment of neurodegenerative diseases. CN201480038570.8 provides a cyclic peptide containing a T cell antigen peptide as a medicament. CN202380011139.3 Antibodies or antigen-binding fragments thereof against IL-18BP can specifically bind to IL-18P and have high affinity, enhancing the cell's ability to kill tumors. CN202280086947.1 relates to IL-34 antibodies, compositions thereof, and methods for treating immune-mediated diseases such as neurodegenerative diseases. CN202180090027.2 discloses multifunctional polypeptides, including PEST motifs that target proteasomes and treat neurodegenerative diseases. CN202180089795.6 relates to pharmaceutical compositions comprising binding polypeptides and binding peptide conjugates and methods for treating neurodegenerative diseases, etc. The antisense oligonucleotides involved in CN201980071729.9 target TIA1 precursor mRNA sequences and inhibit neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS) or frontotemporal dementia. The molecules provided by CN201380022143.6 directly or indirectly target unwanted cells and prevent other parts from binding to immune cells. The mutant proteins involved in CN201080055370.5 can bind to beta amyloid peptide in Alzheimer's disease. CN200880120434.8 discloses a composition, a synthesis method and a use of F-18 labeling for PET imaging, for example. The nucleic acids disclosed in CN200480009612.1 and the polypeptides encoded therein are related to early dynamic inflammation of brain microvascular endothelial cells and blood-brain barrier function.

[0020] The existing patents for near-infrared brain function imaging involve diagnosis and treatment, but do not involve cell biology or antigen immunology technology, let alone further advance to the diagnosis and treatment of cognitive dysfunction, Alzheimer's disease, Parkinson's disease and other neurodegenerative diseases. The patents for targeting antigen epitopes involve molecular immunology, but do not apply near-infrared brain function imaging.

[0021] This patent develops a near-infrared brain function imager based on targeted antigen epitope technology, which not only greatly enhances the signal-to-noise ratio of fluorescent signals at specific locations of tissues and cells from the source of the signal, but also helps to ensure that the fluorescent molecular probe has precise targeting and specific binding capabilities, thereby expanding the clinical application scope of near-infrared brain function imagers in the field of targeted therapy, including but not limited to the diagnosis and treatment of cognitive dysfunction, Alzheimer's disease, Parkinson's disease and other neurodegenerative diseases. From the perspective of the integration and in-depth development of cutting-edge disciplines, fluorescent molecular probes in cell biology or antigen immunology technology accurately target and locate specific antigen epitopes of human organs, tissues and cells in real time, which not only greatly improves the accuracy of collecting fluorescent signals of near-infrared brain function imagers, but also lays a molecular biological foundation for the use of near-infrared brain function imagers in clinical research to diagnose and treat diseases. Summary of the invention

[0022] In view of the deficiencies in the prior art, the present invention provides a near-infrared brain function imager targeting antigen epitopes and a method for using the same.

[0023] Near-infrared brain function imaging can be used to accurately target and locate specific antigen epitopes of human organs, tissues and cells in real time. Furthermore, it can be used to diagnose and treat neurodegenerative diseases such as cognitive dysfunction, Alzheimer's disease, Parkinson's disease, etc.

[0024] The near-infrared brain function imager applies the molecular biology technology of ligand targeting antigen epitopes in antigen immunology. The application of cell biology or antigen immunology technology greatly improves the near-infrared brain function imager, thereby providing medical images with high signal-to-noise ratio, high accuracy and high definition. The combination of high specificity and high affinity corresponds to the performance characteristics of real-time positioning and precise targeting of the near-infrared brain function imager. The binding between antigen and antibody in antigen immunology has the characteristics of high specificity and high affinity. The fusion development of the two technologies is a prerequisite for the present invention. The molecular biology technology of antibody targeting antigen in antigen immunology and the near-infrared brain function imager belong to different fields and disciplines.

[0025] From the perspective of the research and development process, the antibody protein laboratory confirmed the high specificity and high affinity of the antibody-targeted antigen. The near-infrared brain function imager tracks the near-infrared fluorescent-labeled antibodies, thereby locating and targeting them in real time.

[0026] From the perspective of equipment application and equipment calibration process, the factory process of near-infrared brain function imager includes quality control measures, that is, setting up a reference condition and judging the performance of near-infrared brain function imager under this condition. The near-infrared fluorescent group located at the end of a specific antibody is excited by light of a specific wavelength. From the perspective of the clinical application process of the equipment, the near-infrared brain function imager uses fluorescent molecular probes to target antigen epitopes for real-time positioning and targeted imaging. The near-infrared brain function imager collects fluorescent signals and uses precision medical imaging to guide personalized and precise diagnosis and treatment of neurodegenerative diseases.

[0027] The beneficial effect of the clinical application of near-infrared brain function imagers is that they can locate and accurately target specific antigenic epitopes of human organs, tissues and cells in real time. Near-infrared medical imaging of antigenic epitopes targeting neurodegenerative diseases is used to accurately diagnose and treat cognitive dysfunction, Alzheimer's disease, Parkinson's disease and other neurodegenerative diseases. Targeting antigenic epitopes is conducive to the development of medical imaging equipment with the characteristics of high efficiency, precision, clarity and accuracy, greatly improving the positioning and recognition performance of near-infrared brain function imagers. Furthermore, it will promote the diagnosis and treatment of cognitive dysfunction, Alzheimer's disease, Parkinson's disease and other neurodegenerative diseases.

[0028] 1. A near-infrared brain function imager targeting antigen epitopes and a method for using the same, wherein one of the characteristics of the near-infrared brain function imager is that the near-infrared real-time medical images provided by the near-infrared brain function imager have the characteristics of high signal-to-noise ratio, high accuracy and high definition. It can be applied to the diagnosis and treatment of neurodegenerative diseases such as cognitive dysfunction, Alzheimer's disease, Parkinson's disease, etc.

[0029] The fluorescence signal collected by the near-infrared brain function imager originates from the excitation process of the fluorescent group of the fluorescent molecular probe and follows the law of exponential decay. The precision targeted medical imaging performance of the near-infrared brain function imager has been supported by clinical research evidence. The process of the near-infrared brain function imager producing precise medical images involves the fluorescent group of the fluorescent molecular probe being illuminated by light of a specific wavelength and thereby producing a fluorescent signal, which is then used by the near-infrared brain function imager for precise medical imaging.

[0030] The near-infrared brain function imager obtains highly accurate medical images. The clinical research results are summarized as follows: the near-infrared fluorescent molecular probe maintains the characteristics of high signal-to-noise ratio and strong fluorescent signal for 8 to 24 hours after entering the body, and is suitable for use as a fluorescent signal source for the near-infrared brain function imager. The optimal detection time for targeted binding is often 4 to 48 hours, with 6 to 16 hours being the most common. The targeted binding process lasts for 0 to 24 hours to 48 hours, but the residual amount of fluorescent molecular probes in the tissue to be tested needs to accumulate to a critical value to meet the numerical requirements of the minimum detection concentration in drug analysis.

[0031] The real-time medical images generated by the near-infrared brain function imager are characterized in that background noise signals are filtered, the fluorescence penetration depth can reach 8 mm through the mucosal muscularis, the vessel wall muscularis or the capsule layer, and the image signal-to-noise ratio can exceed 20.

[0032] Based on the amount of tissue residue in the animal experimental results, the time it takes for the fluorescent molecular probe to complete targeted binding is 2 to 24 hours, which may be extended to 48 hours (even 72 hours when excited fluorescence still exists). The optimized detection time for real-time medical imaging of the near-infrared brain functional imager is 2 to 16 hours. A short optimized detection time (for example, close to 2 hours) indicates that the fluorescent molecular probe is rapidly accumulated in the tissue to be tested (the retention trend is stronger than the clearance trend). A long optimized detection time (for example, close to 16 hours) means that the tendency of the tissue to be tested to retain the fluorescent molecular probe is weaker than the clearance trend.

[0033] The beneficial effect of the present invention is that the near-infrared brain function imager can be used to diagnose and treat neurodegenerative diseases such as cognitive dysfunction, Alzheimer's disease, Parkinson's disease, etc.

[0034] This article uses the following professional terms:

[0035] Signal-to-Noise Ratio (SNR): The ratio of the target signal intensity to the background noise signal intensity based on tissue structure or lesion area. It is one of the key factors in evaluating the quality of medical images. A high signal-to-noise ratio means that the target signal is much stronger than the background signal, corresponding to high specific binding, high affinity binding, high sensitivity fluorescence development, and high stability stimulated luminescence.

[0036] Medical Imaging Diagnosis: With the help of non-invasive imaging technology (such as X-ray, B-ultrasound, computed tomography (CT), magnetic resonance imaging (MRI), and nuclear medicine), specific areas of tissues and cells can be scanned to intuitively display the size, location, and shape of the lesions, providing an important basis for formulating personalized treatment plans.

[0037] Diagnostic Accuracy of Medical Imaging Diagnosis: The accuracy of medical imaging diagnosis is affected by many factors, including image quality, disease complexity, and physician experience and expertise.

[0038] False Positive Rate (FPR): The number of false positive samples detected divided by the number of true negative samples. A false positive occurs when a normal cell is misidentified as an abnormal cell in a medical imaging diagnosis report. If the fluorescent molecular probe does not specifically recognize and bind to the target antigen, or the specificity is not high, and normal cells are misidentified as abnormal cells, it is called a false positive.

[0039] Abnormal cells: refers to cells with abnormal cell morphology and size, including degenerative cells, inflammatory cells, tumor cells, etc.

[0040] False Negative Rate (FNR): The situation where abnormal cells are mistakenly identified as normal cells is called false negative.

[0041] Precision / Accuracy: refers to the consistency of the measurement results (how close the measurement results are to the actual results). The denominator is the predicted positive (sensitivity is the positive of the gold standard). The fluorescence signal generated by the misjudged normal cells (i.e. false positive cells) is the background noise signal. If the background noise signal is too strong, the signal-to-noise ratio of the fluorescence signal will be reduced, and the possibility of misjudgment will be high, resulting in the real abnormal cells not being accurately identified.

[0042] 2. A near-infrared brain function imager targeting antigen epitopes and a method of using the same, wherein the second feature of the device is that the process comprises the following four steps: (1) research on the preparation process and quality of near-infrared fluorescent molecular probes; (2) specific recognition of cell surface antigen epitopes by near-infrared fluorescent molecular probes; (3) generation of fluorescent signals by near-infrared fluorescent molecular probes upon excitation; and (4) medical imaging processing for precise targeting and real-time positioning.

[0043] (1) Research on the preparation process and quality of near-infrared fluorescent molecular probes: Specific spatial structures or terminal group characteristics affect the specificity and affinity of fluorescent molecular probes binding to antigen epitopes. Based on the specific spatial structure or terminal group characteristics, fluorescent molecular probes can specifically recognize cell surface antigens, thereby achieving the targeting performance of fluorescent molecular probes, and are used to locate and target specific sites of brain tissue and cells in real time. The output light intensity signal generated by the excitation of near-infrared light of a specific wavelength can be used as a signal source for near-infrared brain function imagers. Various types of fluorescent molecular probes such as antibodies and peptides, nucleic acids and nucleic acid analogs, polysaccharides, etc. can be designed to target specific antigen epitopes.

[0044] It is necessary to screen the fluorescent molecular probe experimentally to ensure that it can specifically recognize specific antigenic epitopes on the cell surface. Indicators such as specificity and affinity are used to judge whether the fluorescent molecular probe can target specific antigenic epitopes. The ends of the above-mentioned fluorescent molecular probes can be connected to other functional groups, for example, a group with a therapeutic effect (therapeutic agent) can be connected. Examples of groups with therapeutic effects are chemotherapeutic agents (such as methotrexate, docetaxel, cisplatin and etoposide) or biotherapeutic agents (such as cDNA, siRNA, shRNA and RNAi). An example of a functional group is a near-infrared fluorescent signal source, located in the near-infrared region 1 (650-900nm) or the near-infrared region 2 1000-1700nm). The fluorescent signal source can be derived from a variety of modified structures, such as adding polyethylene glycol groups, glycosyl groups or glycosyl polyethylene glycol groups.

[0045] (2) Near-infrared fluorescent molecular probes specifically recognize cell surface antigen epitopes: This paper studies the recognition and binding of fluorescent molecular probes to antigen epitopes on the cell surface that are associated with neurodegenerative diseases. Suitable fluorescent molecular probes have the characteristics of targeting antigen epitopes, and their molecular structure is based on suitable spatial configuration, suitable electronegativity, and suitable molecular size. In the binding experiment results, it is manifested as real-time positioning and precise targeting of specific antigen epitopes. The terminal fluorescent group of the fluorescent molecular probe generates a fluorescent signal under specific wavelength illumination conditions, which is then collected by a near-infrared brain functional imager.

[0046] (3) Near-infrared fluorescent molecular probes are excited to generate fluorescent signals: The end of the fluorescent molecular probe targeting the antigen epitope can be connected to a near-infrared fluorophore (for example, the near-infrared fluorescent group indocyanine green ICG, whose fluorescent angiography was approved by the U.S. Food and Drug Administration (FDA) in 1956 for use in cardiovascular and liver function research). Based on the fact that the safety of ICG has been confirmed by extensive clinical application results, the present invention connects ICG or its derivatives to the end of the fluorescent molecular probe.

[0047] (4) Medical imaging processing with precise targeting and real-time positioning: Fluorescent molecular probes recognize and bind to antigenic epitopes on the cell surface that are associated with neurodegenerative diseases. Furthermore, near-infrared brain functional imaging devices collect fluorescent signals and use precise medical imaging to promote the diagnosis and treatment of neurodegenerative diseases such as cognitive dysfunction, Alzheimer's disease, and Parkinson's disease.

[0048] The beneficial effect of the application of the near-infrared brain function imager in clinical research is that the near-infrared brain function imager can locate and accurately target antigen epitopes on the cell surface associated with neurodegenerative diseases in real time, and further promote the diagnosis and treatment of neurodegenerative diseases such as cognitive dysfunction, Alzheimer's disease, Parkinson's disease, etc. with precise medical imaging.

[0049] 3. A near-infrared brain function imager targeting antigen epitopes and a method of using the same, wherein the third feature is that the near-infrared medical image generated by the near-infrared brain function imager can be accurately targeted and positioned in real time. The near-infrared medical image has the characteristics of high signal-to-noise ratio, high accuracy and high definition, which correspond to the low-noise signal characteristics of imaging diagnosis, the specific binding characteristics of antigen immunology, and the high accuracy characteristics of molecular immunology.

[0050] The specific binding property is derived from the precise match between the ligand structure of the near-infrared fluorescent molecular probe and the cell surface antigen epitope. The ligand structure of the near-infrared fluorescent molecular probe refers to any atom, ion or molecule that can interact with the cell surface antigen epitope (including ionic bonds, covalent bonds, coordination bonds, metal bonds or hydrogen bonds, etc.). The molecule can be a small chemical molecule or a biological macromolecule (protein, nucleic acid, polysaccharide and lipid, etc.).

[0051] The ligand structure of the near-infrared fluorescent molecular probe may include nucleic acid or nucleic acid fragments and their analogs and modifications, and allow the near-infrared fluorescent molecular probe to target and bind to cell surface antigen epitopes.

[0052] In the specific implementation manner below, the present invention provides characteristic fragment sequences involved in preparing ligands.

[0053] As a non-limiting example, the specific embodiments below involve nucleic acid fragments, which are used to prepare receptors similar to structural analogs of nucleic acids or nucleic acid fragments and their modifications. A summary is given here. For detailed information about each sequence, see the specific embodiments of the present invention given below.

[0054] The target binding site of the fluorescent molecular probe may include a nucleic acid sequence, and the characteristic fragment of the nucleic acid sequence may target a specific antigen epitope.

[0055] The tumor testis antigen KK-LC-1 (Kita-Kyushu Lung Cancer Antigen-1) is abundantly expressed in epithelial malignant tumors. It is encoded by the CT83 gene and is abundantly expressed in epithelial tumors, including gastric cancer, triple-negative breast cancer, non-small cell lung cancer, cervical cancer, liver cancer, pancreatic cancer, etc.

[0056] The nucleic acid or nucleic acid fragment and its analogs and modifications are preferably all or part of sequence 1; all or part of sequence 1, plus all or part of one or more of the three sequences of sequence 2, 3, 4, etc. Further preferably, the 1st to 255th fragment of sequence 1 corresponds to the 57th to 311th of sequence 2, the 166th to 420th of sequence 3, and the 1068th to 1322nd of sequence 4. This fragment is as follows:

[0057] ATGAACTTCTATTTACTCCTAGCGAGCAGCATTCTGTGTGCCTTGATTGTCTTCTGGAAATATCGCCGCTTTCAGAGAAACACTGGCGAAATGTCATCAAATTCAACTGCTCTTGCACTAGTGAGAC CCTCTCTTCTGGGTTAATTAACAGCAATACAGACAACAATCTTGCAGTCTACGACCTCTCTCGGGATATTTTAAATAATTTCCCACACTCAATAGCCAGGCAGAAGCGAATATTGGTAAACCTCAGT

[0058] It is well known to those skilled in the art that the characteristic fragment sequence of the antigen target KK-LC-1 is polymorphic. The results of bioinformatics research show that personalized differences are reflected in different races, different individuals, and different organ parts of the same individual.

[0059] It is well known to those skilled in the art that one or more artificially designed nucleic acid fragments or short-chain polypeptides are specifically bound to a target protein (eg, FOX04 protein closely related to cell metabolism) through experimental results.

[0060] The near-infrared fluorescent molecular probe used in the near-infrared brain function imager can specifically identify cell surface antigen epitopes, and the near-infrared real-time medical images provided by the near-infrared brain function imager have real-time antigen immunological localization performance.

[0061] The near-infrared fluorescent molecular probe targets antigenic epitopes on the cell surface associated with neurodegenerative diseases. The near-infrared brain function imager uses the fluorescent molecular probe to locate and specifically identify cell surface antigenic epitopes in real time.

[0062] Amyloid secretase is currently the main therapeutic target for disease modification intervention in AD. Immunotherapy targeting Aβ has achieved good results in preclinical animal model studies. However, the application of targeted antigen epitope technology to the near-infrared real-time medical imaging provided by the near-infrared brain functional imager needs to deal with the following difficulties:

[0063] Ligand molecules targeting antigen epitopes are not easy to design, synthesize and quality control. It is necessary to confirm the precise targeting of neurotoxic Aβ oligomers, and the dilemma of Aβ-based immunotherapy is that it is not easy to synthesize Aβ molecules. Aβ oligomers are highly neurotoxic and difficult to capture in the Aβ cascade metabolic pathway in the brain. Soluble Aβ oligomers are unstable and difficult to separate. Transmembrane aspartic proteases BACE-1 and γ-secretase can cleave proteins and cause Aβ to accumulate in the brain. Inhibitors need to pass through the blood-brain barrier (BBB) ​​and nerve membranes to reach the site of action. Poor brain permeability, short half-life, first-pass effect, etc. are the reasons for the reduced efficacy of ligands in vivo. BACE-1 inhibitors can reduce the concentration of Aβ in the brain and even prevent the progression of AD. Animal study results have confirmed that it can reverse the amyloid protein metabolic pathway and reduce the deposition of new Aβ.

[0064] The beneficial effect of the present invention is that the near-infrared brain function imager is applied to medical imaging diagnosis, and has the performance characteristics of real-time positioning and precise targeting of antigen epitopes of human brain tissue and specific cells.

[0065] This article uses the following professional terms:

[0066] Antigenic epitope (AE): The antigenic epitope of human brain tissue and specific cells is the site in a specific antigen molecule in antigen immunology that can specifically bind to the antibody binding site and determine the antigen specificity.

[0067] Epitope: Antigenic Determinant, refers to a special chemical group that determines the specificity of an antigen. Antigenic epitopes are divided into B cell epitopes and T cell epitopes. A polypeptide epitope is usually composed of 5 to 20 amino acid residues, and a nucleic acid hapten epitope is composed of 6 to 8 nucleotide residues. The total number of epitopes on the antigen surface that can bind to antibodies is also called the antigen binding valence.

[0068] T cell epitope: refers to the antigen substance that can be recognized by T cell receptor (TCR). Antigen presenting cells convert antigens into small molecule peptides and bind to MHC before they can be recognized by TCR.

[0069] B Cell Receptor (BCR): Before being secreted into the extracellular space, antibodies are expressed on the surface of B cells in the form of membrane proteins for specific recognition of antigens.

[0070] Specific Antigen (SA): The specificity of an antigen is manifested in two aspects, namely, the specificity of immunogenicity and the specificity of antigenicity.

[0071] 4. A near-infrared brain function imager targeting antigen epitopes and a method of using the same, wherein the fourth feature is that the near-infrared medical imaging images generated by the near-infrared brain function imager have the characteristics of high signal-to-noise ratio, high accuracy and high definition, and the supporting evidence includes the results of cytological studies in preclinical studies, animal experimental results and clinical research results.

[0072] The low noise signal characteristic of diagnostic imaging refers to the extremely strong target signal and extremely low background signal. Identifying specific antigens and screening out ligands with high specificity and high affinity in the binding experiment between ligands and antigen epitopes is the only way to target antigen epitopes. The following experimental studies are involved: determining the expression level of antigens in specific tissues and cells, screening ligands that can bind to antigen epitopes, testing the specificity of ligand binding to antigen epitopes, testing the affinity of ligand binding to antigen epitopes, studying human leukocyte antigen (HLA) expression and cell membrane presentation, and using proteomics for verification.

[0073] The passage of immune antibodies through the blood-brain barrier is the key to AD treatment. The near-infrared real-time medical imaging technology provided by the near-infrared brain function imager can apply bispecific antibodies and their derivatives to enhance the penetration of fluorescent molecular probes into the blood-brain barrier. The efficacy is subject to the development of the disease and the mechanism of disease progression. Treatment should be carried out as early as possible in the early or preclinical stages of the disease. Early diagnosis of dementia is very difficult, and the progression of the disease is difficult to predict. Drug development and its clinical application lack efficient and accurate medical evaluation indicators and research methods. There is a lack of highly sensitive and highly specific diagnostic biomarkers and indicators and markers for judging the severity of the disease. Immunotherapy for Aβ has been shown to be able to clear Aβ plaques. Central nervous system inflammatory reactions and adverse reactions such as vasogenic edema may be closely related to the activation of immune function in the central nervous system. AβOs causes hyperphosphorylation of tau protein and leads to inflammatory reactions in the brain, leading to AD. In order to select early AD populations and clinical drug intervention, it is necessary to screen biomarkers that can identify misfolded proteins and have the characteristics of high specificity and high reliability. Targeted antigen epitope technology can draw on the technical experience of cancer immunotherapy, for example, to improve the biological specificity and targeted binding specificity of monoclonal antibodies.

[0074] Examples of cell surface targets: Target Delta-like protein 3: Delta-like protein 3 (DLL3) is a highly tumor-selective cell surface target that is mainly expressed in neural or neuroendocrine tumors, including small cell lung cancer (SCLC), large cell neuroendocrine carcinoma (LCNEC), gastrointestinal neuroendocrine tumors (GI-NEC), small cell bladder cancer (SCBC), glioblastoma multiforme, metastatic castration-resistant prostate cancer, pulmonary neuroendocrine tumors, etc.

[0075] Regarding fluorescence compensation of flow cytometry: Flow cytometry uses more than two fluorescent labeled antibodies, but there is overlap between the emission spectra of multiple fluorescent dyes. In multicolor flow cytometry analysis, it is necessary to correct the error caused by the superposition of fluorescent emission spectra. In addition to setting positive and negative controls, single staining controls are also set.

[0076] This article uses the following professional terms:

[0077] Blood-brain barrier (BBB): A protective barrier system between blood and brain tissue composed of endothelial cells, basement membrane and glial cell foot processes of brain capillaries. It allows nutrients needed by brain tissue to pass through, effectively blocks the passage of some foreign matter and macromolecules, and prevents harmful substances in the blood from invading the brain and causing brain damage.

[0078] Fluorescence compensation (FC): refers to the process of correcting the mutual leakage of fluorescence optical signals between detectors and being digitally detected.

[0079] Limitations of T cell recognition of antigen epitopes: A T cell usually recognizes only one epitope of an antigen. There is a dynamic balance in the process of recognizing antigen epitopes (T cell recognition of antigen epitopes is not limited to 100% matching or coordination). Multiple similar spatial structures or similar functional groups that exceed a critical value can activate a certain T cell.

[0080] One example is that early developing B cells undergo negative selection against CNS-specific antigens in the meninges. Autoreactive immature B cells that recognize myelin oligodendrocyte glycoprotein (MOG) are specifically eliminated from the meninges. Genetic deletion of the MOG gene can restore the autoreactive B cell population in the meninges.

[0081] Specificity: refers to the mutual compatibility, targeting and specificity between substances, reflecting the ability of the analytical system to correctly distinguish or detect the measured quantity when interferences exist.

[0082] Dissociation equilibrium constant (Equilibrium Association Constant, K D ): The degree of dissociation of the complex at equilibrium. The more dissociation, the higher the K D The larger the K, the weaker the affinity between the components. D The smaller the value, the stronger the affinity.

[0083] Specific Binding: refers to the binding of a ligand to specific sites of specific tissues and cells. The ligand binds to the antigen epitope and exists stably in specific cells, while in other tissues or cells, the amount is extremely small or even below the detection limit.

[0084] Fluorescent molecular probes bind to antigen epitopes with high specificity and high affinity. Its evaluation index is specificity. In antigen immunology, ligands bind specifically to antigens.

[0085] Tumor Specific Antigen (TSA): refers to a type of antigen that is specific to tumor cells or only exists in certain tumor cells, but not expressed by normal cells or only expressed in very small amounts. It can be regarded as an antigen that is specific to certain tumor cells and basically does not exist on normal tissue cells. For example, prostate specific antigen is a substance produced by the prostate acinar epithelium, and its main physiological function is to prevent the premature coagulation of semen. Neuroblast Specific Transfer Factor Antigen.

[0086] Screening for ligands that specifically bind to antigen epitopes: Ligands involve macromolecules (e.g., antibodies or polypeptides, nucleic acids or nucleic acid fragments) or small molecules, etc. Examples of ligands are antibodies or antibody fragments, structural analogs similar to antibodies or antibody fragments, and modified products thereof, nucleic acids or nucleic acid fragments, structural analogs similar to nucleic acids or nucleic acid fragments, and modified products thereof.

[0087] Screening for high affinity and high specificity: Considering that the interaction between the screened molecule and the antigen epitope may be weak, medium or strong, the task of the screening process is to remove impurities with weak or medium interaction. First, try to make the target be bound, adsorbed, retained, and layered, and then obtain ligands with high affinity and high specificity through separation and purification operations.

[0088] Separation and purification of adaptor proteins is based on the different properties of the target and impurities (solubility, polarity, electronegativity, adsorption, permeability, etc.). For example, the dialysis method for separating and purifying proteins uses the property that protein molecules cannot pass through semipermeable membranes to separate proteins from other small molecules such as inorganic salts, monosaccharides, water, etc.; ultrafiltration can retain proteins on the membrane and use pressure and centrifugal force to allow small molecules and water to pass through the semipermeable membrane; gel filtration chromatography uses the gel mesh of the gel chromatography column to exclude protein molecules that exceed the mesh size and allow them to move downward between the gaps of the gel beads.

[0089] The characteristics of high specificity and high affinity are obtained by screening the binding experiment between ligand and antigen epitope. Improving clinical effectiveness requires ensuring the high accuracy of medical imaging results. The high accuracy is mainly reflected in the extremely low false positive rate or false negative rate. The performance indicators for judging ligands involve high signal-to-noise ratio, high accuracy and high clarity. The high accuracy characteristic of molecular immunology refers to the extremely low misjudgment rate. The misjudgment rate includes the false positive rate or the false negative rate. The high accuracy characteristic involves the metabolism of fluorescent molecular probes.

[0090] Binding assays involve radioactive isotope-labeled ligands (Ligand, L) and receptors (Receptor, R).

[0091] Receptor: A cellular protein component formed by cells during the evolution process that can recognize and bind to certain trace chemicals in the environment, triggering subsequent physiological reactions or pharmacological effects through information transduction and amplification systems.

[0092] Receptor kinetics: K D Indicates the affinity of L to R, in molar concentration. K D The larger the value, the smaller the affinity. Take the inverse of both sides of the following receptor kinetics formula, ([LR] / [RT] = [L] / K D +[L]) will become 1 / [LR]=K D / [L][RT]+1 / [RT]. The linear graph has 1 / [L] as the horizontal axis and 1 / [LR] as the vertical axis, and the slope is K D / [RT].

[0093] The LR binding curve can be obtained by subtracting the non-specific binding amount from the total binding amount. The binding of ligand to receptor involves affinity and intrinsic activity.

[0094] As an example, the following introduces nucleic acid aptamers (a small molecule nucleic acid), which belong to structural analogs similar to nucleic acids or nucleic acid fragments and their modifications. Aptamers with high affinity to the target substance can be screened out from a random single-stranded nucleic acid sequence library using the exponential enrichment ligand system evolution technology (Systematic Evolution of Ligands by Exponential Enrichment, SELEX). Single-stranded oligonucleotide libraries (Oligonucleotide Libraries) are chemically synthesized in vitro, and free components that are not bound to nucleic acids are removed by washing, while the complex formed by the target and the nucleic acid is retained. The polymerase chain reaction (PCR) amplifies the nucleic acid molecules bound to the target and enters the next round of screening. Nucleic acid molecules that are completely unbound or only weakly bound to the target are washed and removed during each round of screening. After multiple rounds of screening, high affinity and high specificity are obtained. The high specificity of binding ability is mainly subject to the specific spatial structure of the fluorescent molecular probe and the electronegative attraction between each group or fragment.

[0095] As a non-limiting example, the fluorescent molecular probe can be injected into the body by intravenous injection. It reaches various organs and tissues of the body with blood circulation. At the microscopic level, there is a dynamic balance in the binding process between the fluorescent molecular probe and the antigenic epitope on the surface of a specific cell. The forward process is the binding between the fluorescent molecular probe and the antigenic epitope on the surface of a specific cell, and the reverse process is the dissociation between the probe and the antigenic epitope on the surface of a specific cell. The forward process and the reverse process are in competition with each other. If the forward trend is stronger than the reverse, the binding between the fluorescent molecular probe and the antigenic epitope on the surface of a specific cell is strengthened; if the forward trend is weaker than the reverse, the binding between the probe and the antigenic epitope is weakened. In the initial stage of the metabolic process, the fluorescent molecular probe is mainly distributed in the blood with high liquid flow rate and the tissue fluid and membrane structure that are easy to diffuse. The fluorescent molecular probe slowly enters the part with high resistance and low flow rate, and can be evenly distributed in the part with low mass transfer resistance and high liquid flow rate in the future. The transmission barrier in the tissue and cell microenvironment in the body is large, and the targeted binding is slow (not easy to be bound to the antigenic epitope on the surface of brain tissue and cells).

[0096] 5. A near-infrared brain function imager targeting antigen epitopes and a method of using the same, wherein the fifth feature is that the near-infrared real-time medical images provided by the near-infrared brain function imager have the characteristics of high signal-to-noise ratio, high accuracy and high definition, and these three characteristics are supported by evidence from research results. The evidence includes evidence from cytological research results and animal experimental data in preclinical research, as well as evidence from clinical research results.

[0097] The near-infrared real-time medical images provided by the near-infrared brain function imager can be used to diagnose and treat neurodegenerative diseases such as cognitive dysfunction, Alzheimer's disease, Parkinson's disease, etc. The clinical application effect is that the near-infrared real-time medical images with precise targeting of antigen epitopes are used to screen lymph node metastasis or occult lesions, and their accuracy is confirmed by clinical pathological results.

[0098] Cytological research includes cell biology and cell imaging research. The laser scanning confocal microscope scans the multi-fluorescent labeled tissue cells layer by layer in different channels, splits multiple fluorescence and combines overlapping synthetic images. The images can be used for in situ qualitative and quantitative identification of molecules in tissue cells, observation of subcellular structures of cells, and dynamic monitoring of living tissues and cells. Flow cytometry (FCM) quantitatively analyzes the biological properties of single cells or biological microparticles, and has the advantages of rapidity, high precision, high accuracy, multi-parameters and high throughput.

[0099] Disease occurrence and progression covers signal transduction, molecular regulation, activation or inhibition of protease enzymatic reactions. For example: Wallerian degeneration refers to the degeneration of peripheral nerve fibers induced by nerve cutting. Excitotoxicity refers to the damage and death of nerve cells caused by excessive stimulation of neurotransmitters. Mitotic catastrophe refers to DNA damage leading to tetraploidy or polyploidy. Phagocytosis refers to the death of defensive cells (such as white blood cells, macrophages, T cells, B cells, NK cells, etc.) due to engulfing foreign bodies. It involves cellular immunity, humoral immunity, and the killing effect on tumor cells and virus-infected cells. Cell necrosis refers to acute inflammation induced by plasma membrane disintegration, tissue autolysis, etc. Cell pyroptosis refers to programmed cell death caused by microbial infection and the release of pro-inflammatory factors. Cell autophagy refers to the degradation of damaged proteins or organelles after being encapsulated by autophagy. Oncosis refers to the swelling of cells that destroys the integrity of the cell membrane and squeezes the intracellular structures such as the nucleus, endoplasmic reticulum, and mitochondria. Apoptosis refers to physiological, active, conscious suicide behavior. Cornification refers to the transformation of epidermal cells from basal to stratum corneum cells and their migration to the surface. Anoikis refers to the death of adherent cells due to prolonged suspension. Senescense refers to the inactivation of cells due to DNA damage and cell poisoning after multiple in vitro doublings.

[0100] This article uses the following professional terms:

[0101] Mini-Mental State Examination (MMSE): One of the screening tools for cognitive impairment, it was selected into the Diagnostic Examination Schedule (DIS) for the epidemiological survey of mental illness by the American ECA.

[0102] Negative / Positive in flow cytometry: The negative group corresponds to the background, resting state, basal level, and no stimulation, reflecting the basal expression of the test substance in the negative group. The positive group refers to the functional state after stimulation and after drug administration.

[0103] Laser Scanning Confocal Microscopy (LSCM): Laser is used as a light source to excite fluorescent probes and scan samples. After focusing twice, a fluorescent image of the microstructure inside cells or tissues is obtained.

[0104] Alzheimer's Disease (AD): commonly known as senile dementia, clinical manifestations include memory impairment, aphasia, apraxia, agnosia, visual-spatial skill impairment, executive dysfunction, and personality and behavioral changes. Studies have shown that the misfolding of amyloid-β (Aβ) in the brain causes changes in protein function and neuronal cell toxicity or synaptic dysfunction, leading to the onset of the disease. Peptides of Aβ-related proteins are the main targets for AD diagnosis and treatment. It is necessary to determine the different targets of Aβ that the antibody specifically targets, and then screen receptors based on the amino acid sequences of different targets.

[0105] Neurodegenerative Disease (NDD): Heterogeneous diseases of the nervous system, such as vascular dementia (VD), behavior variant of Fronto-Temporal Dementia (bvFTD), Lewy Body Dementia (DLB), Posterior Cortical Atrophy (PCA), Primary Progressive Aphasia (PPA), Progressive Superanuclear Palsy (PSP), Multiple System Atrophy (MSA), Parkinson's Disease (PD), Amyotrophic Lateral Sclerosis (ALS) and Spinocerebellar Ataxia (SCA).

[0106] Mild Cognitive Impairment (MCI): An intermediate state between normal aging and dementia, characterized by mild, repetitive memory loss and a syndrome of functional impairments in language, thinking, and judgment.

[0107] Postoperative cognitive dysfunction (POCD) is one of the complications of surgery, characterized by persistent memory loss, thinking and orientation disorders after anesthesia, accompanied by a significant decrease in social activity ability.

[0108] Magnetic Resonance Spectroscopic Imaging (MRS): Utilizes the magnetic resonance phenomenon and chemical shift to analyze specific atomic nuclei and their compounds.

[0109] Functional Magnetic Resonance Imaging (fMRI): A non-invasive and non-radioactive technique for observing brain activity, using magnetic resonance imaging to measure changes in blood dynamics caused by neuronal activity. The more severe the hypoxia, the greater the blood oxygen level dependent (BOLD) signal value.

[0110] Diffusion Tensor Imaging (DTI): Based on the principle of anisotropic motion imaging, it shows the direction and degree of diffusion of water molecules in brain tissue.

[0111] Positron Emission Computed Tomography (PET): uses positron-emitting radionuclides to label human metabolites such as glucose as imaging agents, and the uptake of imaging agents by the lesions is used to reflect their metabolic changes.

[0112] BOLD (Blood Oxygen Level Dependent imaging) MRI: indirectly observes brain activity and changes in specific brain areas by measuring blood oxygen levels.

[0113] Cerebrospinal fluid (CSF) is a colorless, transparent liquid that surrounds the central nervous system (brain and spinal cord), mainly found in the spaces inside the skull and spine.

[0114] Glial Fibrillary Acidic Protein (GFAP): The main cytoskeletal protein that constitutes glial cells, it is a marker for astrocyte activation, early diagnosis of AD and prediction of disease onset.

[0115] Phosphorylated Tau (P-tau): Microtubule-associated protein (Tau) is the main component of neurofibrillary tangles and a marker for neurodegenerative diseases such as Alzheimer's disease (AD).

[0116] The beneficial effects of the present invention are: research and development of relevant biomarkers and establishment of efficient and accurate medical imaging technology, improvement of quantitative evaluation system, in-depth exploration of the occurrence and development mechanism of cognitive dysfunction and promotion of rapid development of diagnosis and treatment technology. Multimodal fMRI technology (BOLD, DTI, MRS, PWI, etc.) improves the accuracy, sensitivity and specificity of diagnosis from multiple perspectives of function, metabolism and morphology.

[0117] 6. A near-infrared brain function imager targeting antigen epitopes and a method of using the same, wherein the near-infrared real-time medical images provided by the near-infrared brain function imager can be used to monitor the pathological physiological processes of disease occurrence and immune regulation of tissues and cells, including but not limited to monitoring cell damage, aging, apoptosis, and even canceration trends. The fluorescent molecular probes used by the near-infrared brain function imager accurately target antigen epitopes of brain tissues and specific cells.

[0118] The near-infrared real-time medical images provided by the near-infrared brain function imager can be used to monitor the occurrence of diseases in tissues and cells and the immune regulation process. Antigenic epitopes are involved in the immune balance in the physiological or pathological process of the human body. Real-time positioning of antigenic epitopes means that the near-infrared brain function imager can be used to monitor the aging, apoptosis and even canceration trends of specific cells.

[0119] The real-time medical images of the near-infrared brain function imager reflect the interaction between the brain and the immune system. The brain and the immune system communicate in a two-way manner, and any immune process occurring at the border of the brain may be unbalanced. The disease progression of tissues and cells involves the activation, expression, and regulation of a series of genes. It involves both pathological damage and the adaptive regulation of tissues and cells under physiological conditions. IFN-α / β is a cytokine produced by virus-infected cells and has multiple biological activities. It can play antiviral, anti-tumor and immunomodulatory roles by binding to the specific receptor IFNAR on the cell surface.

[0120] The near-infrared real-time medical images provided by the near-infrared brain function imager can be used to monitor the cancerous tendency of cells. The clinical medical basis is that tumors may originate from the obstruction of cell apoptosis or uncontrolled growth and excessive proliferation. The normal physiological metabolism or immune process is unbalanced, thereby affecting the activity of antigenic epitopes of specific cells. Accordingly, the real-time medical images of the near-infrared brain function imager show significant differences.

[0121] This article uses the following professional terms:

[0122] Signaling Pathway (SP): After the extracellular molecular signal, i.e., ligand, specifically binds to the cell membrane or intracellular receptor, a series of intracellular proteins will sequentially regulate the activity of downstream proteins, resulting in various effects such as gene expression regulation, changes in intracellular enzyme activity, changes in cell skeleton morphology, or changes in DNA synthesis. For example, by inhibiting the Wnt / β-Catenin signaling pathway, the expression of vascular endothelial growth factor and matrix metalloproteinase family proteins is downregulated, thereby reducing the invasion and metastasis of tumor cells.

[0123] Interferon (IFN) is related to Aβ in the brain. The nucleic acids in the plaques activate microglia, which produce IFN, triggering a series of inflammatory reactions, leading to the loss of synapses, and ultimately causing memory loss and dementia.

[0124] The brain’s dependence on the immune system: The brain has access to its neighboring immune cells, rather than being immune-isolated, and there is a two-way communication between the brain and the immune system. Any immune process occurring at the brain’s borders could be imbalanced.

[0125] 7. A near-infrared brain function imager targeting antigen epitopes and a method of using the same, wherein the seventh feature is that the near-infrared brain function imager can be used for both precision medical imaging diagnosis and precision targeted therapy.

[0126] Regarding the application in precision medical imaging diagnosis, the near-infrared brain function imager can be used independently or in combination with other medical imaging diagnosis methods. Other medical imaging diagnosis methods include but are not limited to radiological medical imaging diagnosis, ultrasonic medical imaging diagnosis, nuclear magnetic resonance medical imaging diagnosis, etc.

[0127] Regarding the application in precision targeted therapy, the near-infrared brain function imager can be used independently or in combination with other targeted therapy methods. Other targeted therapy methods include but are not limited to chemodynamic therapy (CD), electrochemical therapy (EChT), electromagnetic therapy (EMT), photodynamic therapy (PDT), sonodynamic therapy (SDT), radiodynamic therapy (RD), etc.

[0128] In the first aspect, the near-infrared brain function imager is jointly applied to precision medical imaging diagnosis. For example, the near-infrared brain function imager can be combined with other medical imaging diagnostic methods or clinical pathological diagnostic methods to jointly accurately diagnose cognitive dysfunction, Alzheimer's disease, Parkinson's disease and other neurodegenerative diseases. The real-time medical images provided by the near-infrared brain function imager can be integrated, converted, grafted, and added to other medical imaging diagnostic methods.

[0129] Secondly, the real-time medical images provided by the near-infrared brain function imager are applied in clinical treatment, and are applicable to neurodegenerative diseases such as cognitive dysfunction, Alzheimer's disease, Parkinson's disease, etc. The near-infrared brain function imager provides targeted antigen epitope technology, which can be integrated, converted, grafted, and added to existing therapies during the treatment of diseases.

[0130] As an example, the near-infrared brain function imager is used for precision targeted treatment of tumors with reference to the following indicators: the content of interferon-γ and IL-4 in tumor cells, whether peripheral blood lymphocytes (such as CD3 and CD4 positive lymphocytes) increase, and the CD4 / CD8 ratio of positive lymphocytes. Precision targeted therapy is applicable to a variety of tumors, such as malignant melanoma, basal cell carcinoma of the skin, squamous cell carcinoma of the skin, hepatocellular carcinoma, colon cancer, ovarian cancer, oral cancer, pancreatic cancer, etc.

[0131] As a special case, near-infrared real-time medical imaging can be converted to photodynamic diagnosis and treatment. The depth of penetration of photoacoustic or photoelectric signals that precisely target antigenic epitopes of specific cells is greatly increased. The penetration ability (fluorescence penetration of the mucosal muscular layer, the muscular layer of the vessel wall or the capsule layer up to 8mm) is increased fivefold (penetrating the smooth muscle layer up to 4cm).

[0132] 8. A near-infrared brain function imager targeting antigen epitopes and a method of using the same, wherein the eighth feature is that the near-infrared brain function imager uses near-infrared fluorescent molecular probes to target antigen epitopes that are frequently expressed by the Chinese population and exhibits characteristics such as high specificity and high affinity.

[0133] The near-infrared brain function imager is not only easy to screen clinical subjects, but also greatly improves the accuracy, efficacy and safety of diagnosis and treatment. Based on the precise matching of the genetic background of Asians, the near-infrared real-time medical imaging is suitable for personalized precision medicine and diagnosis. In particular, the near-infrared fluorescent molecular probe accurately targets the human leukocyte antigen HLA-A11, which is highly expressed in human brain tissue and specific cells.

[0134] Because European and American technologies serve the genetic characteristics of European and American races that express HLA-A2 at a high frequency, the near-infrared brain function imager can more accurately and efficiently respond to the clinical needs of Asian races and even further focus on the Chinese race.

[0135] The beneficial effect is that the near-infrared brain function imager uses a near-infrared fluorescent molecular probe to accurately target the human leukocyte antigen HLA-A11 that is highly expressed in Asians. It is suitable for Asians and has the characteristics of accurate imaging, significant efficacy, gene matching, and clinical safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0136] The present invention will be further described below in conjunction with the accompanying drawings. It should be noted that the following embodiments are based on the present technical solution and provide detailed implementation methods and specific operating processes, but the protection scope of the present invention is not limited to these embodiments.

[0137] Figure 1 The targeted binding technology of the present invention improves the signal-to-noise ratio and accuracy of the brain function imager.

[0138] Figure 2 It is a schematic diagram of the principle of the fNIRS and brain function imaging instrument of the present invention.

[0139] Figure 3 It is a schematic diagram of the signal pattern, target affinity screening and target binding molecular mechanism of the brain function imager of the present invention.

[0140] Figure 4 Schematic diagram of the pathogenic mechanism of common neurodegenerative diseases involved in the present invention.

[0141] Figure 5 Schematic diagram of the protein target screening and vector information involved in the present invention and animal experiments of CNS-targeted Antigen.

[0142] Figure 6 This is the result of the targeted binding experimental study of the present invention (recombination, identification and imaging of nucleic acid fragments).

[0143] Figure 7 This is the vector information (restriction enzyme cutting site distribution map and multiple cloning site) of the targeting antigen epitope of the present invention.

[0144] Figure 8 It is the nucleic acid sequence information (gene cloning and expression region) of the target antigen epitope of the present invention.

[0145] Fig. 9 Quantitative analysis of binding affinity studies in the targeted binding properties of the present invention.

[0146] Fig.10 It is a schematic diagram of the clinical research of the present invention (proving that targeted binding can improve the signal-to-noise ratio and accuracy of brain function imaging equipment). DETAILED DESCRIPTION

[0147] A near-infrared brain function imager targeting an antigen epitope and a use method thereof. The near-infrared brain function imager relates to a targeted antigen epitope.

[0148] In the first embodiment, the present invention provides a method for targeting antigenic epitopes, preferably, targeting specific antigenic epitopes with artificially designed protein molecule fragments or nucleic acid molecule fragments. The task of artificial intelligence design is to optimize the ligand structure to facilitate ligand recognition and targeted binding to specific antigenic epitopes. Artificially designed protein molecule fragments or nucleic acid fragments can enhance targeted binding affinity and specificity. As a non-limiting example, the following nucleic acid fragment can be applied to the near-infrared brain function imager. It contains all or part of sequence 1; all or part of sequence 1, plus one or more sequence fragments of three sequences such as sequence 2, 3, and 4.

[0149] Sequence 1 (SEQ ID NO: 1): abbreviated as CT83.

[0150] ATGAACTTCTATTTACTCCTAGCGAGCAGCATTCTGTGTGCCTTGATTGTCTTCTGGAAATATCGCCGCT

[0151] TTCAGAGAAACACTGGCGAAATGTCATCAAATTCAACTGCTCTTGCACTAGTGAGACCCTCTTCTTCT

[0152] GGGTTAATTAACAGCAATACAGACAACAATCTTGCAGTCTACGACCTCTCTCGGGATATTTTAAATAAT

[0153] TTCCCACACTCAATAGCCAGGCAGAAGCGAATATTGGTAAACCTCAGTATGGTGGAAAACAAGCTGG

[0154] TTGAACTGGAACATACTCTACTTAGCAAGGGTTTCAGAGGTGCATCACCTCACCGGAAATCCACCTAA

[0155] Note: Because sequence 1 (SEQ ID NO: 1), i.e., CT83, is not a formal circular RNA sequence, it is necessary to conduct experiments based on the subsequent implementation schemes of the present invention to verify whether it is expressed in a ring, and then apply it to the targeted binding link of the present invention.

[0156] Sequence 2 (SEQ ID NO: 2): abbreviated as PEGFP-C3.

[0157] Note: CMV strong promoter, with Kan screening resistance, Neo screening resistance in cells; EGFP expression fused at the C-terminus; suitable for transient cell transfection, stable cell line construction, protein localization (with fluorescent labeling).

[0158] CGCGGGTTCTTCTCGGCATGGACGAGCTGTACAAGTACTCAGATCTCGAGGCCACCATGAACTTCTAT

[0159] TTACTCCTAGCGAGCAGCATTCTGTGTGCCCTTGATTGTCTTCTGGAAATATCGCCGCTTTCAGAGAAAC

[0160] ACTGGCGAAATGTCATCAAATTCAACTGCTCTTGCACTAGTGAGACCCTCTTCTTCTGGGTTAATTAAC

[0161] AGCAATACAGACAACAATCTTGCAGTCTACGACCTCTCTCGGGATATTTTAAATAATTTCCCACACTCA

[0162] ATAGCCAGGCAGAAGCGAATATTGGTAAACCTCAGTATGGTGGAAAACAAGCTGGTTGAACTGGAAC

[0163] ATACTCTACTTAGCAAGGGTTTCAGAGGTGCATCACCTCACCGGAAATCCACCCGGGATCCACCGGAT

[0164] CTAGATAACTGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCAC

[0165] ACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATA

[0166] ATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTT

[0167] GTGGTTTGTCCAAACTCATCAATGTATCTTAACGCGTAAATTGTAAGCGTTAATATTTTGTTAAAATTCG

[0168] CGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATC

[0169] AAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAAC

[0170] GTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGCGATGGCCCACTACGTGAACCATCACC

[0171] CTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGA

[0172] TTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGATGGAAGAAAGCGAAAGGAGCG

[0173] GCGCTAGGCGCTGCAAGTGTAGCGGTCACGCTGCGCGTAACCACACACCGCGCGCTATGCGCGCTAC

[0174] AGGCGCCGTCAGTGGCACTTTTCGGGGAATGTGCGCCGAACCCAATGGTTAATTTCTAAA

[0175] Sequence 3 (SEQ ID NO:3): The short name is PET-28a.

[0176] GGGGATACATTTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGGCAGCAGC

[0177] CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGCTAGCATGACTGGTGG

[0178] ACAGCAAATGGGTCGCGGATCCGCCACCATGAACTTCTATTTACTCCTAGCGAGCAGCATTCTGTGTG

[0179] CCTTGATTGTCTTCTGGAAATATCGCCGCTTTCAGAGAAACACTGGCGAAATGTCATCAAATTCAACT

[0180] GCTCTTGCACTAGTGAGACCCTCTTCTTCTGGGTTAATTAACAGCAATACAGACAACAATCTTGCAGT

[0181] CTACGACCTCTCTCGGGATATTTTAAATAATTTCCCACACTCAATAGCCAGGCAGAAGCGAATATTGGT

[0182] AAACCTCAGTATGGTGGAAAACAAGCTGGTTGAACTGGAACATACTCTACTTAGCAAGGGTTTCAGA

[0183] GGTGCATCACCTCACCGGAAATCCACCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCT

[0184] AACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTG

[0185] GGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATTGGCGAATGGG

[0186] ACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACT

[0187] TGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCC

[0188] CCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCA

[0189] AAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGA

[0190] CGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAACTGGAACAACACTCAACCCTATCTCGG

[0191] TCTATTCTTTTGATTTATAAGGATTTTGCCGATTTCGGGCCTATTGGGTTAAAAATGAGCTGAT

[0192] Note: Eukaryotic expression vector, the vector comes with a His purification tag for protein purification.

[0193] Sequence 4 (SEQ ID NO:4): abbreviated as C-1170+CT83.

[0194] Note: Circularization vectors are used to construct circularized genes to achieve circular expression.

[0195] Its characteristic is that it contains the following two fragments: The first fragment is as follows:

[0196] GATCTATACTTTTCTGATATTATAAAGATAGTTATCTTCTCCAAGGGAAAAAATCATCTTCATGGAAATTAATTACTTTTTTACAAATTGTGAATTTGACCCTTAAGAGTTTTCTTCCTGATATTTAAAATTGAAAAAAAAAATTGTTGACATTAATATTTCTTCTTTCGAATTC

[0197] The second snippet is as follows:

[0198] GGATCCTAGCTAACAACTCCATACTTTTTGGTTGTTTATTAATGTGAAATTTCTGCTAAATGAAATACTTTTGTGTGTGTTTGTTGGTAGAAGAGACCACTTCAGTTAAATAAGGAAATCAAGAGAGGATCAATTTAGGAAGATTCAGATATACA

[0199] Sequence 5 (SEQ ID NO:5): abbreviated as CT83-C3-XhoIF.

[0200] Note: Amplification primer sequence

[0201] 5'CCGCTCGAGGCCACCATGAACTTCTATTTACTCCTAGCGAGCAG 3'

[0202] Sequence 6 (SEQ ID NO: 6): abbreviated as CT83-C3-BamHIR

[0203] Note: Amplification primer sequence

[0204] 5'CGCGGATCCCGGGTGGATTTCCGGTGAGGTGATGCACCTCT 3'

[0205] In a second embodiment, the fluorescent molecular probe is connected to the therapeutic agent, diagnostic agent, imaging agent or targeting agent via a covalent bond. The covalent bond includes polar bonds, non-polar bonds, coordination bonds, single bonds, double bonds, triple bonds, σ bonds, π bonds and the like.

[0206] In a third embodiment, the present invention is directed to a method for operating a laser scanning confocal microscope.

[0207] The OLYMPUS-IX81-FV1000 laser scanning confocal microscope with a 40x objective was used to scan and collect images in three channels. FITC was selected for the first channel: excitation light 488nm, emission wavelength 530nm, green; CY3 was selected for the second channel: excitation light 543nm, emission wavelength 590nm, red; DAPI was selected for the third channel: excitation light 405nm, emission wavelength 420nm, blue. 4 to 5 fields of view were taken for each slice, respectively, for single-channel monochrome fluorescence images and multi-channel multiple fluorescence composite images, and the collected digital images were stored and applied to subsequent image research.

[0208] In a fourth embodiment, the present invention provides a technical strategy that can be used in conjunction with the multiple immunofluorescence labeling technology of the near-infrared brain functional imager to effectively reduce fluorescence interference from impurities.

[0209] Ensure that the overlapping areas of several fluorescence emission wavelengths are as small as possible. The results of the study confirmed that washing with PBS buffer solution can significantly reduce the fluorescence interference from residual impurities. Therefore, sufficient washing should be ensured when preparing fluorescent probes. In the operation of near-infrared brain functional imaging instruments targeting antigen epitopes, it is necessary to avoid long-term exposure of specimens when previewing and scanning under the microscope to avoid inducing fluorescence quenching.

[0210] In the fifth embodiment, the experiment confirmed that the receptor can target the antigen epitope and the near-infrared brain function imager applied the targeted antigen epitope technology. Anti-Aβ antibodies have been shown in clinical studies to improve and delay the expression of cognitive function. A near-infrared medical imaging and clinical safety evaluation targeting the Aβ antigen epitope were carried out using an oligomeric monoclonal antibody against the Aβ protein. Patients with Aβ-positive early AD were confirmed by positron emission tomography (PET) imaging or cerebrospinal fluid examination. Compared with the placebo group, a 2-month clinical study confirmed that the high-dose receptor group (10 mg / kg) maintained roughly consistent cognitive function. About 80% of patients had no significant difference in brain Aβ (based on PET and cerebrospinal fluid Aβ indicators), and magnetic resonance imaging (MRI) confirmed that the incidence of amyloid-related abnormal imaging edema (ARIA-E) was not significantly different (<10%).

[0211] As a non-limiting example, the near-infrared brain function imager targeting antigen epitopes is used for early diagnosis of asymptomatic Alzheimer's disease. The new plasma marker GFAP can be used for early diagnosis of asymptomatic Alzheimer's disease. Plasma glial fibrillary acidic protein can identify neurodegenerative diseases with high diagnostic accuracy (AUC value exceeds 0.85). Higher levels of plasma glial fibrillary acidic protein are closely related to cognitive decline and significantly increase the clinical risk of AD.

[0212] The artificially designed nucleic acid molecule fragments can improve the high specificity and high affinity of the fluorescent molecular probe. Furthermore, the near-infrared brain function imager uses fluorescent molecular probes to achieve real-time positioning and precise targeting of specific antigen epitopes of human brain tissue and specific cells.

[0213] In a sixth embodiment, the present invention provides a method for preparing a fluorescent molecular probe capable of targeting and binding to an antigen epitope.

[0214] For those skilled in the art, various corresponding changes and modifications can be made according to the above technical solutions and concepts, and all of these changes and modifications should be included in the protection scope of the claims of the present invention.

[0215] The following mainly involves the construction of gene overexpression vector.

[0216] (1) Amplification primer sequences: abbreviated as CT83-EcoRIF and CT83-BamHIR, see the specific embodiments of the present invention, sequence 5 (SEQ ID NO: 5) and sequence 6 (SEQ ID NO: 6), see P16 for sequence information.

[0217] Template cDNA preparation: Human 293t cells were collected by centrifugation, 1 ml of Trizol (Invitrogen) solution was added, pipetting was performed to mix well to fully lyse the cells, and the cells were allowed to stand for 5 minutes.

[0218] Total RNA purity and integrity test: Take 1 μl RNA sample and dilute it 50 times to confirm the OD 260 / OD 280 The ratio is greater than 1.8.

[0219] Total RNA integrity test: Take 1 μl of RNA sample, perform 1% agarose gel electrophoresis, and use EB staining for 10 minutes to observe the 5s rRNA, 18s rRNA and 28s rRNA bands of total RNA using a gel imaging system.

[0220] (2) Reverse transcription: Prepare a solution in an RNase free PCR tube; pipette the solution evenly and keep it at 65°C for 5 minutes to denature the RNA. Then immediately cool it on ice to prevent RNA renaturation; add reagents to the PCR tube; keep 20 μl of the reaction solution at 30°C for 10 minutes; 42°C for 60 minutes; and 72°C for 10 minutes. Store at -20°.

[0221] (3) PCR reaction system: Prepare the following system in a 0.2 mL EP tube. Dilute the cDNA template stock solution 20 times and take 0.5 μL for amplification. Mix well and then perform PCR amplification. After 1% gel electrophoresis of the PCR product, cut the gel band containing the target gene fragment with a scalpel under UV light and put it into a clean 1.5 mL EP tube. After weighing, add solution BD to the centrifuge tube at a ratio of 100 mg gel to 100 μL solution BD. Incubate in a 60°C water bath for 10 min until the gel is completely dissolved. Oscillate and mix 3 times during the water bath. Transfer the solution to a DNA purification column, let it stand for 2 min, centrifuge at room temperature and discard the filtrate. Add 500 μL solution PE to the column, centrifuge at 12,000 rpm at room temperature for 1 min, and discard the filtrate. Repeat the operation once. Centrifuge the empty column at room temperature to remove the residual liquid. Place the column in a new 1.5 mL EP tube, add 30 μL of 60°C preheated sterile water, and centrifuge to elute the DNA.

[0222] (4) PCR recovery product and vector double enzyme digestion: In two sterile 0.2 mL EP reaction tubes, take 15 μL of CT83 PCR recovery product and C-1170 vector respectively, and double digest with EcoRI / BamHI.

[0223] (5) Recovering the enzyme cleavage product (DNA gel recovery kit): After the enzyme cleavage product is subjected to 1% gel electrophoresis, use a scalpel to cut the gel bands containing the target fragment and the vector into a clean 1.5mL EP tube under ultraviolet light, and add solution BD to the centrifuge tube. Incubate in a 60℃ water bath until the gel is completely dissolved, and oscillate to mix 3 times. Transfer to a DNA purification column, let it stand, centrifuge at 12000rpm at room temperature for 1min, and discard the filtrate. Add 500μL solution PE, centrifuge at 12000rpm at room temperature for 1min, and discard the filtrate. Repeat the previous operation once. Centrifuge the empty column at 12000rpm for 1min to completely remove the residual liquid in the purification column. Place the column in a new 1.5mL EP tube, add 30μL of sterile water preheated at 60℃ to the column, and centrifuge to elute the DNA.

[0224] (6) Ligation of target fragment and vector: Add the following reagents (PCR product recovered by enzyme digestion, vector recovered by enzyme digestion (C-1170); 10× Ligase Buffer; T4 DNA Ligase; ddH2O) into a 0.2 mL EP tube and ligate at 16°C for 1 h.

[0225] (7) Transformation of ligation products: Add 5 μL of ligation products to 50 μL of DH5α competent cells in an ice bath. Gently rotate to mix, and place on ice for 30 min. Heat shock in a 42°C water bath for 90 s. Quickly transfer the tube to an ice bath and place on ice for 2 min. Add 200 μL of LB culture medium, mix, and culture at 37°C and 200 rpm. Spread the bacterial solution evenly on an LB plate containing ampicillin (Amp 100 μg / mL), place at room temperature, then invert the plate and transfer it to a 37°C biochemical incubator for overnight culture.

[0226] (8) Identification of positive clones by plasmid digestion: Pick several single clones from the plate and culture them in a 3 mL LB tube on a shaker overnight; for plasmid extraction, collect 3 μL of bacterial solution in a 1.5 mL EP tube, centrifuge at 12,000 rpm for 1 min, and discard the supernatant. Add 250 μL of solution I / RNase A mixture to resuspend the bacteria. Add 250 μL of solution II, gently invert and mix 6 times, and let it stand at room temperature for 2 min. Add 350 μL of solution III and mix. Centrifuge at 12,000 rpm for 10 min, remove the supernatant and transfer it to a DNA purification column, and let it stand for 2 min. Centrifuge at 12,000 rpm for 1 min, and discard the filtrate. Add 500 μL of solution PB to the column, centrifuge at 12,000 rpm for 1 min, and discard the filtrate. Add 500 μL of solution W to the column, centrifuge at 12,000 rpm for 1 min, and discard the filtrate. Repeat once. Centrifuge the empty column at 12,000 rpm for 3 min. The column was removed and placed in a new 1.5 mL EP tube, 50 μL sterile water (preheated at 60°C) was added, and the tube was allowed to stand for 2 min, and centrifuged at 13400 rpm for 1 min to elute the plasmid. The extracted plasmid was identified by enzyme digestion. The enzyme digestion was carried out at 37°C for 2 h. The enzyme digestion products were separated by 1% agarose gel electrophoresis containing ethidium bromide (EB) and imaged by UVP gel imaging system.

[0227] (9) A band was cut out at the corresponding position, indicating that a positive clone was obtained. The positive plasmid was outsourced for sequencing.

Claims

1. A near-infrared brain function imager targeting antigen epitopes and a method of using the same, characterized in that: The near-infrared brain function imager uses near-infrared fluorescent molecular probes to target antigenic epitopes of human brain tissue and specific cells. The generated near-infrared medical imaging images can be accurately targeted and positioned in real time, and can be used to diagnose and treat cognitive dysfunction, Alzheimer's disease, Parkinson's disease and other neurodegenerative diseases. The near-infrared fluorescent molecular probe contains a near-infrared fluorophore and specifically recognizes cell surface antigen epitopes through ligand structure. The cell surface antigen epitopes can reflect the antigen immunological process of neurodegenerative diseases such as cognitive dysfunction, Alzheimer's disease, Parkinson's disease, etc. The binding process between the near-infrared fluorescent molecular probe and the cell surface antigen epitope is specific, sensitive and stable. The near-infrared fluorophore of the near-infrared fluorescent molecular probe is excited under light of a specific frequency. The generated fluorescence signal follows an exponential decay law. It can be collected by the near-infrared brain function imager to generate near-infrared real-time medical images. The near-infrared real-time medical images have the characteristics of high signal-to-noise ratio, high accuracy and high definition.

2. The near-infrared brain function imager according to claim 1, characterized in that: The near-infrared brain function imager comprises the following four steps: (1) preparation process and quality research of near-infrared fluorescent molecular probes; (2) specific recognition of cell surface antigen epitopes by near-infrared fluorescent molecular probes; (3) generation of fluorescent signals by near-infrared fluorescent molecular probes upon excitation; and (4) medical imaging processing for precise targeting and real-time positioning.

3. The near-infrared brain function imager according to claim 1, characterized in that: The near-infrared medical image generated by the near-infrared brain function imager can accurately target and locate in real time. The near-infrared medical image has the characteristics of high signal-to-noise ratio, high accuracy and high definition, which correspond to the low-noise signal characteristics of imaging diagnosis, the specific binding characteristics of antigen immunology, and the high accuracy characteristics of molecular immunology. The specific binding property is derived from the precise match between the ligand structure of the near-infrared fluorescent molecular probe and the cell surface antigen epitope. The ligand structure of the near-infrared fluorescent molecular probe refers to any atom, ion or molecule that can interact with the cell surface antigen epitope (including ionic bonds, covalent bonds, coordination bonds, metal bonds or hydrogen bonds, etc.). The molecule can be a small chemical molecule or a biological macromolecule (protein, nucleic acid, polysaccharide and lipid, etc.). The ligand structure of the near-infrared fluorescent molecular probe can include nucleic acids or nucleic acid fragments and their analogs and modifications, and allow the near-infrared fluorescent molecular probe to target and bind to cell surface antigen epitopes. The nucleic acids or nucleic acid fragments and their analogs and modifications are preferably all or part of sequence 1; all or part of sequence 1, plus all or part of one or more of the three sequences of sequence 2, 3, and 4. Further preferably, the 1st to 255th fragments of sequence 1 correspond to the 57th to 311th of sequence 2, the 166th to 420th of sequence 3, and the 1068th to 1322nd of sequence 4. This fragment is as follows: ATGAACTTCTATTTACTCCTAGCGAGCAGCATTCTGTGTGCCTTGATTGTCTTCTGGAAATATCGCCGCTTTCAGAGAAACACTGGCGAAATGTCATCAAATTCAACTGCTCTTGCACTAGTGAGACC CTCTTCTTCTGGGTTAATTAACAGCAATACAGACAACAATCTTGCAGTCTACGACCTCTCTCGGGATATTTTAAATAATTTCCCACACTCAATAGCCAGGCAGAAGCGAATATTGGTAAACCTCAGT.

4. The near-infrared brain function imager according to claim 1, characterized in that: The near-infrared medical imaging images generated by the near-infrared brain functional imager have the characteristics of high signal-to-noise ratio, high accuracy and high definition, and the supporting evidence includes the results of cytological studies in preclinical studies, animal experimental results and clinical research results. The near-infrared brain function imager generates medical imaging images with precise targeting and real-time positioning, the background noise signal is filtered, the fluorescence penetration depth can reach 8mm through the mucosal muscular layer, the vessel wall muscular layer or the capsule layer, and the image signal-to-noise ratio can exceed 20. The near-infrared fluorescent molecular probe maintains the characteristics of high signal-to-noise ratio and strong fluorescent signal for 8 to 24 hours after entering the body, and is suitable for use as a fluorescent signal source for the near-infrared brain function imager. The optimal detection time for targeted binding is 4 to 48 hours.

5. The near-infrared brain function imager according to claim 1, characterized in that: The near-infrared real-time medical images provided by the near-infrared brain function imager confirm that the near-infrared fluorescent molecular probe accurately targets the antigen epitopes of human brain tissue and specific cells, and is used to diagnose and treat neurodegenerative diseases such as cognitive dysfunction, Alzheimer's disease, and Parkinson's disease. The clinical effect is that near-infrared medical imaging images can be used to screen lymph node metastasis or occult lesions, and its accuracy has been confirmed by clinical pathological test results.

6. The near-infrared brain function imager according to claim 1, characterized in that: The near-infrared real-time medical images generated by the near-infrared brain function imager are used to monitor the occurrence of diseases and immune regulation of tissues and cells, including but not limited to monitoring cell damage, aging, apoptosis and even cancer trends.

7. The near-infrared brain function imager according to claim 1, characterized in that: The near-infrared brain function imager can be applied to precision medical imaging diagnosis and can also be applied to precision targeted therapy. The near-infrared brain function imager can be used independently or in combination with other medical imaging diagnostic methods (including but not limited to radiological medical imaging, ultrasonic medical imaging, nuclear magnetic medical imaging, etc.).

8. The near-infrared brain function imager according to claim 1, characterized in that: The near-infrared brain function imager uses near-infrared fluorescent molecular probes to target antigen epitopes that are frequently expressed by the Chinese population and exhibits characteristics such as high specificity and high affinity. The near-infrared brain function imager is not only easy to screen clinical subjects, but also greatly improves the accuracy, efficacy and safety of diagnosis and treatment. Based on the precise matching of the genetic background of Asians, the near-infrared real-time medical imaging is suitable for personalized precision medicine and diagnosis. In particular, the near-infrared fluorescent molecular probe accurately targets the human leukocyte antigen HLA-A11, which is highly expressed in human brain tissue and specific cells. Because European and American technologies serve the genetic characteristics of European and American races that express HLA-A2 at a high frequency, the near-infrared brain function imager can more accurately and efficiently respond to the clinical needs of Asian races and even further focus on the Chinese race. The beneficial effect is that the near-infrared brain function imager uses a near-infrared fluorescent molecular probe to accurately target the human leukocyte antigen HLA-A11 that is highly expressed in Asians. It is suitable for Asians and has the characteristics of accurate imaging, significant efficacy, gene matching, and clinical safety.

Images