Application of 4-hydroxyisoleucine in preparation of medicine for treating atherosclerosis

Abstract

The invention discloses application of 4-hydroxyisoleucine in preparation of a medicine for treating atherosclerosis, and belongs to the technical field of medicines. The invention provides an application of 4-hydroxyisoleucine in preparation of a medicine for treating atherosclerosis. The provided 4-hydroxyisoleucine can inhibit the expression of ABCG1 in macrophages induced by oxLDL in a dose-dependent manner. The invention further provides a pharmaceutical composition for preventing, relieving and / or treating atherosclerosis. The pharmaceutical composition comprises the 4-hydroxyisoleucine. The invention provides the application of 4-hydroxyisoleucine in preparation of the medicine for treating atherosclerosis, and the application of 4-hydroxyisoleucine in preparation of the medicine for treating atherosclerosis is realized by reducing blood fat, inhibiting PPAR-gamma / CD36 signal channels, reducing lipid content in macrophages, inhibiting oxLDL-induced ABCG1 expression and inflammatory factor generation, inhibiting atherosclerotic plaque formation and relieving aortic valve fibrosis lesion degree, so that the application of 4-hydroxyisoleucine in preparation of the medicine for treating atherosclerosis is realized. The stability of atherosclerotic plaques is promoted, and

Description

Technical Field

[0001] The invention belongs to the field of medical technology, and particularly relates to application of 4-hydroxyisoleucine in preparing a medicine for treating atherosclerosis. Background Art

[0002] Atherosclerosis is a chronic inflammatory disease characterized by lipid accumulation, inflammatory response and fibrosis in the arterial wall, which leads to thickening and hardening of the arterial wall and eventually the formation of plaques. These plaques may cause vascular stenosis, reduce blood flow, and even cause serious cardiovascular events such as myocardial infarction and cerebral infarction. The main pathological basis of atherosclerosis is the accumulation of foam cells in the intima layer of the arterial wall. These foam cells are mainly transformed from macrophages that have engulfed oxidized low-density lipoprotein (oxLDL). Macrophages play a key role in the development of atherosclerosis. They not only participate in the formation of plaques, but also aggravate the inflammatory response by releasing inflammatory factors, affecting the stability of plaques.

[0003] At present, the treatment of atherosclerosis mainly focuses on lipid-lowering and anti-inflammatory aspects. Although statins, as the first-line treatment for lowering cholesterol, have achieved certain clinical efficacy, long-term use may cause side effects such as myopathy and liver damage. In addition, intervention in inflammatory signaling pathways also shows therapeutic potential, but there is currently a lack of therapeutic drugs with strong specificity and few side effects. Therefore, the development of new treatment methods, especially those that can both regulate blood lipids and fight inflammation, is of great significance for the prevention and treatment of atherosclerosis. Summary of the invention

[0004] In order to solve the above technical problems, the present invention proposes the use of 4-hydroxyisoleucine in the preparation of a drug for treating atherosclerosis, which inhibits the formation of atherosclerotic plaques, reduces the degree of aortic valve fibrosis, promotes the stabilization of atherosclerotic plaques, and thus treats atherosclerosis by lowering blood lipids, inhibiting the PPAR-γ / CD36 signaling pathway, reducing the lipid content in macrophages, and inhibiting oxLDL-induced ABCG1 expression and inflammatory factor production.

[0005] To achieve the above object, the present invention provides the use of 4-hydroxyisoleucine in preparing a drug for treating atherosclerosis.

[0006] Preferably, the 4-hydroxyisoleucine is used for preventing, alleviating and / or treating atherosclerosis.

[0007] Preferably, the 4-hydroxyisoleucine treats atherosclerosis by lowering blood lipids, inhibiting the PPAR-γ / CD36 signaling pathway, reducing lipid content in macrophages, and inhibiting oxLDL-induced ABCG1 expression and inflammatory factor production.

[0008] Preferably, the 4-hydroxyisoleucine can dose-dependently inhibit the expression of ABCG1 induced by oxLDL in macrophages.

[0009] The present invention also provides the use of the 4-hydroxyisoleucine in preparing a drug for preventing, alleviating and / or treating oxLDL-induced atherosclerosis.

[0010] The present invention also provides a pharmaceutical composition for preventing, alleviating and / or treating atherosclerosis, comprising the 4-hydroxyisoleucine.

[0011] Preferably, a pharmaceutical composition comprises the 4-hydroxyisoleucine as an active ingredient and a pharmaceutically acceptable carrier.

[0012] The present invention also provides a pharmaceutical preparation comprising a therapeutically effective amount of the 4-hydroxyisoleucine and a pharmaceutically acceptable excipient.

[0013] The pharmaceutical preparations include the following dosage forms: oral preparations (such as tablets, capsules, solutions or suspensions); injectable preparations (such as injectable solutions or suspensions, or injectable dry powders, which can be used immediately by adding injection water before injection) and local preparations (such as ointments or solutions).

[0014] The carrier used in the pharmaceutical composition of the present invention is a common carrier available in the pharmaceutical field, including: binders, lubricants, disintegrants, solubilizers, diluents, stabilizers, suspending agents, pigments, flavoring agents, etc. for oral preparations; preservatives, solubilizers, stabilizers, etc. for injectable preparations; bases, diluents, lubricants, preservatives, etc. for local preparations. The pharmaceutical preparations can be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally or topically), and if some drugs are unstable under gastric conditions, they can be formulated into enteric-coated tablets.

[0015] Compared with the prior art, the present invention has the following advantages and technical effects:

[0016] (1) The present invention discloses the use of 4-hydroxyisoleucine in the treatment of atherosclerosis. 4-hydroxyisoleucine can effectively reduce the cholesterol level in the blood of ApoE- / - mice, reduce the blood lipid content, and inhibit the formation of arterial plaques.

[0017] (2) 4-Hydroxyisoleucine reduces the severity of aortic valve fibrosis and promotes plaque stability, which is of great significance for the prevention of cardiovascular diseases.

[0018] (3) In terms of inflammatory response, 4-hydroxyisoleucine significantly inhibited the production of inflammatory factors, including NLRP3 and IL-18, in RAW 264.7 cells induced by oxLDL, and alleviated the inflammatory process of atherosclerosis. By regulating macrophage function, 4-hydroxyisoleucine inhibited the PPAR-γ / CD36 signaling pathway, reduced macrophage phagocytosis of oxLDL, reduced intracellular lipid content, and thus reduced the formation of foam cells. At the same time, 4-hydroxyisoleucine significantly inhibited the expression of ABCG1 in RAW264.7 cells induced by oxLDL, reduced the excretion of cholesterol to the extracellular space, and reduced the formation of cholesterol crystals in plaques. This shows that 4-hydroxyisoleucine can be used as a drug for the treatment of atherosclerosis, providing a new drug for the prevention and treatment of atherosclerosis.

[0019] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 A flowchart of the construction and treatment of an atherosclerosis mouse model provided in Example 1 of the present invention;

[0021] Figure 2 The results of constructing an atherosclerosis mouse model in Example 1, wherein: Figure 2 A in the figure is a statistical chart of weight changes in the mouse model. Figure 2 B is the electron microscopic image of the aortic arch of mice in the model group, with a scale of 100 μm;

[0022] Figure 3 This is a statistical chart of blood routine and cholesterol content of mice in Example 1, where: Figure 3 A in the figure is a statistical chart showing changes in the number of white blood cells. Figure 3 B in the figure is a statistical chart showing changes in TNF-α content. Figure 3 C in the figure is a statistical chart showing changes in cholesterol content;

[0023] Figure 4 The results of Oil Red O staining of the mouse aorta in Example 1 are shown, wherein: Figure 4 A in the figure is the staining result of the control group mice. Figure 4 B in the figure is the staining result of mice in the model group. Figure 4 C in the figure is the staining result of the 50mg / kg 4-HIL group. Figure 4 D in the figure is the staining result of 150 mg / kg 4-HIL group;

[0024] Figure 5 The results of Masson staining of mouse aortic valve in Example 1, wherein: Figure 5 A in the figure is the staining result of the control group mice, and the scale bar is 200 μm. Figure 5B in the figure is the staining result of mice in the model group, and the scale bar is 200 μm. Figure 5 C in the figure is the staining result of the 50mg / kg 4-HIL group, and the scale bar is 200μm. Figure 5 D in the figure is the staining result of 150mg / kg 4-HIL group, the scale bar is 200μm, Figure 5 E in the figure is the staining result of the control group mice, the scale bar is 100 μm, Figure 5 F in the figure is the staining result of mice in the model group, and the scale bar is 100 μm. Figure 5 G in the figure is the staining result of the 50mg / kg 4-HIL group, and the scale bar is 100μm. Figure 5 H in the figure is the staining result of 150 mg / kg 4-HIL group, and the scale bar is 100 μm;

[0025] Figure 6 The results of Oil Red O staining of lipid content in RAW 264.7 cells induced by oxLDL in Example 1, wherein: Figure 6 A in the figure shows the staining results of the control group, 2mM 4-HIL, and 4mM 4-HIL. The scale bar is 50μm. Figure 6 B in the figure shows the staining results of oxLDL, oxLDL+2mM 4-HIL, and oxLDL+4mM 4-HIL, with a scale bar of 50μm;

[0026] Figure 7 The results of the effect of 4-HIL on the PPAR-γ / CD36 signaling pathway in oxLDL-induced macrophages in Example 1, wherein: Figure 7 A in the figure is the statistical result of PPAR-γ. Figure 7 B in the figure is the statistical result of CD36. Figure 7 C in the figure is the expression result of PPAR-γ and CD36 at the protein level. Figure 7 D in the figure is the quantitative statistical results of PPAR-γ and CD36 at the protein level;

[0027] Figure 8 The expression results of Abcg1 in RAW264.7 cells when 4-HIL inhibited oxLDL induction in Example 1, wherein: Figure 8 A in the middle shows the results of 4-HIL inhibiting the expression of Abcg1 without oxLDL induction. Figure 8 B in the figure is the result of inhibition of Abcg1 expression during oxLDL induction;

[0028] Fig. 9 The results of 4-HIL inhibiting the expression of inflammatory factors in macrophage-derived foam cells in Example 1, wherein: Fig. 9 A is a statistical chart showing the effect of 4-HIL on the mRNA level of inflammatory factor NLRP3 in RAW 264.7 cells. Fig. 9 B in the figure is a statistical chart showing the effect on the mRNA level of inflammatory factor IL18; Fig. 9 C in the figure is a statistical graph showing the effect of 4-HIL on the mRNA level of inflammatory factor NLRP3 in RAW 264.7 cells induced by oxLDL. Fig. 9 D in the figure is a statistical graph showing the effect of 4-HIL on the mRNA level of inflammatory factor IL18 in RAW 264.7 cells induced by oxLDL. DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0032] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0033] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0034] Sources of the experimental materials of the present invention: 6-8 week old SPF grade male C57BL / 6J mice and ApoE- / - mice were purchased from Jiangsu Wukong Biotechnology Co., Ltd.

[0035] 4-Hydroxyisoleucine (4-HIL) was purchased from Henan Julong Biotechnology Co., Ltd.; hematoxylin and eosin were purchased from Zhuhai Besuo Biotechnology Co., Ltd.; isopropanol and xylene were purchased from Tianjin Fuyu Fine Chemical Co., Ltd.; neutral resin was purchased from Coolaber Solelybio; anhydrous ethanol was purchased from Tianjin Zhiyuan Chemical Reagent Co., Ltd.; cholesterol content detection kit was purchased from Nanjing Jiancheng Bioengineering Institute; Mouse TNF-α ELISA kit was purchased from Lianke Biotechnology, and 40% high-fat feed was purchased from Jiangsu Wukong Biotechnology Co., Ltd.

[0036] Unless otherwise specified, other test materials and instruments and equipment are conventional test materials in this field and can be purchased through commercial channels.

[0037] Example 1

[0038] 1. Construction of atherosclerosis mouse model and treatment plan

[0039] The experimental animals were 6-8 weeks old SPF male C57BL / 6J mice and ApoE- / - mice, weighing 18±2g. The mice were raised in the Animal Experiment Center of the School of Life Sciences of Zhengzhou University. The experiment was carried out after one week of adaptation to the environment and no abnormalities were found. The breeding environment was SPF-grade, the temperature was 25°C, and the 12-hour light and dark alternation was strictly followed. During the experiment, the animals were fed with sterile ordinary feed or high-fat feed, and sterile water was used throughout the feeding process.

[0040] The experiment was divided into 4 groups, with 7 mice in each group. Male C57BL / 6J mice were used as the control group, and male ApoE- / - mice were set as the model group, 50mg / kg 4-HIL group, and 150mg / kg4-HIL group, respectively. 4-HIL was dissolved in 0.9% saline. ApoE- / - mice were successfully modeled after being fed a 40% high-fat diet for 8 weeks. After the modeling was completed, each mouse in the control group and the model group was given 200μL of 0.9% saline by gavage every day, and the drug group was given 50mg / kg 4-HIL and 150mg / kg 4-HIL. The mice were killed after continuous gavage for 6 weeks. The blood routine test, serum cholesterol content, arterial plaque formation in ApoE- / - mice, and aortic valve fibrosis in ApoE- / - mice were detected.

[0041] 1. After ApoE- / - mice were fed a high-fat diet for 8 weeks, their body weights were measured, and one mouse was randomly selected from the model group for Masson staining of the aortic arch. Figure 2 .

[0042] Depend on Figure 2 As shown in A, the body weight of mice in the model group increased significantly. Figure 2As shown in B, there is obvious plaque formation in the aortic arch of mice, which proves that the mouse model of atherosclerosis was successfully established.

[0043] 2. The effect of 4-HIL on the inflammation and cholesterol levels in the serum of ApoE- / - mice was studied by blood routine test and cholesterol content detection kit. The experimental scheme is as follows: blood is collected from the mouse eyeball, and the blood sample is subjected to blood routine test, and the ELISA kit is used to detect the TNF-α content in the serum; the cholesterol content detection kit is used to detect the cholesterol content in the serum. The results are as follows: Figure 3 .

[0044] Depend on Figure 3 As shown in A, the number of white blood cells in the model group increased significantly compared with the control group. Figure 3 B and Figure 3 As shown in C, the TNF-α content and cholesterol level in serum also increased. Compared with the model group, the number of white blood cells, TNF-α content and cholesterol level in the 4-HIL150mg / kg group were significantly reduced. The results showed that 4-HIL can reduce inflammation and cholesterol levels in the blood of ApoE- / - mice.

[0045] 3. To detect the effect of 4-HIL on plaque formation, mice were killed after 6 weeks of administration. One mouse was randomly selected from each group and the entire artery tissue was removed and fixed for more than 24 hours, then stained with Oil Red O and photographed with a camera. The results are shown in the figure. Figure 4 .

[0046] Depend on Figure 4 It can be seen that compared with the control group, the model group showed obvious lipid accumulation, and compared with the model group, the lipid content of the 4-HIL150mg / kg group was significantly reduced. The results showed that 4-HIL can reduce the lipid content in the aorta of ApoE- / - mice and has the effect of inhibiting the formation of arterial plaques.

[0047] 4. Masson staining experiment of aortic valve. The experimental method is as follows: After 6 weeks of drug administration, one mouse was randomly selected from each group to obtain aortic valve tissue for fixation, paraffin embedding, sectioning, Masson staining, and electron microscopy scanning. The results are as follows Figure 5 .

[0048] Depend on Figure 5 It can be seen that compared with the control group, the model group showed obvious fibrosis, and compared with the Model group, the fibrosis degree of the 4-HIL150mg / kg group was reduced. The results showed that 4-HIL can reduce the degree of aortic valve fibrosis in ApoE- / - mice and promote plaque stability.

[0049] 2. Exploring the mechanism of 4-HIL inhibiting plaque formation

[0050] Effect of 1.4-HIL on the formation of macrophage-derived foam cells

[0051] Oil red O staining was used to investigate the effect of 4-HIL on lipid content in oxLDL-induced macrophages. The experimental scheme was as follows:

[0052] (1) Plating: RAW 264.7 cells were plated at 2×10 5 / well density was plated in a 6-well plate and allowed to adhere overnight;

[0053] (2) Drug addition: Cultured in DMEM medium containing 0 mM, 2 mM, 4 mM 4-HIL or 40 μg / mL oxLDL for 24 h;

[0054] (3) Fixation: discard the supernatant, wash once with PBS (pH 7.2), add 4% paraformaldehyde for fixation for half an hour, discard the supernatant, and wash once with PBS (pH 7.2);

[0055] (4) Staining: Add the prepared Oil Red O staining solution into the cell wells and stain at room temperature in the dark for 10 min.

[0056] (5) Observation: After staining, discard the excess stain, use 60% isopropanol to differentiate for a few seconds and then discard it, add PBS (pH 7.2) and observe and take pictures under an inverted microscope. Figure 6 .

[0057] The effects of different concentrations of 4-HIL (0 mM, 2 mM, 4 mM) on the lipid content in RAW 264.7 cells treated with or without oxLDL were observed under an inverted fluorescence microscope at 24 h. Figure 6 It can be seen that when oxLDL was not treated, there was no significant change in the cellular lipid content in the 4-HIL 2mM group and the 4-HIL 4mM group compared with the control group. However, when oxLDL was treated, the intracellular lipid content in the oxLDL+4-HIL 4mM group was significantly reduced compared with the oxLDL group. The results show that 4mM 4-HIL can significantly reduce the lipid level in RAW 264.7 cells induced by oxLDL.

[0058] 2. In vitro experiments were used to study the effect of 4-HIL on the PPAR-γ / CD36 signaling pathway in oxLDL-induced macrophages.

[0059] The effect of 4-HIL on the mRNA levels of PPAR-γ and CD36 in RAW 264.7 cells treated with or without oxLDL was detected by real-time fluorescence quantitative PCR. The experimental scheme is as follows: cells were plated in 6-well plates, oxLDL was induced or not induced, 4mM 4-HIL was added or not, cells were collected after 24h treatment, protein and RNA were extracted, and the expression of PPAR-γ, CD36, and NF-κBp50 at the gene (A, B) or protein (C, D) levels was detected. The results are shown in Figure 7 .

[0060] Depend on Figure 7 A and Figure 7 As shown in Figure B, 4mM 4-HIL significantly reduced the expression of PPAR-γ and CD36 in cells treated with oxLDL. The effect of 4-HIL on the protein levels of PPAR-γ and CD36 in RAW 264.7 cells induced by oxLDL was further detected by Western Blot experiments. Figure 7 C and Figure 7 As shown in D, 4-HIL also significantly reduced the expression levels of PPAR-γ, CD36, and NF-κB p50 proteins in RAW 264.7 cells induced by oxLDL. The results showed that oxLDL significantly induced the high expression of PPAR-γ, CD36, and NF-κB p50 in RAW 264.7 cells, while 4-HIL could significantly reverse this effect. Therefore, 4-HIL inhibited the phagocytosis of oxLDL by macrophages by inhibiting the PPAR-γ / CD36 signaling pathway, thereby reducing the intracellular lipid content.

[0061] 3. Real-time fluorescence quantitative PCR experiment was used to detect the expression of cholesterol efflux receptor ABCG1 on macrophages. The experimental scheme is as follows:

[0062] Real-time fluorescence quantitative PCR experiment

[0063] RNA extraction

[0064] (1) 2×10 5 RAW 264.7 cells / well were seeded in a six-well plate and cultured overnight in an incubator;

[0065] (2) After the cells adhered, DMEM medium containing 4 mM 4-HIL or 40 μg / mL oxLDL was added to each well and incubated for 24 h.

[0066] (3) After reaching the time point, centrifuge and discard the supernatant, wash once with 1 mL of pre-cooled PBS (pH 7.2), and then discard the excess PBS;

[0067] (4) After adding 1 mL of RNA lysis solution to each cell well, use a pipette to gently blow the cells to fully lyse them. Then transfer the cell lysate to a 1.5EP tube and extract RNA strictly according to the steps in the RNA extraction kit manual.

[0068] Total RNA was reverse transcribed into cDNA

[0069] (1) Use a sterile nuclease-free PCR tube for first-strand transcription and add the following components in order:

[0070] 4×gDNA wiper mix:4μL

[0071] RNA: 1 μg

[0072] DEPC H2O: total to 16μL

[0073] (2) After the samples are thoroughly mixed, they are placed in the PCR instrument one by one, and the program is set to 42°C for 2 min. The PCR instrument should be run immediately after setting.

[0074] (3) After the program is completed, remove the sample tube, add 4 μL of 5×Hicript RT super mix, mix well, and put it back into the PCR instrument, and then proceed to the next program;

[0075] (4) The PCR instrument is operated at 37°C for 15 min and 85°C for 5 s. When the reaction is completed, the desired cDNA is obtained. The cDNA is stored at -80°C.

[0076] Fluorescence quantitative PCR

[0077] All primers in the experiment were synthesized by BGI, and the primer sequences are shown in Table 1.

[0078] Table 1 Fluorescence quantitative PCR primers

[0079] Primer name Primer sequence (5'-3') Primer fragment length (bp) M-β-actin-F TGCTGTCCCTGTATGCCTCT 20 M-β-actin-R AGGTCTTTACGGATGTCAACG 21 M-Abcg1-F GTTGCGACATTTGTGGGTCC 20 M-Abcg1-R CCCCCTCAAAGCCGTATCTG 20

[0080] Add the components in Table 2 in sequence, and the system is 12 μL.

[0081] Table 2 Fluorescence quantitative PCR reaction system

[0082]

[0083]

[0084] Place the reaction plate into the real-time fluorescence quantitative PCR instrument and set the reaction program as shown in Table 3.

[0085] Table 3 Fluorescence quantitative PCR reaction procedure

[0086]

[0087] The results are as follows Figure 8 .

[0088] like Figure 8 As shown in A, when oxLDL was not treated, there was no significant difference in the expression of ABCG1 in the 4-HIL 2mM group and the 4-HIL 4mM group compared with the control group. Figure 8 As shown in B, when treated with oxLDL, the expression of ABCG1 in the oxLDL group increased significantly compared with the control group, and the expression of ABCG1 in the oxLDL+4-HIL 2mM group and oxLDL+4-HIL 4mM group decreased significantly compared with the oxLDL group. The results showed that 4-HIL could significantly inhibit the expression of ABCG1 in RAW264.7 cells induced by oxLDL, reduce the excretion of cholesterol to the extracellular space, and thus reduce the formation of cholesterol crystals in plaques.

[0089] Effects of 4-HIL on inflammatory factors in macrophage-derived foam cells

[0090] Real-time fluorescence quantitative PCR experiments were used to detect the effect of 4-HIL on the mRNA levels of inflammatory factors such as NLRP3 and IL-18 in RAW 264.7 cells with or without oxLDL treatment. The experimental scheme was as follows: RNA extraction and total RNA reverse transcription into cDNA were the same as above, and the primer sequences were shown in Table 4 below.

[0091] Table 4 Fluorescence quantitative PCR primers

[0092] Primer name Primer sequence (5'-3') Primer fragment length (bp) M-β-actin-F TGCTGTCCCTGTATGCCTCT 20 M-β-actin-R AGGTCTTTACGGATGTCAACG 21 M-Nlrp3-F TCACCATGTGCTTCATCCCC 20 M-Nlrp3-R GGTGGTCTTGGATGTCTGGG 20 M-Il18-F GACCAAGGAAATCGGCCTCT 20 M-Il18-R AATATGGTCCGGGGTGCATT 20

[0093] The other experimental steps are the same as above. Fig. 9 .

[0094] Depend on Fig. 9 A and Fig. 9 As shown in B, when oxLDL was not treated, the expression of NLRP3 in the cells of the 4-HIL 2mM group was significantly reduced compared with the Control group, and there was no significant difference in the expression of IL-18. Fig. 9 C and Fig. 9 It can be seen from the D in that when treated with oxLDL, the expression of inflammatory factors in the cells in the oxLDL group increased significantly compared with the control group, and the expression of inflammatory factors in the cells in the oxLDL+4-HIL 2mM group and the oxLDL+4-HIL 4mM group decreased significantly compared with the oxLDL group. The results showed that 4mM 4-HIL could significantly inhibit the production of inflammatory factors in RAW 264.7 cells induced by oxLDL in vitro.

[0095] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

Application of 1.4-hydroxyisoleucine in the preparation of drugs for treating atherosclerosis.

2. The use according to claim 1, characterized in that: The 4-hydroxyisoleucine is used for preventing, alleviating and / or treating atherosclerosis.

3. The application according to claim 1, characterized in that: The 4-hydroxyisoleucine treats atherosclerosis by lowering blood lipids, inhibiting the PPAR-γ / CD36 signaling pathway, reducing the lipid content in macrophages, and inhibiting the ABCG1 expression and inflammatory factor production induced by oxLDL.

4. The use according to claim 3, characterized in that: The 4-hydroxyisoleucine can dose-dependently inhibit the expression of ABCG1 induced by oxLDL in macrophages.

5. Use of 4-hydroxyisoleucine as claimed in claim 1 in the preparation of a medicament for preventing, alleviating and / or treating oxLDL-induced atherosclerosis.

6. A pharmaceutical composition for preventing, alleviating and / or treating atherosclerosis, comprising the 4-hydroxyisoleucine as claimed in claim 1.

7. A pharmaceutical composition according to claim 6, characterized in that The invention comprises the 4-hydroxyisoleucine as claimed in claim 1 as an active ingredient and a pharmaceutically acceptable carrier.

8. A pharmaceutical preparation comprising a therapeutically effective amount of the 4-hydroxyisoleucine according to claim 1, and a pharmaceutically acceptable excipient.

Images