Application of piRNA-AB352916 and analogue thereof in preparation of medicine for treating ischemic heart disease

Abstract

The invention relates to application of piRNA-AB352916 and a mimetic thereof in preparation of a medicine for treating ischemic heart disease, and belongs to the technical field of medicines. In order to solve the problem that a medicine capable of promoting myocardial cell proliferation and inhibiting myocardial cell apoptosis is lacked in the treatment process of the ischemic heart disease, the invention provides application of piRNA-AB352916 and a mimetic thereof in preparation of a medicine for treating the ischemic heart disease. According to the application disclosed by the invention, the expression level of the piRNA-AB352916 in myocardial regeneration model tissues after cardiac apex resection is obviously increased, and animal experiments prove that the myocardial specific overexpression piRNA-AB352916 not only can promote myocardial cell proliferation, but also can inhibit myocardial cell apoptosis, so that the myocardial infarction area is reduced, and the cardiac function of an infarction mouse is improved. The invention proves that the piRNA-AB352916 and the analogue thereof have prevention and treatment values on the ischemic heart disease.

Description

Technical Field

[0001] The present invention belongs to the field of medical technology, and in particular relates to the use of piRNA-AB352916 and its analogs in the preparation of drugs for treating ischemic heart disease. Background Art

[0002] With the rapid development of social economy and the accelerated pace of people's lives, the incidence and mortality of cardiovascular diseases have also increased year by year, and have begun to show a trend of younger people, seriously endangering human health and reducing the quality of life of patients. Ischemic heart disease is a heart disease caused by myocardial ischemia and ultimately myocardial damage, including myocardial infarction, coronary heart disease, arrhythmia, heart failure, etc. When acute myocardial infarction occurs, local ischemia and hypoxia lead to necrosis and apoptosis of a large number of functional myocardial cells. Because adult myocardial cells have exited the cell cycle, the missing myocardial cells are replaced by fibrous scar tissue, which then causes ventricular remodeling, decreased heart function and eventually develops into heart failure. Although conventional treatments such as drugs, percutaneous coronary intervention, and balloon dilatation can improve heart function to a certain extent, they cannot replenish the myocardial cells lost during the onset of the disease. Therefore, exploring regulatory factors that effectively promote myocardial repair after injury is a key scientific issue that needs to be solved at present.

[0003] piRNAs (PIWI-interacting RNAs) are a new type of endogenous non-coding RNA originally discovered in germ cells. Unlike other small non-coding RNAs such as miRNAs and siRNAs, piRNAs are 23-31nt in length and have 2′-O-methylation modification at the 3′ end. They can bind to the PIWI subgroup of the Ago (argonaute) family and maintain the genome integrity between generations of organisms by recognizing and silencing transposable elements. Studies have shown that piRNAs are expressed in a variety of tissue cells and play an important role in life activities such as epigenetic regulation, germ stem cell differentiation, and embryonic development. Recent studies have found that piRNAs also have very important functions in the cardiovascular system. For example, the myocardial hypertrophy-related piRNA-CHARPIR can directly bind to METTL3 and block the m6A methylation modification of poly(ADP) polymerase Parp10 mRNA, thereby promoting pathological hypertrophy and cardiac remodeling; piRNA-AVCAPIR directly interacts with FTO, blocking its N6-methyladenosine demethylase activity, thereby promoting the progression of calcific aortic valvular disease. It can be seen that piRNAs, a new type of non-coding RNA, plays an important role in maintaining the normal physiological function of the heart. The abnormal expression of piRNAs in the heart is closely related to the occurrence and development of many heart diseases. However, to date, there are few reports on the use of piRNAs to treat ischemic cardiomyopathy, and most of them are limited to the regulation of cardiomyocyte apoptosis. Previous studies have confirmed that mammalian cardiomyocytes still have a certain regenerative potential during the embryonic period and a short period after birth. That is, when the embryonic heart is stimulated by injury, it will regenerate by dividing and proliferating to replace necrotic or apoptotic cells. This process is the self-repair process of cardiomyocytes after injury, which brings new hope for repair treatment after myocardial injury. However, this repair ability is gradually lost with development and maturity. Therefore, finding piRNAs that can both promote cardiomyocyte proliferation and inhibit its apoptosis can provide new basis and new strategies for the clinical treatment of ischemic heart disease. Summary of the invention

[0004] In order to solve the problem of lack of drugs that can both promote cardiomyocyte proliferation and inhibit apoptosis in the treatment of ischemic heart disease, the present invention provides the use of piRNA-AB352916 and its analogs in the preparation of drugs for treating ischemic heart disease.

[0005] The technical solution of the present invention:

[0006] Application of piRNA-AB352916 and its specific overexpression mimics in the preparation of drugs for treating ischemic heart disease.

[0007] Furthermore, the nucleotide sequence of piRNA-AB352916 is shown in SEQ ID NO:1.

[0008] Furthermore, the specific overexpression mimetic of piRNA-AB352916 includes a sense strand having a nucleotide sequence as shown in SEQ ID NO:2 and an antisense strand having a nucleotide sequence as shown in SEQ ID NO:3.

[0009] Furthermore, the drug contains piRNA-AB352916 as the only active ingredient or one of the active ingredients; or the drug contains a specific overexpression mimetic of piRNA-AB352916 as the only active ingredient or one of the active ingredients.

[0010] Furthermore, the drug also includes pharmaceutically acceptable excipients and / or carriers.

[0011] Furthermore, the drug is a parenteral dosage form, specifically an injectable dosage form.

[0012] Furthermore, the drug can promote cardiomyocyte proliferation, inhibit cardiomyocyte apoptosis, reduce myocardial infarction area and improve cardiac function.

[0013] Furthermore, the ischemic heart disease includes myocardial infarction, coronary heart disease, arrhythmia, heart failure and myocardial injury caused by ischemia-reperfusion.

[0014] Beneficial effects of the present invention:

[0015] The present invention found that the expression level of piRNA-AB352916 in the myocardial regeneration model tissue after apical resection was significantly upregulated, and verified through animal experiments that myocardial-specific overexpression of piRNA-AB352916 can both promote myocardial cell proliferation and inhibit myocardial cell apoptosis, thereby reducing myocardial infarction area and improving cardiac function in infarcted mice. The present invention confirms that piRNA-AB352916 and its specific overexpression mimics have potential preventive and therapeutic value for ischemic heart disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is a heat map of differentially expressed piRNAs in myocardial tissues of sham-operated group and apical resection model mice in Example 1;

[0017] Figure 2 The volcano plot of differentially expressed piRNAs in myocardial tissues of sham-operated group and apical resection model mice in Example 1;

[0018] Figure 3 This is a comparison chart of the expression abundance of differentially expressed piRNAs in the myocardial tissue of the sham operation group and the apical resection model mice in Example 1;

[0019] Figure 4This is a comparison chart of the expression levels of piRNA-AB352916 in the myocardial tissue of the sham operation group and the apical resection model mice detected by qRT-PCR technology in Example 1;

[0020] Figure 5 This is a comparison chart of the expression levels of piRNA-AB352916 in myocardial tissue of mice 1 day and 7 days after birth detected by qRT-PCR technology in Example 1;

[0021] Figure 6 This is a comparison chart of the expression levels of piRNA-AB352916 in the myocardial tissue of the negative control group and the agomir-overexpressing group of mice detected by qRT-PCR technology in Example 2;

[0022] Figure 7 This is a comparison chart of the cardiac ultrasound examination results of each group of mice in Example 2;

[0023] Figure 8 This is a comparison chart of cardiac ejection fraction and left ventricular fractional shortening of each group of mice in Example 2;

[0024] Fig. 9 The microscopic photographs of the myocardial infarction sites of mice in each group after Masson staining in Example 2;

[0025] Fig.10 This is a comparison of the myocardial infarction area of ​​each group of mice in Example 2;

[0026] Fig.11 The following are photos of myocardial tissue staining of mice in each group after immunofluorescence staining in Example 2;

[0027] Fig.12 This is a comparison chart of the percentage of pH3 and Ki67 positive cardiomyocytes in each group of mice in Example 2;

[0028] Fig.13 This is a comparison chart of the cardiac ultrasound examination results of each group of mice in Example 3;

[0029] Fig.14 This is a comparison chart of cardiac ejection fraction and left ventricular fractional shortening of each group of mice in Example 3;

[0030] Fig.15 The figure is a comparison chart of the expression levels of lactate dehydrogenase LDH and creatine kinase isoenzyme CK-MB in the serum of each group of mice in Example 3;

[0031] Fig.16 These are TUNEL staining photos of cardiac tissue sections of each group of mice in Example 3;

[0032] Fig.17This is a comparison chart of the percentage of TUNEL-positive cells in the heart tissues of mice in each group in Example 3;

[0033] Fig.18 The WB images and expression level comparison graphs of apoptosis-related protein Caspase 3 in myocardial tissue of each group of mice in Example 3;

[0034] Fig.19 The WB images and expression level comparison graphs of apoptosis-related protein Bcl2 in myocardial tissue of each group of mice in Example 3;

[0035] Fig. 20 The WB images and expression level comparison diagram of apoptosis-related protein Bax in myocardial tissue of each group of mice in Example 3;

[0036] Fig.21 The immunofluorescence staining photos of primary cultured neonatal rat cardiomyocytes of each group of mice in Example 4 are, from left to right, the proliferation marker EdU, cell proliferation-related proteins pH3 and Ki67;

[0037] Fig. 22 This is a comparison chart of the percentage of EdU, pH3 and Ki67 positive cells in primary cultured neonatal rat cardiomyocytes in each group of mice in Example 4;

[0038] Fig.23 These are the TUNEL staining photos of primary cultured neonatal rat cardiomyocytes in each group of mice in Example 4;

[0039] Fig.24 This is a comparison chart of the percentage of TUNEL-positive cells in primary cultured neonatal rat cardiomyocytes of each group of mice in Example 4. DETAILED DESCRIPTION

[0040] The technical solution of the present invention is further described below in conjunction with the embodiments, but it is not limited thereto. Any modification or equivalent replacement of the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention shall be included in the protection scope of the present invention. The process equipment or devices not specifically noted in the following embodiments are all conventional equipment or devices in the art. If not specifically specified, the raw materials used in the embodiments of the present invention can be obtained commercially; if not specifically specified, the technical means used in the embodiments of the present invention are all conventional means well known to those skilled in the art.

[0041] Example 1

[0042] This example provides a method and results for screening piRNAs related to myocardial injury and repair.

[0043] (1) In order to explore the key piRNAs related to myocardial injury and repair, the present invention constructed a myocardial regeneration model after apical resection of 1-day-old mice. The specific method is as follows:

[0044] Establishment of the neonatal mouse apical resection model:

[0045] After 3 minutes of anesthesia on ice, mice born on day 1 were incised in the fourth intercostal space at the heart of the suckling mice. The muscles were bluntly separated and the heart was quickly squeezed out. The apex of the heart was quickly removed with ophthalmic scissors and then placed in the heart cavity. The chest wall incision was sutured with 7-0 sutures. The sham operation group underwent the same operation without removing the apex of the heart.

[0046] (2) Total RNA was extracted from tissue samples using the TRIzol method, and the piRNA sequencing technology was used to detect the overall expression profile of piRNAs in heart samples 7 days after mouse apical resection. The specific method is as follows:

[0047] RNA extraction and piRNA sequencing:

[0048] Seven days after surgery, myocardial tissues were harvested from the sham-operated group and the apical resection model mice. RNA was extracted using the TRIzoL method, and a small RNA library was prepared using the NEBNext Small RNA Diversified Library Preparation Kit.

[0049] High-throughput sequencing was performed on the Illumina HiSeq platform to generate raw sequencing reads. Clean reads were then mapped to the reference genome using the Bowti or BWA algorithm to identify piRNA sequences.

[0050] The expression levels of piRNAs were normalized to RPM to account for differences in sequencing depth between samples.

[0051] Differential expression analysis was performed using DESeq2 or edgeR software packages, and piRNAs with a fold change ≥ 1.5 and an FDR-corrected p value < 0.05 were considered to be significantly differentially expressed.

[0052] Figure 1-Figure 3 The heat map, volcano map and expression abundance comparison map of differentially expressed piRNAs in myocardial tissue of sham operation group and apical resection model mice are shown respectively; as shown in the figure, compared with the sham operation group, the highly conserved piRNA-AB352916 was significantly upregulated in the myocardial regeneration model group after apical resection, and its expression abundance was higher in myocardial tissue.

[0053] (3) Real-time quantitative qRT-PCR was used to detect the expression level of piRNA-AB253916. The specific method is as follows:

[0054] Myocardial tissues of sham-operated mice, apical resection mice, and 1-day and 7-day-old mice were cut and RNA was extracted by TRIzoL method. Real-time quantitative RT-PCR was performed using ABI 7500Fast real-time quantitative PCR instrument and SYBR Green I dye method.

[0055] The primer sequences used to detect piRNA-AB253916 expression are as follows:

[0056] Forward primer as shown in SEQ ID NO: 4: 5'-AACAAGGCATTGGTGGTTCAG-3';

[0057] Reverse primer as shown in SEQ ID NO:5: 5'-GTCGTATCCAGTGCAGGGT-3';

[0058] RT primer as shown in SEQ ID NO:6:

[0059] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCGAG.

[0060] The expression of piRNA-AB253916 was calculated by relative quantification method.

[0061] Figure 4 The figure is a comparison of the expression levels of piRNA-AB352916 in the myocardial tissue of mice in the sham operation group and the apical resection model. As shown in the figure, the expression level of piRNA-AB253916 in the apical resection model group was significantly higher than that in the sham operation group (P < 0.001).

[0062] Figure 5 The figure is a comparison of the expression levels of piRNA-AB352916 in the myocardial tissue of mice 1 day and 7 days after birth; as shown in the figure, the expression level of piRNA-AB253916 in the heart tissue of mice 7 days after birth gradually decreased compared with that of mice 1 day after birth (P < 0.01). Previous reports have confirmed that the heart of mice 1 day after birth has regenerative potential, while the heart of mice 7 days after birth loses its regenerative ability. The sequencing results of this example indicate that the change in the expression level of piRNA-AB 352916 may be related to the time window of myocardial regeneration.

[0063] In summary, the present example uses qRT-PCR technology to verify that the expression level of the highly conserved piRNA-AB352916 in the apical resection model group is significantly increased. The nucleotide sequence of piRNA-AB352916 is shown in SEQ ID NO: 1, specifically GCATTGGTGGTTCAGTGGTAGAATTCTCGCC.

[0064] Example 2

[0065] This example verifies the therapeutic effects of piRNA-AB352916 and agomir-AB352916, an overexpression mimetic of piRNA-AB352916, in ischemic heart disease.

[0066] In order to clarify the regulatory effect of piRNA-AB352916 on cardiac regeneration and cardiomyocyte proliferation and survival, the present example established a myocardial infarction model by ligating the left anterior descending branch of the coronary artery of adult C57BL / 6 mice.

[0067] (1) Preparation of myocardial infarction model

[0068] The specific method for preparing the myocardial infarction model is as follows:

[0069] 6-8 week old C57BL / 6 male mice, weighing 25-30g, were anesthetized with 1% sodium pentobarbital 40mg / kg and fixed in supine position. The PE-90 cannula was used for tracheal intubation and connected to the mouse ventilator. The mouse tidal volume was adjusted to maintain 250-300mL / min, and the respiratory rate was controlled at 110-130 times / min. The intercostal muscles were bluntly separated in the 4th or 5th intercostal space, and a homemade retractor was used to penetrate the myocardial surface with a 7-0 non-damaging suture needle at the left anterior descending branch of the coronary artery, about 2mm away from the lower edge of the left atrial appendage, and ligated. The original color of the corresponding area on the surface of the heart of the model mouse turned pale, indicating that ischemia was successful, and the ribs, muscles and skin were sutured. The sham operation group was threaded without ligation.

[0070] (2) Construction of overexpression mimics and in situ injection

[0071] In this example, a piRNA-AB352916 specific overexpression mimetic agomir-AB352916 was constructed, and agomir-AB352916 was then injected into the myocardial infarction marginal zone tissue of mice by in situ injection. The specific method is as follows:

[0072] The piRNA-AB352916 specific overexpression mimetic agomir-AB352916 was constructed by Suzhou Gene Gene Co., Ltd., and includes a sense strand as shown in SEQ ID NO: 2 and an antisense strand as shown in SEQ ID NO: 3. To comply with the WIPOST.26 standard, T is used instead of U in the nucleotide sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3 to represent uracil in RNA.

[0073] The specific nucleotide sequence of the sense strand of agomir-AB352916 is:

[0074] Sense strand: 5'-GCAUUGGUGGUUCAGUGGUAGAAUUCUCGCC-3',

[0075] The nucleotide sequence of the antisense strand of agomir-AB352916 is specifically:

[0076] Antisense strand: 5′-CGAGAAUUCUACCACUGAACCACCAAUGCUU-3′.

[0077] 30 μL of piRNA-AB352916 overexpression mimetic agomir-AB352916 was drawn into the syringe and injected at multiple points in the myocardial tissue of the ischemic marginal zone, generally 3-4 injections (6OD / mouse). The control group was injected with the same amount of negative control reagent. Myocardial tissues of mice in each group were taken and RNA was extracted using the TRIzoL method. ABI 7500Fast real-time quantitative PCR instrument and SYBRGreen I dye method were used for real-time quantitative RT-PCR determination. The relative quantitative method was used to calculate the expression level of piRNA-HReG in mouse myocardial tissue.

[0078] Figure 6 The results of real-time quantitative RT-PCR detection of RNA in myocardial tissue of mice in each group showed that compared with the negative control group, the expression level of piRNA-AB352916 in myocardial tissue of mice injected with overexpression of agomir mimics was significantly increased (P < 0.001), indicating that overexpression of agomir mimics successfully induced overexpression of piRNA-AB352916 in myocardial tissue.

[0079] (3) Echocardiography to monitor heart function

[0080] Four weeks after injection of agomir-AB352916, echocardiography was used to detect the cardiac function of mice in the sham operation group and the myocardial infarction model group. The specific method is as follows:

[0081] Four weeks after surgery, the mice were anesthetized, their limbs were fixed, and their chests were shaved and coated with an appropriate amount of coupling agent. The mice were placed in the left lateral decubitus position, and a 12Mhz probe was used for cardiac ultrasound examination (GE, USA). The parasternal left ventricular long axis section was taken, and the left ventricular end-diastolic diameter (LVEDD), left ventricular end-systolic diameter (LVESD), and E peak / A peak ratio (E / A) were measured by M-mode ultrasound, and the left ventricular short axis shortening rate (FS), ejection fraction (EF) and other indicators were calculated. The measured value was the average value measured over 5 consecutive cardiac cycles.

[0082] Figure 7 The figure is a comparison of the cardiac ultrasound examination results of mice in each group; Figure 8The figure is a comparison chart of cardiac ejection fraction and left ventricular short-axis shortening fraction of each group of mice; as shown in the figure, compared with the myocardial infarction + negative control group, the left ventricular short-axis shortening rate and ejection fraction of mice in the myocardial overexpression piRNA-AB352916 group were significantly increased (P < 0.05), indicating that myocardial overexpression of piRNA-AB352916 can significantly improve the cardiac function of mice with myocardial infarction.

[0083] (4) Masson staining to detect infarct area

[0084] Masson staining technique was used to evaluate the changes in myocardial infarction area during the process of cardiac injury and repair. The specific method is as follows:

[0085] Heart tissues were obtained, embedded in paraffin, and dehydrated. Tissue sections were sliced ​​and stained with Masson staining (Beijing Solebow Technology Co., Ltd.), and the degree of myocardial infarction in each group of mice was observed under a microscope.

[0086] Fig. 9 These are the microscopic photos of the myocardial infarction sites of mice in each group after Masson staining; Fig.10 The figure is a comparison chart of myocardial infarction area in each group of mice; as shown in the figure, compared with the myocardial infarction + negative control group, myocardial overexpression of piRNA-AB352916 can significantly reduce the myocardial infarction area (P < 0.001).

[0087] (5) Detection of cardiomyocyte proliferation in vivo by immunofluorescence technique

[0088] Immunofluorescence technique was used to observe the expression of pH3 and Ki67 in myocardial cells in the infarct edge zone. The specific method is as follows:

[0089] The heart tissue of each group of mice was obtained, embedded with embedding agent and immediately frozen in liquid nitrogen, then frozen sections were made using a freezing microtome, fixed with 500 μL 4% paraformaldehyde (Beijing Solebow Technology Co., Ltd.) for 30 min, added with 500 μL TritonX-100 (Beijing Solebow Technology Co., Ltd.), 1% BSA (Boster Biotechnology Co., Ltd.) and incubated at room temperature for 1 h, blocked with 500 μL goat serum (Boster Biotechnology Co., Ltd.) for 1 h, added with 500 μL primary antibodies of Ki67 (Abcam (Shanghai) Trading Co., Ltd.), pH3 (Merck Pharmaceutical Biotechnology Co., Ltd.) and α-Actinin (Abcam (Shanghai) Trading Co., Ltd.) and incubated at 4°C overnight, then incubated with fluorescent secondary antibody (Abcam (Shanghai) Trading Co., Ltd.) at room temperature for 1 h, incubated with DAPI (Boster Biotechnology Co., Ltd.) at room temperature for 10 min, and observed the expression of proliferation markers Ki67 and pH3 in myocardial tissue sections using a confocal laser scanning microscope (Carl Zeiss).

[0090] Fig.11These are photos of myocardial tissue staining of mice in each group after immunofluorescence staining. Green fluorescence indicates α-Actinin, which indicates myocardial cells, and red fluorescence indicates pH3 and Ki67 positive signals. Arrows point to pH3 and Ki67 positive myocardial cells, i.e., proliferating myocardial cells. Fig.12 The figure is a comparison chart of the percentage of pH3 and Ki67 positive cardiomyocytes in each group of mice; as shown in the figure, compared with the myocardial infarction + negative control group, the number of Ki67 and pH3 positive cardiomyocytes in the myocardial overexpression piRNA-AB352916 group was significantly increased (P < 0.05, P < 0.001), indicating that myocardial overexpression of piRNA-AB352916 can significantly improve the proliferation and regeneration ability of cardiomyocytes in adult mice.

[0091] Example 3

[0092] This example verifies the therapeutic effects of piRNA-AB352916 and agomir-AB352916, an overexpression mimetic of piRNA-AB352916, in ischemic heart disease.

[0093] In order to clarify the regulatory effect of piRNA-AB352916 on cardiac regeneration and cardiomyocyte proliferation and survival, in this example, an ischemia-reperfusion injury model was established by ligating the left anterior descending branch of the coronary artery of adult C57BL / 6 mice.

[0094] (1) Preparation of ischemia-reperfusion injury model

[0095] The specific preparation method of the ischemia-reperfusion injury model is as follows:

[0096] 6-8 week old C57BL / 6 male mice weighing 25-30 g were anesthetized with 1% sodium pentobarbital 40 mg / kg and fixed in supine position. The trachea was intubated with a PE-90 cannula and connected to a mouse ventilator. The tidal volume of the mice was adjusted to maintain 250-300 mL / min and the respiratory rate was controlled at 110-130 times / min. The intercostal muscles were bluntly separated at the 4th or 5th intercostal space, and a homemade retractor was used to penetrate the myocardial surface layer at the left anterior descending coronary artery with a 7-0 non-damaging suture needle about 2 mm from the lower edge of the left atrial appendage and ligated. After 45 minutes of ischemia, the ligature was opened and reperfused for 24 hours. Sham-operated mice underwent the same operation without ligating the left anterior descending coronary artery. The syringe was filled with 30 μL of agomir-AB352916 (Suzhou Genetech Co., Ltd.), the same as in Example 2, and injected at multiple points in the myocardial tissue at the ischemic edge zone, generally 3-4 injections (6 OD / mouse). The control group was injected with the same amount of negative control reagent.

[0097] (2) Echocardiography to monitor heart function

[0098] Four weeks after injection of agomir-AB352916, the cardiac function of the mice in the sham operation group and the ischemia-reperfusion injury model group was detected by echocardiography. The specific detection method was the same as that in Example 2.

[0099] Fig.13 The figure is a comparison of the cardiac ultrasound examination results of mice in each group; Fig.14 The figure is a comparison chart of cardiac ejection fraction and left ventricular short-axis shortening fraction of each group of mice; as shown in the figure, the left ventricular short-axis shortening rate and ejection fraction of mice in the piRNA-AB352916 overexpression group were significantly increased (P < 0.01, P < 0.001), indicating that myocardial overexpression of piRNA-AB352916 can also significantly improve the damage of cardiac function caused by ischemia-reperfusion.

[0100] (3) Kit for detecting the expression levels of LDH and CKMB in mouse serum

[0101] The kit was used to detect the expression levels of lactate dehydrogenase (LDH) and creatine kinase isoenzyme (CK-MB) in the serum of each group of mice. The specific method is as follows:

[0102] After the mouse was anesthetized, the needle was inserted into the strongest part of the heart beat on the left side of the chest, and blood was seen flowing into the needle tube by slowly withdrawing the syringe. After obtaining blood by the above method, it was left to stand at room temperature for 1 hour in an EP tube, centrifuged at 3000 rpm for 10 minutes, and the supernatant was serum. The levels of lactate dehydrogenase (LDH) and serum creatine kinase isoenzyme (CKMB) in mouse serum were evaluated using the LDH detection kit (Nanjing Jiancheng Bioengineering Institute) and the CKMB detection kit (Nanjing Jiancheng Bioengineering Institute).

[0103] Fig.15 The figure is a comparison of the expression levels of lactate dehydrogenase LDH and creatine kinase isoenzyme CK-MB in the serum of each group of mice; as shown in the figure, compared with the ischemia-reperfusion + negative control group, the levels of LDH and CKMB in the serum of mice in the myocardial overexpression piRNA-AB352916 group were significantly reduced (P < 0.01, P < 0.001), indicating that myocardial overexpression of piRNA-AB352916 can alleviate myocardial injury caused by ischemia-reperfusion.

[0104] (4) Detection of cardiomyocyte apoptosis by TUNEL staining in vivo

[0105] Cardiomyocytes were stained using the TUNEL apoptosis assay kit and apoptosis of cardiomyocytes was assessed using a confocal laser scanning microscope as follows:

[0106] The heart tissue of each group of mice was obtained, embedded with an embedding agent and immediately frozen in liquid nitrogen, then frozen using a freezing microtome, fixed with 500 μL 4% paraformaldehyde (Beijing Solebow Technology Co., Ltd.) for 30 min, added with 500 μL TritonX-100 (Beijing Solebow Technology Co., Ltd.), 1% BSA (Boster Biotechnology Co., Ltd.) and incubated at room temperature for 1 h, blocked with 500 μL goat serum (Boster Biotechnology Co., Ltd.) for 1 h, stained with a TUNEL apoptosis assay kit (Biyuntian Biotechnology Co., Ltd.), and evaluated the apoptosis of myocardial cells using a confocal laser scanning microscope (Carl Zeiss).

[0107] Fig.16 These are TUNEL staining photos of heart tissue sections of mice in each group; green fluorescence is α-Actinin indicating cardiomyocytes, and red fluorescence indicates TUNEL-positive signals, namely apoptotic cardiomyocytes. Fig.17 The figure is a comparison chart of the percentage of TUNEL-positive cells in the heart tissue of each group of mice; as shown in the figure, compared with the ischemia-reperfusion + negative control group, the TUNEL-positive rate in the piRNA-AB352916 overexpression group was significantly reduced (P < 0.05), indicating that myocardial overexpression of piRNA-AB352916 can significantly inhibit myocardial cell apoptosis caused by ischemia-reperfusion injury.

[0108] (5) Effect of overexpression of piRNA-AB352916 on apoptosis-related proteins

[0109] Western blot technology was used to detect the expression changes of apoptosis-related proteins Caspase 3, Bcl2 and Bax in mouse myocardial tissue. The specific method is as follows:

[0110] Protein was extracted from the myocardial tissue of each group of mice using RIPA lysis buffer (Biyuntian Biotechnology Co., Ltd.), and the protein concentration was determined using a BCA protein assay kit (Biyuntian Biotechnology Co., Ltd.). An equal amount of 60 μg of protein was taken from each group, and the protein was separated by 12.5% ​​SDS-polyacrylamide gel electrophoresis, and the separated protein was electroblotted from the gel to a nitrocellulose membrane (Pall (China) Co., Ltd.) by electrophoretic transfer. After blocking in 5% milk for 1.5 h, the membrane was incubated with primary antibodies at 4 ° C overnight, including Bcl2 (Shanghai Abi Biotechnology Co., Ltd.), Bax (Shanghai Abi Biotechnology Co., Ltd.), and Caspase 3 (Jiangsu Qinke Biological Research Center Co., Ltd.). β-actin (Abcam (Shanghai) Trading Co., Ltd.) was used as an internal reference. Next, the membrane was incubated with the corresponding secondary antibody for 1 h at room temperature, and the Odyssey CLx infrared imaging system (LI-COR Biosciences) was used for quantitative analysis.

[0111] Figure 18-Figure 20 The following are WB images and expression level comparison diagrams of apoptosis-related proteins Caspase 3, Bcl2 and Bax in myocardial tissue of each group of mice; as shown in the figure, compared with the ischemia-reperfusion + negative control group, overexpression of piRNA-AB352916 can significantly inhibit the expression levels of Bax and active Caspase 3 (P < 0.01), and significantly upregulate the expression level of anti-apoptotic protein Bcl2 (P < 0.05), further confirming that myocardial overexpression of piRNA-AB352916 can inhibit myocardial cell apoptosis caused by ischemia-reperfusion injury.

[0112] Example 4

[0113] This example investigates whether overexpression of piRNA-AB352916 mimics affects the replication and proliferation ability and apoptosis of cardiomyocytes.

[0114] (1) Establishment of a neonatal rat cardiomyocyte hypoxia model in vitro and detection of cardiomyocyte proliferation

[0115] Immunofluorescence technology was used to detect the expression changes of proliferation marker EdU, cell proliferation-related proteins pH3 and Ki67 in cardiomyocytes. The specific method is as follows:

[0116] Under sterile conditions, the heart of a 1-2 day old mouse was removed, the blood was removed, the aorta and atrium were cut off, and the heart was cut into pieces. 0.25% pancreatic enzyme was added and digested at 37°C for 5 minutes. This process was repeated to remove fibroblasts by differential adhesion. 5 / cm 2 The cells were seeded in culture dishes at different concentrations. Two days later, agomir-AB352916 (1.5 μM) was transfected into neonatal rat cardiomyocytes. 24 h after transfection, the cardiomyocytes were transferred to an oxygen-deficient incubator containing 5% CO2 and 1% O2 and cultured for another 24 h.

[0117] Fig.21 These are the immunofluorescence staining photos of primary cultured neonatal rat cardiomyocytes in each group of mice, from left to right: proliferation marker EdU, cell proliferation-related proteins pH3 and Ki67; green fluorescence is α-Actinin indicating cardiomyocytes, red fluorescence indicates pH3 and Ki67 positive signals, and arrows point to pH3 and Ki67 positive cardiomyocytes, i.e., proliferating cardiomyocytes. Fig. 22The figure is a comparison of the percentages of EdU, pH3 and Ki67 positive cells in primary cultured neonatal rat cardiomyocytes of each group of mice; as shown in the figure, compared with the negative control group, the positive rates of EdU, pH3 and Ki67 in cardiomyocytes of the piRNA-AB352916 overexpression group were significantly increased (P < 0.05, P < 0.001), indicating that overexpression of piRNA-AB352916 in vitro can promote cardiomyocyte proliferation.

[0118] (2) Establishing a hypoxia-reoxygenation model of neonatal rat cardiomyocytes in vitro and detecting cardiomyocyte apoptosis

[0119] Cardiomyocytes were stained using the TUNEL apoptosis assay kit and apoptosis of cardiomyocytes was assessed using a confocal laser scanning microscope as follows:

[0120] After transfection of agomir-AB352916 (1.5 μM) in neonatal rat cardiomyocytes, the cardiomyocytes were transferred to a hypoxic incubator containing 5% CO2 and 1% O2 for culture. After 12 h, the cells were transferred back to a normal cell incubator at 37°C, 5% CO2 and 95% air and cultured for further 24 h. Cardiomyocyte apoptosis was detected by TUNEL staining.

[0121] Fig.23 These are photos of TUNEL staining of primary cultured neonatal rat cardiomyocytes in each group of mice; red fluorescence indicates TUNEL-positive signals, i.e., apoptotic cardiomyocytes. Fig.24 The figure is a comparison chart of the percentage of TUNEL-positive cells in primary cultured neonatal rat cardiomyocytes of each group of mice. As shown in the figure, compared with the negative control group, the number of TUNEL-positive cardiomyocytes in the piRNA-AB352916 overexpression group was significantly reduced (P < 0.001), indicating that overexpression of piRNA-AB352916 in vitro can inhibit cardiomyocyte apoptosis caused by hypoxia-reoxygenation treatment.

Claims

1. Application of piRNA-AB352916 and its specific overexpression analogs in the preparation of drugs for the treatment of ischemic heart disease.

2. The use of piRNA-AB352916 and its specific overexpression mimics according to claim 1 in the preparation of a drug for treating ischemic heart disease, characterized in that: The nucleotide sequence of piRNA-AB352916 is shown in SEQ ID NO:

1.

3. The use of piRNA-AB352916 and its specific overexpression mimics in the preparation of a drug for treating ischemic heart disease according to claim 1, characterized in that: The specific overexpression mimetic of piRNA-AB352916 includes a sense strand having a nucleotide sequence as shown in SEQ ID NO:2 and an antisense strand having a nucleotide sequence as shown in SEQ ID NO:

3.

4. Use of piRNA-AB352916 and its specific overexpression mimics according to any one of claims 1 to 3 in the preparation of a drug for treating ischemic heart disease, characterized in that: The drug has piRNA-AB352916 as the only active ingredient or one of the active ingredients; or the drug has a specific overexpression mimetic of piRNA-AB352916 as the only active ingredient or one of the active ingredients.

5. The use of piRNA-AB352916 and its specific overexpression mimics in the preparation of a drug for treating ischemic heart disease according to claim 4, characterized in that: The drug also includes pharmaceutically acceptable excipients and / or carriers.

6. The use of piRNA-AB352916 and its specific overexpression mimics in the preparation of a drug for treating ischemic heart disease according to claim 5, characterized in that: The drug is a parenteral dosage form, specifically an injection dosage form.

7. Use of piRNA-AB352916 and its specific overexpression mimics in the preparation of a drug for treating ischemic heart disease according to claim 6, characterized in that: The drug can promote myocardial cell proliferation, inhibit myocardial cell apoptosis, reduce myocardial infarction area and improve cardiac function.

8. The use of piRNA-AB352916 and its specific overexpression mimics in the preparation of a drug for treating ischemic heart disease according to claim 7, characterized in that: The ischemic heart disease includes myocardial infarction, coronary heart disease, arrhythmia, heart failure and myocardial injury caused by ischemia-reperfusion.

Images