Application of CREBZF inhibitor in preparation of drugs for macrophage-related diseases

Abstract

The invention relates to application of a CREBZF inhibitor in preparation of a medicine for treating macrophage related diseases. According to the application disclosed by the invention, the insulin resistance of a subject can be obviously slowed down and the glucose tolerance can be increased by specifically knocking out the CREBZF from the macrophages; moreover, the traditional Chinese medicine composition has an important inhibiting effect on the proinflammatory state of macrophages, effectively prevents the macrophages in adipose tissues from secreting excessive proinflammatory factors, and relieves chronic inflammation. Therefore, the invention provides application of the CREBZF inhibitor in preparation of drugs for treating or preventing macrophage-related diseases. The CREBZF inhibitor is specifically targeted to the macrophages; the macrophage related diseases comprise adipose tissue inflammation, adipose tissue macrophage infiltration diseases and glycolipid metabolism diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biology, and more specifically, the present invention relates to the application of CREBZF inhibitors in the preparation of medicines. Background Art

[0002] Studies have shown that obesity-induced inflammation plays an important role in the body's glucose and lipid metabolism disorders and insulin resistance. Metabolic inflammation is closely related to the occurrence and development of obesity, type 2 diabetes and a series of metabolic syndromes, including insulin resistance, fatty liver, hyperglycemia, and dyslipidemia. Patients in an inflammatory state, especially obese patients, can produce a large number of inflammatory factors in their adipose tissue, and insulin resistance can also increase the inflammation of adipose tissue and other tissues. At the same time, the occurrence of obesity and type 2 diabetes can also accelerate the progression of cardiovascular and other related diseases. In obese adipose tissue, the ratio of macrophages M1 / M2 is unbalanced, that is, the ratio of M1 pro-inflammatory macrophages is increased, and the ratio of M2 anti-inflammatory macrophages is decreased, resulting in chronic inflammation of adipose tissue and aggravating insulin resistance. Therefore, by controlling the metabolic fuel used by macrophages to generate energy, macrophages can be effectively controlled to prevent excessive activity of macrophages, which may inhibit the occurrence of obesity and diabetes after tissue inflammation.

[0003] Currently, most of the known drugs targeting macrophages are concentrated in the field of tumors, including Roche's Emactuzumab (RG7155) and Plexxikon's PLX-3397. Due to the number advantage of macrophages and their strong migration and infiltration capabilities, they have great potential to change the microenvironment of lesions after being modified and then infused back into the patient's body. However, in the field of metabolism, macrophage targets and drugs are still to be explored.

[0004] Therefore, a lot of research is still needed to develop and find suitable drugs targeting macrophages, which will help delay, prevent or treat macrophage-related metabolic diseases. Summary of the invention

[0005] The present invention found that macrophage-specific knockout of CREBZF can not only significantly reduce insulin resistance and increase glucose tolerance in animal models induced by a high-fat and high-sugar diet (diabetic animal models); it also has an important inhibitory effect on the pro-inflammatory state of macrophages, effectively preventing macrophages in adipose tissue from secreting excessive pro-inflammatory factors and alleviating chronic inflammation. Therefore, the present invention provides the use of a CREBZF inhibitor in the preparation of a drug for treating or preventing macrophage-related diseases; the CREBZF inhibitor specifically targets macrophages; the macrophage-related diseases include: adipose tissue inflammation, adipose tissue macrophage infiltration diseases, and glycolipid metabolism diseases.

[0006] In the first aspect of the present invention, there is provided a use of a CREBZF inhibitor in the preparation of a drug for treating or preventing macrophage-related diseases; the CREBZF inhibitor specifically targets macrophages; the macrophage-related diseases include: adipose tissue inflammation, adipose tissue macrophage infiltration diseases, and glycolipid metabolism diseases.

[0007] In one or more embodiments, the adipose tissue inflammation includes: chronic adipose tissue inflammation.

[0008] In one or more embodiments, the adipose tissue macrophage infiltration disease includes: adipose tissue macrophage increase disease, adipose tissue pro-inflammatory macrophage increase disease, adipose tissue anti-inflammatory macrophage deficiency disease.

[0009] In one or more embodiments, the pro-inflammatory macrophages include CD206-CD11c+ macrophages.

[0010] In one or more embodiments, the anti-inflammatory macrophages include CD206+CD11c- macrophages.

[0011] In one or more embodiments, the "macrophage hyperplasia disease" refers to a state in which there are too many macrophages in tissues until a disease (inflammatory response) is formed.

[0012] In one or more embodiments, the "pro-inflammatory macrophage hyperplasia disease" refers to a state in which there are too many pro-inflammatory macrophages in tissues until a disease (inflammatory response) is formed.

[0013] In one or more embodiments, the "anti-inflammatory macrophage deficiency disease" refers to a state in which there are too few anti-inflammatory macrophages in tissues until a disease (inflammatory response) state is formed.

[0014] In one or more embodiments, the glucose and lipid metabolism diseases include: metabolic diseases caused by excessive diet (such as high-fat, high-sugar diet); preferably, the glucose and lipid metabolism diseases include: insulin resistance, diabetes (including type 2 diabetes), hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, and obesity.

[0015] In one or more embodiments, the CREBZF inhibitor is an agent that targets CREBZF and inhibits the expression or activity of CREBZF.

[0016] In one or more embodiments, the CREBZF inhibitor includes (but is not limited to): an agent for knocking out or silencing CREBZF, a binding molecule that specifically binds to CREBZF (such as an antibody to CREBZF), and a chemical small molecule antagonist or inhibitor against CREBZF.

[0017] In one or more embodiments, the reagent for knocking out or silencing CREBZF includes (but is not limited to): a CREBZF loss-of-function mutation reagent, or an interfering molecule that specifically interferes with the expression of the gene encoding CREBZF; preferably, the CREBZF loss-of-function mutation reagent includes (but is not limited to): a homologous recombination reagent for CREBZF, a CRISPR gene editing reagent, or a site-directed mutagenesis reagent.

[0018] In one or more embodiments, the binding molecule that specifically binds to CREBZF includes: an antibody against CREBZF.

[0019] In one or more embodiments, the homologous recombination agent for CREBZF includes: a homologous recombination vector of a nucleic acid sequence encoding a CREBZF mutant whose activity is downregulated or lost compared with wild-type CREBZF.

[0020] In one or more embodiments, the interfering molecule that specifically interferes with the expression of the gene encoding CREBZF includes: siRNA, miRNA, shRNA or antisense RNA.

[0021] In one or more embodiments, the siRNA or antisense RNA binds to the promoter region of CREBZF.

[0022] In one or more embodiments, the gene editing vector knocks out the promoter region, open reading frame (ORF), or exon region of CREBZF, or introduces a mutation in the promoter region that causes promoter inactivation, thereby inhibiting the expression of CREBZF.

[0023] In another aspect of the present invention, a method for establishing an animal model for resistance to macrophage-related diseases is provided, the method comprising: (a) providing an animal for modeling; (b) specifically inhibiting the expression or activity of CREBZF in the macrophages of the animal described in (a); wherein the macrophage-related diseases include: adipose tissue inflammation, adipose tissue macrophage infiltration diseases, and glycolipid metabolism diseases.

[0024] In one or more embodiments, in (b), the expression or activity of CREBZF in the macrophages is specifically inhibited by a method selected from the following group: a loss-of-function mutation is performed on CREBZF to interfere with the expression of the gene encoding CREBZF by interfering molecules specifically; preferably, the loss-of-function mutation of CREBZF includes (but is not limited to): knocking out CREBZF by homologous recombination method, knocking out CREBZF by CRISPR gene editing reagent, or knocking out CREBZF by site-directed mutagenesis reagent.

[0025] In one or more embodiments, the method comprises: (1) knocking out CREBZF in animal embryonic stem cells by homologous recombination, screening embryonic stem cells that undergo homologous recombination, and allowing them to develop into animals; (2) hybridizing the animal of (1) with an animal expressing the cre enzyme in a bone marrow cell lineage (monocytes, mature macrophages, and granulocytes), and then selfing the heterozygous animal to obtain the animal model.

[0026] In one or more embodiments, the animal is a mouse.

[0027] In one or more embodiments, the animal whose bone marrow cell lineage (monocytes, mature macrophages and granulocytes) expresses the Cre enzyme is a LysM-Cre mouse.

[0028] In another aspect of the present invention, a method for screening potential substances for treating or preventing macrophage-related diseases is provided, the method comprising: (1) providing a system comprising macrophages, and the macrophages express CREBZF; (2) adding a candidate substance to the system of (1) and observing its effect on the system; if the candidate substance can specifically inhibit (significantly inhibit, such as reducing it by 10%, 20%, 40%, 60%, 80%, 90% or lower, or making it certain) the expression or activity of macrophage CREBZF, then the candidate substance is a potential substance for treating or preventing macrophage-related diseases; wherein the macrophage-related diseases include: adipose tissue inflammation, adipose tissue macrophage infiltration diseases, and glycolipid metabolism diseases.

[0029] In one or more embodiments, the method further comprises, in (2), setting a control group to which the candidate substance is not added, so as to clearly distinguish the difference between the expression or activity of CREBZF in macrophages of the test group and that of the control group.

[0030] In one or more embodiments, the candidate substances include (but are not limited to): regulatory molecules designed for macrophage CREBZF or its encoding gene or its upstream or downstream proteins or genes (such as upregulators, downregulators, small molecule compounds, gene editing constructs, etc.

[0031] In one or more embodiments, the system includes: a macrophage culture system, an animal tissue / organ system containing the macrophage, and an animal system containing the macrophage.

[0032] Other aspects of the present invention will be apparent to those skilled in the art in view of the disclosure herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 , construction and identification of CREBZF macrophage-specific knockout mice.

[0034] (A) Schematic diagram of the construction of mice carrying CREBZF alleles at the Flox site and mice with CREBZF macrophage-specific knockout;

[0035] (B) The target fragments generated by F1 and R1 PCR for identification of CREBZF Flox mice were 248 bp; the target fragment size for identification of LysM-Cre was 700 bp;

[0036] (C) Verification of CREBZF expression levels in macrophages of mice carrying the CREBZF allele of the Flox site and mice with CREBZF macrophage-specific knockout.

[0037] * indicates significant difference compared with the wild type (WT) group (P<0.05).

[0038] Figure 2 , fasting blood glucose, plasma insulin levels, insulin resistance index (HOMA-IR), insulin sensitivity and glucose tolerance evaluation of CREBZF macrophage-specific knockout mice.

[0039] (A) Fasting blood glucose levels in mice;

[0040] (B) Plasma insulin levels in mice;

[0041] (C) Mouse insulin resistance index (HOMA-IR) level;

[0042] (D) Glucose tolerance test (GTT) results of the normal diet group (Chow) and the high-fat and high-sugar diet-induced mouse group (HFHS) (blood glucose fluctuation curve after glucose injection, total GTT changes);

[0043] (E) Insulin sensitivity test (ITT) results of the normal diet group (Chow) and the high-fat and high-sugar diet-induced mouse group (HFHS) (blood glucose fluctuation curve after insulin injection, total ITT change).

[0044] In the figure, * represents a significant difference (P<0.05) compared with the wild-type (WT) group on a normal diet (Chow), and # represents a significant difference (P<0.05) compared with the wild-type (WT) group on a high-fat and high-sugar diet (HFHS).

[0045] Figure 3 , changes in plasma triglyceride, total cholesterol levels and body weight in CREBZF macrophage-specific knockout mice.

[0046] (A) Plasma triglyceride levels in mice;

[0047] (B) Plasma total cholesterol levels in mice;

[0048] (C) Mouse body weight.

[0049] * indicates a significant difference (P<0.05) compared with the wild-type (WT) group on a normal diet (Chow); # indicates a significant difference (P<0.05) compared with the wild-type (WT) group on a high-fat and high-sugar diet (HFHS).

[0050] Figure 4 , HE sections of adipose tissue and macrophage ratio of CREBZF macrophage-specific knockout mice.

[0051] (A) HE staining results of mouse epididymal fat;

[0052] (B) Flow cytometric analysis of macrophage proportion in mouse epididymal adipose tissue.

[0053] In the figure, * represents a significant difference (P<0.05) compared with the wild-type (WT) group on a normal diet (Chow), and # represents a significant difference (P<0.05) compared with the wild-type (WT) group on a high-fat and high-sugar diet (HFHS).

[0054] Figure 5 , macrophage-specific knockout of CREBZF alleviates adipose tissue inflammation.

[0055] (A) Expression levels of pro-inflammatory genes (IL6, IL-1β, TNFα, INOS) and anti-inflammatory genes (Mgl1, Mrc1, Ym1) in the vascular stromal cells of mouse adipose tissue;

[0056] (B) Changes of JNK, an inflammatory pathway in eWAT, in adipose tissue of mice fed a high-fat and high-sugar diet for 16 weeks. Actin is an internal reference.

[0057] * indicates significant difference compared with the wild type (WT) group (P<0.05).

[0058] Figure 6 , comparison between macrophage-specific knockout of CREBZF (MKO) and hepatocyte-specific knockout of CREBZF (LKO). DETAILED DESCRIPTION

[0059] After in-depth research, the inventors found that macrophage-specific knockout of CREBZF can not only significantly reduce insulin resistance and increase glucose tolerance in animal models induced by high-fat and high-sugar diets (diabetic animal models); but also has an important inhibitory effect on the pro-inflammatory state of macrophages, effectively preventing macrophages in adipose tissue from secreting excessive pro-inflammatory factors and alleviating chronic inflammation. Therefore, the present invention provides the use of a CREBZF inhibitor in the preparation of a drug for treating or preventing macrophage-related diseases; the CREBZF inhibitor specifically targets macrophages; the macrophage-related diseases include: adipose tissue inflammation, adipose tissue macrophage infiltration diseases, and glycolipid metabolism diseases.

[0060] As used herein, the term "macrophage" is a cell population with high plasticity and pluripotency, which can be expressed as two main phenotypes according to the activation type. Unactivated macrophages are called M0 macrophages, and their characteristic surface markers include CD14, CD11c, CD68, and F4 / 80 (specific to mice). After initial stimulation, macrophages can obtain different phenotypes: M1 macrophages are "classically activated" types, with characteristic surface markers of CD80 and CD86, and have the functions of antigen presentation, secretion of proinflammatory cytokines and toxic mediators, thereby achieving the purpose of killing bacteria, pathogens and tumor cells, but often also lead to overexpression of inflammatory response, causing damage to tissue cells; and M2 macrophages are called "alternative activation" macrophages, and characteristic surface markers include CD163 and CD206, and their main function is to secrete anti-inflammatory cytokines, drive immune regulation and promote wound healing and tissue remodeling.

[0061] It is known in the art that "macrophages" are unique and their functions / characteristics are completely different from other body cells such as "hepatocytes".

[0062] Herein, "M1 macrophages" and "pro-inflammatory macrophages" are used interchangeably. "M2 macrophages" and "anti-inflammatory macrophages" are used interchangeably.

[0063] As used herein, the term "macrophage-related disease" generally refers to metabolic diseases caused by high expression or high activity of macrophage CREBZF, including but not limited to: adipose tissue inflammation, adipose tissue macrophage infiltration disease, and sugar and lipid metabolism disease. The "sugar and lipid metabolism disease" can be a metabolic disease caused by excessive diet (e.g., high-fat, high-sugar diet), including but not limited to: insulin resistance, diabetes (including type 2 diabetes), hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, obesity, non-alcoholic fatty liver disease. It should be understood that "high expression" and "high activity" described herein refer to an increase in expression or activity in adipose tissue or macrophages compared to normal tissues or cells.

[0064] As used herein, the term "inflammation" generally refers to the upregulation of proinflammatory factors and the downregulation of anti-inflammatory factors. The "inhibition of inflammation" includes inhibiting, slowing down or reversing the upregulation of proinflammatory factors, and / or inhibiting, slowing down or reversing the downregulation of anti-inflammatory factors. The "upregulation" or "downregulation" includes the "upregulation" or "downregulation" of gene or protein activity, and the "increase" or "decrease" of gene or protein expression. The proinflammatory factors include but are not limited to: IL6, IL-1β, TNFα, INOS. The anti-inflammatory factors include but are not limited to: Mgl1, Mrc1, Ym1. "Adipose tissue inflammation" includes but is not limited to: chronic inflammation of adipose tissue.

[0065] As used herein, the term "adipose tissue macrophage infiltration disease" refers to an excessive number of macrophages in the tissue until a disease (inflammatory response) is formed. Adipose tissue macrophage infiltration diseases include, but are not limited to: adipose tissue macrophage increase disease, adipose tissue pro-inflammatory macrophage increase disease, adipose tissue anti-inflammatory macrophage deficiency disease.

[0066] In one or more embodiments, the "pro-inflammatory macrophage hyperplasia disease" refers to a state in which there are too many pro-inflammatory macrophages in tissues until a disease (inflammatory response) is formed.

[0067] In one or more embodiments, the "anti-inflammatory macrophage deficiency disease" refers to a state in which there are too few anti-inflammatory macrophages in tissues until a disease (inflammatory response) state is formed.

[0068] As used herein, the term "targeting macrophages" refers to specifically or selectively acting on macrophages, thereby preventing or treating macrophage-related diseases.

[0069] Herein, the term "CREBZF inhibitor" generally refers to an agent that targets CREBZF and inhibits the expression or activity of CREBZF.

[0070] CREZ

[0071] In this article, "CREBZF", also known as "Zhangfei", ZF or "HCF-binding transcriptionfactor Zhangfei", belongs to the basic leucine zipper (bZIP) transcription factor of the Activation Transcription Factor / cAMP Response Element-Binding protein (ATF / CREB) family. ATF / CREB family members have transcriptional regulatory functions and respond to a variety of extracellular signals. They play a bridging role in mediating extracellular nutrient signals, growth factor sensing, intracellular glucose and lipid metabolism, and cell proliferation homeostasis, and are involved in liver glucose and lipid metabolism, cell growth, and tumor diseases.

[0072] The CREBZF gene involved in the present invention or the CREBZF protein encoded by it includes CREBZF genes and CREBZF proteins from different species, especially CREBZF genes and CREBZF proteins from mammals (such as humans and mice, etc.). Human CREBZF gene can refer to Gene ID: 58487, and human CREBZF protein can refer to NCBI accession number: NM_001039618. Mouse CREBZF gene can refer to Gene ID: 233490, and mouse CREBZF protein can refer to NCBI accession number: NM_145151. It should be understood that the CREBZF gene and CREBZF protein described in the present invention include mutants known in the art. These mutants are usually naturally produced and carried by the animal body itself. That is, such genes or proteins that can be referred to as "CREBZF" and "CREBZF" in the art are included within the scope of the present invention. CREBZF is expressed in a variety of tissues, including adipose tissue, liver, immune system, muscle, brain, etc.

[0073] CREBZF inhibitors and their applications

[0074] The present invention finds that using macrophage CREBZF as a target can prevent or treat diseases, such as macrophage-related diseases. The present invention also reveals that specific knockout of macrophage CREBZF can inhibit the upregulation of pro-inflammatory factors and reverse the downregulation of anti-inflammatory factors, thereby reducing macrophage infiltration in adipose tissue and alleviating chronic inflammation of adipose tissue.

[0075] Therefore, the present invention provides the use of a CREBZF inhibitor in the preparation of a drug targeting macrophages. In other words, the present invention provides the use of a CREBZF inhibitor in the preparation of a drug for preventing or treating macrophage-related diseases.

[0076] The treatment or prevention of the disease can be achieved by targeting CREBZF and inhibiting the expression or activity of CREBZF, that is, by a CREBZF inhibitor. In the present invention, the inhibition of CREBZF protein activity can be achieved by techniques well known in the art. For example, an antibody to CREBZF can be administered to antagonize its activity. Commercially available antibodies can be used. Alternatively, the inhibition of CREBZF protein activity can be achieved by expressing a mutated CREBZF protein, and generally, the biological activity of the mutated CREBZF protein is downregulated or lost. For example, a homologous recombination vector can be expressed in a subject cell, and a nucleic acid sequence encoding a CREBZF with a biological activity downregulated or lost as a CREBZF protein is recombined into the genome of the cell, replacing a normal CREBZF gene, so that the subject cell expresses a mutated CREBZF. Mutations usually occur in the functional domain of CREBZF. Mutations can be insertions, deletions, or substitutions of any number, as long as the activity of the mutated CREBZF is downregulated or lost. In some embodiments, small molecule compounds can also be used to antagonize the biological activity of CREBZF.

[0077] In the present invention, CREBZF gene expression can be inhibited by expressing a suitable nucleic acid molecule. Such nucleic acid molecules include but are not limited to siRNA, antisense RNA, ribozymes and gene editing vectors. siRNA is a double-stranded RNA of 20 to 25 nucleotides in length, which participates in RNA interference (RNAi) and inhibits the expression of CREBZF gene in a specific manner. siRNA can also be introduced into the subject cell via a variety of different transfection techniques, and produce a specific knock-down effect on CREBZF. siRNA can be designed using siRNA design principles known in the art. siRNA of interest can be prepared by methods such as chemical synthesis, in vitro transcription, siRNA expression vectors, and PCR expression components. Antisense RNA refers to RNA that can inhibit gene expression after complementing mRNA. Antisense RNA generally includes three categories: Class I antisense RNA directly acts on the SD sequence and / or part of the coding region of the target mRNA, directly inhibits translation, or binds to the target mRNA to form double-stranded RNA, which is easily degraded by RNase III; Class II antisense RNA binds to the non-coding region of the mRNA, causing conformational changes in the mRNA and inhibiting translation; Class III antisense RNA directly inhibits the transcription of the target mRNA. Ribozymes are small molecule RNAs with catalytic functions that can degrade specific mRNA sequences. Ribozymes can specifically shear substrate RNA molecules by catalyzing the breakage of phosphodiester bonds in the RNA chain at the target site, thereby blocking the expression of the target gene. The gene editing vector can be a CRISPR-CAS9 gene editing vector, a Cre-lox gene editing vector, a Flp-FRT gene editing vector, a Dre-Rox gene editing vector, a vCre-vloxp and sCre-sloxp gene editing vector, or a TALEN gene editing vector known in the art. In some embodiments, the siRNA or antisense RNA binds to the promoter region of CREBZF, or the gene editing vector knocks out the promoter region, open reading frame (ORF), or exon region of CREBZF, or introduces a mutation that causes promoter inactivation in the promoter region, thereby inhibiting the expression of CREBZF. The siRNA, antisense RNA, ribozyme and gene editing vector suitable for the present invention can be prepared using techniques known in the art, and administered to a subject in need for inhibiting the expression of CREBZF.

[0078] Therefore, the present invention provides the use of CREBZF inhibitors in the preparation of drugs for treating or preventing macrophage-related diseases. The present invention also provides a method for treating or preventing macrophage-related diseases, comprising administering a therapeutically effective amount or a preventively effective amount of a CREBZF inhibitor to a subject in need. The CREBZF inhibitor is as described above. The method for treating macrophage-related diseases can adopt well-known techniques in the art, such as CAR-modified macrophages (CAR-Macrophage, i.e., CAR-M) technology, and macrophages can be edited in vitro and then re-infused to achieve treatment. CAR-M is centered on macrophages, extracts macrophages from the patient himself, introduces CAR into macrophages through genetic engineering methods, and ultimately achieves targeted treatment of the disease.

[0079] The present invention also provides a pharmaceutical composition or mixture containing the CREBZF inhibitor described herein. The pharmaceutical composition or mixture may also contain a physiologically or pharmaceutically acceptable carrier or excipient. Herein, "physiologically or pharmaceutically acceptable carrier" refers to those carriers and diluents that have no obvious irritation to the organism and do not damage the biological activity and performance of the agent in the taken pharmaceutical composition. "Physiologically or pharmaceutically acceptable excipient" refers to an inert substance added to the pharmaceutical composition or mixture that further facilitates the administration of the agent. Non-limiting examples of excipients include calcium carbonate, calcium phosphate, various sugars and various types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycol.

[0080] The CREBZF inhibitor, its pharmaceutical composition or mixture of the present invention can be prepared into any conventional formulation form by conventional methods. The dosage form can be various, as long as it is a dosage form that can effectively allow the active ingredient to reach the subject's body. For example, it can be selected from: injections, infusions, tablets, capsules, pills. The active ingredient (CREBZF inhibitor) can be present in a suitable solid or liquid carrier or diluent. The mixture or pharmaceutical composition of the active ingredient of the present invention can also be stored in a sterilized device suitable for injection or instillation.

[0081] The effective dose of the active ingredient (CREBZF inhibitor) in the pharmaceutical composition or mixture may vary with the mode of administration and the severity of the disease to be treated, which can be based on the experience and advice of the clinician. The effective dose is the amount of medicine that effectively improves or eliminates one or more symptoms, which can be determined by a person of ordinary skill in the art based on the age, sex, physical condition, etc. of the subject. The dosage may cure the disease, but administration is usually to improve the symptoms of the disease. Repeated administration is generally required to achieve the desired symptom improvement.

[0082] In a specific embodiment of the present invention, a series of dosing regimens of CREBZF inhibitors according to different molar ratios or mass ratios are proposed. In the present invention, mice are also used as experimental animals. It is easy for those skilled in the art to convert the dosage of mice into a dosage suitable for humans, for example, it can be calculated according to the Meeh-Rubner formula:

[0083] A=k×(W2 / 3) / 10000.

[0084] Where A is the body surface area, calculated in m2; W is the body weight, calculated in g; K is a constant, which varies with the animal species, 9.1 for mice and rats, 9.8 for guinea pigs, 10.1 for rabbits, 9.9 for cats, 11.2 for dogs, 11.8 for monkeys, and 10.6 for humans. It should be understood that the dosage conversion can vary depending on the drug and clinical situation, based on the evaluation of an experienced pharmacist.

[0085] Herein, the subject is a mammal, especially a human.

[0086] The present invention also provides a kit or test kit for treating or preventing macrophage-related diseases, wherein the kit or test kit contains the CREBZF inhibitor described in any embodiment of the present invention. Alternatively, the kit or test kit contains a pharmaceutical composition or mixture of the CREBZF inhibitor described herein. Alternatively, the kit or test kit contains: a container, and a CREBZF inhibitor described herein placed in the container.

[0087] The medicine box or test kit may also contain some auxiliary medication materials, such as measuring tools and containers such as syringes required for using or applying various dosage forms of the composition. The medicine box or test kit may also contain instructions for use, explaining methods for improving insulin resistance or increasing glucose tolerance.

[0088] Establishment of an animal model for resistance to macrophage-related diseases

[0089] The present invention successfully constructs an animal model for resisting macrophage-related diseases, namely, a CREBZF macrophage-specific knockout animal. Therefore, the present invention provides a method for establishing an animal model for resisting macrophage-related diseases, characterized in that the method comprises: (a) providing an animal for modeling; (b) specifically inhibiting the expression or activity of CREBZF in its macrophages for the animal described in (a); wherein the macrophage-related diseases include: adipose tissue inflammation, adipose tissue macrophage infiltration diseases, and glycolipid metabolism diseases.

[0090] In one or more embodiments, in (b), the expression or activity of CREBZF in the macrophages is specifically inhibited by a method selected from the following group: a loss-of-function mutation is performed on CREBZF to interfere with the expression of the gene encoding CREBZF by interfering molecules specifically; preferably, the loss-of-function mutation of CREBZF includes (but is not limited to): knocking out CREBZF by homologous recombination method, knocking out CREBZF by CRISPR gene editing reagent, or knocking out CREBZF by site-directed mutagenesis reagent.

[0091] In one or more embodiments, the method comprises:

[0092] (1) Knock out CREBZF in animal embryonic stem cells by homologous recombination, screen out embryonic stem cells that have undergone homologous recombination, and develop them into animals;

[0093] (2) The animal of (1) is crossed with an animal whose bone marrow cell lineage (monocytes, mature macrophages and granulocytes) expresses the cre enzyme, and then the heterozygous animal is self-crossed to obtain the animal model.

[0094] Animals expressing Cre enzymes in the myeloid cell lineage are known in the art and can be used in (2). For example, lysozyme M (LysM), an important component of the innate immune system, is highly expressed in the myeloid cell lineage (monocytes, mature macrophages and granulocytes), and its promoter has been used to direct Cre-recombinase expression to target myeloid cells (e.g., macrophages).

[0095] In one or more embodiments, the animal is a mouse; preferably, the animal whose bone marrow cell lineage (monocytes, mature macrophages and granulocytes) expresses the cre enzyme is a LysM-Cre mouse.

[0096] Drug Screening

[0097] After knowing the close correlation between CREBZF and metabolic microenvironment or macrophages and their working mechanism, drugs that further optimize the inhibitory effect can be screened based on this feature. Drugs that target macrophages in the metabolic microenvironment and are truly useful for treating or preventing macrophage-related diseases can be found from the above substances.

[0098] Therefore, the present invention provides a method for screening potential substances for treating or preventing macrophage-related diseases, the method comprising:

[0099] (1) providing a system comprising macrophages, wherein the macrophages express CREBZF;

[0100] (2) adding the candidate substance to the system of (1) and observing its effect on the system;

[0101] If the candidate substance can specifically inhibit (significantly inhibit, such as reducing it by 10%, 20%, 40%, 60%, 80%, 90% or lower, or indeed) the expression or activity of macrophage CREBZF, then the candidate substance is a potential substance for treating or preventing macrophage-related diseases;

[0102] Wherein, the macrophage-related diseases include: adipose tissue inflammation, adipose tissue macrophage infiltration diseases, and glycolipid metabolism diseases.

[0103] In one or more embodiments, during induction, a high-fat and high-sugar (HFHS) diet is used to induce the system to produce macrophage-related diseases. In order to more easily observe the changes in the corresponding indicators caused by the high-fat and high-sugar (HFHS) diet, a normal diet (Chow) group can also be set, and the normal diet (Chow) group can be a system fed with a normal diet and with other conditions being the same as those of the high-fat and high-sugar (HFHS) diet group.

[0104] In one or more embodiments, if the candidate substance can specifically inhibit CREBZF in macrophages during screening observation, the candidate substance is a potential substance for treating or preventing macrophage-related diseases.

[0105] In one or more embodiments, during screening, in order to more easily observe changes in corresponding indicators in the test group, a control group can also be set up in (2). The control group can be a system without adding the candidate substance, but with other conditions being the same as the test group, so as to clearly distinguish the difference in CREBZF expression or activity of macrophages in the test group and that in the control group.

[0106] In one or more embodiments, the system includes: a macrophage culture system, an animal tissue / organ system containing the macrophage, and an animal system containing the macrophage.

[0107] In one or more embodiments, the method further comprises: performing further cell experiments and / or animal experiments on the obtained potential substances to further select and determine substances that are truly useful for treating or preventing macrophage-related diseases.

[0108] Methods for screening substances that act on a target by using a protein or gene or a specific region thereon as a target are well known to those skilled in the art, and these methods can be used in the present invention. The candidate substances include (but are not limited to): regulatory molecules designed for macrophage CREBZF or its encoding gene or its upstream or downstream proteins or genes (such as up-regulators, down-regulators, small molecule compounds, gene editing constructs, etc.). Depending on the type of substance to be screened, those skilled in the art know how to select an appropriate screening method.

[0109] A variety of conventional techniques can be used to identify the transcription or expression of genes in the system. These techniques include, but are not limited to, oligonucleotide hybridization techniques (such as probes), polymerase chain reaction (PCR), polyacrylamide gel electrophoresis, etc. The interaction between proteins and the strength of the interaction can be detected by a variety of techniques well known to those skilled in the art, such as immunoprecipitation, GST sedimentation, phage display or yeast two-hybrid system. The cellular localization of proteins is also a well-known technique in the art.

[0110] Through large-scale screening, a class of potential substances that specifically act on CREBZF and treat or prevent macrophage-related diseases can be obtained. Therefore, the present invention also provides potential substances for treating or preventing macrophage-related diseases obtained by the screening method. These preliminary screened substances can constitute a screening library so that people can eventually screen out truly useful drugs therefrom.

[0111] From another perspective, the present invention provides a detection kit for CREBZF gene or protein, which can determine the condition of macrophage-related diseases, such as whether insulin resistance or glucose tolerance is impaired, by detecting the presence or absence and / or changes in the amount of CREBZF gene or protein.

[0112] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually carried out according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning Experiment Guide, 3rd Edition, Science Press, or according to the conditions recommended by the manufacturer.

[0113] Materials and methods

[0114] 1. Experimental Animals

[0115] (1) Generation of mice carrying the CREBZF allele at the Flox locus

[0116] The CREBZF allele mouse with Flox site was provided by Cyagen, China. That is, an open reading frame (ORF) containing CREBZF exon, a LoxP site and a LoxP-Neo site with a total length of 1062 bp was constructed in vitro, and then constructed into the target plasmid. The plasmid was linearized by restriction endonuclease Swal, and then the sequence containing the target gene fragment constructed in vitro was introduced into mouse embryonic stem cells (ES cells) (AB1, 129 / SvEv) by electroporation. ES cell clones were screened by drug resistance, and Neo probe (as shown in SEQ ID NO: 1-2) was used to perform Southern PCR. The blot technology was used to detect the genome of the cells, and ES cell clones with homologous recombination were screened out. The ES cell clones with homologous recombination were injected into C57BL / 6 (B6) blastocysts, and the injected blastocysts were transferred to the oviducts of pseudo-pregnant female mice (C57BL / 6J) according to standard procedures. After the chimeric mice were born, the chimeras were judged based on the fur color and the degree of chimerism, and the male chimeric mice were mated with wild-type female mice C57BL / 6J. Mice containing Flox sites at both ends of CREBZF CKO (conditional knockout) were obtained through Flp-mediated homologous recombination.

[0117] Neo probe-F:TCATCTCACCTTGCTCCTGC(SEQ ID NO:1)

[0118] Neo probe-R:AAGGCGATAGAAGGCGATGC(SEQ ID NO:2)

[0119] There are two pairs of primers for genotyping CREBZF Flox, which are shown in SEQ ID NOs: 3-4 and SEQ ID NOs: 5-6 respectively.

[0120] F1:GCTTGCAGTTTAGAGAGAAACAGC(SEQ ID NO:3)

[0121] R1:CAGCCAGAGTATCGCGAGATTC(SEQ ID NO:4)

[0122] F2:TTGACAATAAGTATTGAGGCATGCG(SEQ ID NO:5)

[0123] R2:TTTCCAACTTCTCAAGTGGTGAAC(SEQ ID NO:6)

[0124] The target fragments generated by F1 and R1 PCR were 248 bp (wild type) and 318 bp (CREBZF genotype mice containing Flox sites), respectively, and the target fragments generated by F2 and R2 PCR were 157 bp (wild type) and 285 bp (CREBZF genotype mice containing Flox sites), respectively.

[0125] (2) Generation of macrophage-specific CREBZF knockout mice (CREBZF MKO)

[0126] The LysM-Cre transgenic mice (LysM-Cre TG) used in the present invention were purchased from Shanghai Model Organisms and are tool mice used together with transgenic mice carrying Flox to specifically knock out genes in macrophages.

[0127] Macrophage-specific CREBZF knockout mice (CREBZF MKO) were obtained by crossing CREBZF mice with Flox and LysM-Cre transgenic mice (LysM-Cre TG) to obtain first-generation heterozygous mice, and then the heterozygous mice were self-crossed in the second generation to obtain a small number of homozygous knockout mice CREBZF MKO (CREBZF Flox+ / +Cre+ / -) and homozygous control mice CREBZF WT (CREBZF Flox+ / +Cre- / -). Then, the knockout mice obtained were mated with the control mice to expand the population and obtain a sufficient number of mice for experiments.

[0128] Wild-type and CREBZF MKO mice were randomly divided into four groups, two of which were induced with a normal (Chow) diet, and the other two groups were fed with a high-fat and high-sugar (HFHS) diet. The high-fat and high-sugar diet (HFHS) consumed by mice was purchased from Research Diet, USA.

[0129] The primers used to detect LysM-Cre are shown in SEQ ID NOs: 7 to 9. The target fragment size in wild-type mice is 350 bp, and the target fragment size in mice with Cre fragment inserted is 700 bp.

[0130] Forward1:CCC AGA AAT GCC AGA TTA CG(SEQ ID NO:7)

[0131] Forward2:TTA CAG TCG GCC AGG CTG AC(SEQ ID NO:8)

[0132] Reverse:CTT GGG CTG CCA GAA TTT CTC(SEQ ID NO:9)

[0133] 2. Main reagents

[0134] The triglyceride detection kit (Infinity Triglycerides Reagent, TG) and cholesterol detection kit (Infinity Cholesterol Reagent, TC) were purchased from Thermo Scientific.

[0135] Ultrasensitive Mouse Insulin ELISA kit (Mercodia);

[0136] Freestyle blood glucose meter and blood glucose test strips (Abbott);

[0137] Recombinant human insulin injection (Eli Lilly and Company);

[0138] Glucose (Sigma);

[0139] Flow cytometry detection antibodies were purchased from Thermo Scientific.

[0140] 3. Instruments and equipment

[0141] Nuclear magnetic resonance (NMR) body composition analysis (Bruker magnetic resonance fat content measurement instrument Mq7.5);

[0142] Microplate reader (Tecan-200 - Microplate reader Infinite 200PRO);

[0143] Micropipettes were purchased from Rainin or Eppendorf;

[0144] The vertical electrophoresis tank, wet transfer membrane instrument, and supporting power supply were purchased from Bio-Rad;

[0145] The refrigerated centrifuge was purchased from Eppendorf;

[0146] The PCR instrument was purchased from Bio-Rad;

[0147] The real-time fluorescence quantitative PCR system ABI 7500 Fast Real-Time PCR System was purchased from Applied Biosystems;

[0148] The flow cytometer CytoFLEX S was purchased from Beckman Coulter.

[0149] 4. Animal grouping and experimental mouse model construction

[0150] Eight-week-old CREBZF MKO male mice and matched CREBZF WT male mice were randomly divided into groups as shown in Table 1.

[0151] Eight-week-old CREBZF MKO male mice and matched CREBZF WT male mice were fed a high-fat, high-sugar diet for 16 weeks to construct a high-calorie (high-fat, high-sugar (HFHS)) diet-induced diabetic mouse model (insulin resistance mouse model), and normal diet (Chow) mice were used as controls.

[0152] Table 1: Grouping and treatment of mice

[0153]

[0154] The mice were kept in an SPF animal room. After weaning on day 22, they were separated into cages according to gender. The mice were allowed to eat and drink freely (standard food provided by Shanghai Experimental Animal Center). The animal room was maintained at a temperature of 22±3°C, a humidity of 35±5%, and a 12-hour day and night cycle. All experiments were conducted on 8-week-old mice.

[0155] 5. Mouse index determination and mouse tissue collection

[0156] (1) Weekly measurement of mouse indicators: The body weight and food intake of mice were measured every week and the data were recorded.

[0157] (2) The fasting blood glucose of mice was measured three months after the experimental treatment.

[0158] (3) Mice sacrifice: Four months after the experiment, the mice were sacrificed and their tissues were collected.

[0159] Sacrifice method: Use isoflurane anesthesia to induce deep coma in mice, then open the chest cavity and use a 1ml syringe to collect blood from the apex of the heart. The blood is placed in a blood collection tube containing anticoagulant, centrifuged at 4℃3000rpm for 15min, and the supernatant is collected. After blood collection, take a picture of the ventral side of the mouse. Quickly remove epididymal fat, weigh it after taking a picture, fix it with formaldehyde and embed it in frozen (OCT) to observe the pathological changes of adipose tissue in experimental mice, and the remaining tissue is used for Western Blot experiment and RT-PCR experiment.

[0160] 6. Glucose tolerance test and insulin tolerance test

[0161] Glucose tolerance test:

[0162] After 16 hours of starvation, fasting blood glucose was measured, and then 1 g / ml glucose was injected into the mouse peritoneum. Blood was collected from the tail vein of the mouse at 0, 15, 30, 60, 90, and 120 minutes after glucose injection, and blood glucose levels were measured using a blood glucose meter.

[0163] Insulin tolerance test:

[0164] After 8 hours of starvation, fasting blood glucose was measured, and then 1U / kg glucose was injected into the mouse peritoneum. Blood was collected from the tail vein of the mouse at 0, 15, 30, 60, 90, and 120 minutes after glucose injection, and blood glucose levels were measured using a blood glucose meter.

[0165] Example 1: Construction of CREBZF macrophage-specific knockout animals

[0166] Eight-week-old male CREBZF macrophage-specific knockout mice (CREBZF MKO) on a C57Bl / 6 background were obtained by crossing mice carrying the CREBZF allele of the Flox locus with LysM-Cre transgenic mice (LysM-Cre TG) ( Figure 1 A). Genotyping of CREBZF MKO mice and analysis of CREBZF expression in macrophages.

[0167] The results showed that macrophage-specific knockout mice (CREBZF MKO) were successfully constructed ( Figure 1 BC).

[0168] A similar approach was used, except that the target of CREBZF knockout was replaced by hepatocytes instead of macrophages, to obtain liver-specific knockout mice (CREBZF LKO), which were obtained by hybridizing mice carrying the CREBZF allele of the Flox site with Alb-Cre transgenic mice (Alb-Cre TG).

[0169] Example 2: Effects of macrophage-specific knockout of CREBZF on animal glucose metabolism indicators

[0170] After 16 weeks of dietary induction treatment, various metabolic indicators of the experimental animals induced by high-fat and high-sugar diet and the control animals were measured, including fasting blood glucose, plasma insulin levels, glucose tolerance and insulin sensitivity.

[0171] The mice in each group were fasted for 16 hours and their fasting blood sugar was measured. The results showed that under normal diet conditions, there was no significant change in blood sugar between the experimental group and the control group ( Figure 2 A). Under the condition of high-fat and high-sugar (HFHS) diet induction, the fasting blood glucose of the experimental group mice (CREBZF MKO) was significantly lower than that of the control group mice (CREBZF WT) (P<0.05) ( Figure 2 A).

[0172] The mice in each group were fasted for 8 hours, and the insulin level in the mouse plasma was measured. The results showed that under the condition of high-fat and high-sugar (HFHS) diet induction, the insulin level in the plasma of the experimental group mice was significantly lower than that of the control group mice (P<0.05) ( Figure 2 B).

[0173] The insulin resistance index (HOMA-IR) of each group of mice was analyzed. The results showed that under the condition of high-fat and high-sugar (HFHS) diet induction, the insulin resistance index of the experimental group of mice (CREBZF MKO) was significantly decreased compared with the control group (CREBZF WT) ( Figure 2 C).

[0174] The mice were subjected to a glucose tolerance test (GTT). The results showed that under the condition of high-fat and high-sugar (HFHS) diet induction, the glucose tolerance of the experimental group of mice (CREBZF MKO) was significantly increased compared with the control group (CREBZF WT) (P<0.05) ( Figure 2 D), indicating that specific knockout of CREBZF in macrophages can significantly improve the phenotype of impaired glucose tolerance induced by a high-fat and high-saccharide (HFHS) diet.

[0175] The insulin sensitivity experiment found that under the condition of high-fat and high-sugar (HFHS) diet induction, the insulin sensitivity of the experimental group mice (CREBZF MKO) was significantly increased compared with the control group (CREBZF WT) (P<0.05) ( Figure 2 E), indicating that specific knockout of CREBZF in macrophages can significantly improve the phenotype of insulin resistance induced by a high-fat and high-sugar diet.

[0176] Example 3 Analysis of plasma triglyceride and cholesterol levels in CREBZF macrophage-specific knockout animals

[0177] After being fed a high-fat and high-sugar (HFHS) diet for 16 weeks, plasma was collected from mice in each group, and triglyceride (TG) and total cholesterol (TC) detection kits were used to measure triglyceride and total cholesterol in mouse plasma.

[0178] The results showed that under normal diet (Chow), there was no significant difference in the levels of plasma triglycerides and cholesterol between the experimental group (CREBZF MKO) and the control group (WT). However, in the mouse model induced by high-fat and high-sugar (HFHS) diet, the plasma triglyceride levels of the CREBZF MKO group were significantly lower than those of the control group (WT) (P<0.05). Figure 3 A). At the same time, the total cholesterol level in the plasma of mice in the CREBZF MKO group was significantly lower than that in the control group (WT) (P<0.05) ( Figure 3 B).

[0179] The above results indicate that specific knockout of CREBZF in macrophages can reduce the levels of triglycerides and cholesterol in the plasma of mice under a high-fat and high-sugar diet.

[0180] The body weight of the animals was examined. Compared with the control group (WT) mice, the body weight of the mice induced by the high-fat and high-sugar (HFHS) diet increased significantly, indicating that the high-fat and high-sugar (HFHS) diet-induced diabetes model in mice was successful (P<0.05) ( Figure 3 C).

[0181] Therefore, macrophage-specific downregulation of CREBZF can effectively reduce plasma triglyceride and cholesterol levels in animal models of metabolic diseases induced by a high-fat and high-sugar diet.

[0182] Example 4: Analysis of macrophage infiltration in adipose tissue of CREBZF macrophage-specific knockout animals

[0183] First, the inventors embedded the adipose tissue fixed with 4% paraformaldehyde for 48 hours into paraffin and sliced ​​it, and then used hematoxylin-eosin staining (HE staining) to observe the pathological changes of mouse fat.

[0184] HE staining results showed that under normal diet (Chow) feeding, the adipocytes of mice were smaller, the infiltration of macrophages was minimal, and there was no significant difference between the experimental group (CREBZF MKO) and the control group (WT) ( Figure 4 A); however, under the condition of high-fat and high-sugar diet (HFHS), the inventors found that the macrophage infiltration in the adipose tissue of the control group mice (WT) was more obvious, and there were many macrophages distributed around the adipocytes, with a typical "garland structure", but the macrophage infiltration in the adipose tissue of the experimental group mice (CREBZF MKO) was significantly less than that of the control group (WT), and the size of the adipocytes was also improved to a certain extent ( Figure 4 A). Observation of macrophage infiltration in sections shows that the number of inflammatory cells in adipose tissue of CREBZF MKO mice was significantly reduced under high-fat and high-sugar (HFHS) diet. All experimental results were obtained by observing sections from more than 8 different mice.

[0185] CD206 is mainly expressed on anti-inflammatory macrophages, and CD11c is mainly expressed on pro-inflammatory macrophages. The inventors performed flow cytometry on adipose tissue to analyze the presence of different types of macrophages (pro-inflammatory macrophages CD206-CD11c+, anti-inflammatory macrophages CD206+CD11c-). Consistent with the results of microscopic observation, CREBZF-specific knockout reduced the number of macrophages and the proportion of pro-inflammatory macrophages ( Figure 4 B).

[0186] Therefore, in CREBZF macrophage-specific knockout animals, macrophage infiltration in adipose tissue was attenuated and inflammation was alleviated.

[0187] Chronic inflammation in adipose tissue was not affected in animals with liver-specific CREBZF knockout.

[0188] Example 5: Analysis of chronic inflammation in adipose tissue of CREBZF macrophage-specific knockout animals

[0189] First, the inventors isolated the vascular stromal cells of the adipose tissue of mice fed a high-fat and high-sugar (HFHS) diet. The cells are rich in macrophages, which can better reflect the degree of inflammation in adipose tissue. They found that specific knockout of CREBZF reduced the expression level of pro-inflammatory factors and partially upregulated the expression level of anti-inflammatory factors ( Figure 5 A).

[0190] Furthermore, in the adipose tissue of high-fat and high-saccharide (HFHS)-fed mice, CREBZF-specific knockout reduced the activation of the inflammatory signaling pathway JNK. Representatively, p-JNK was significantly decreased in the adipose tissue of CREBZF MKO animals ( Figure 5 B).

[0191] The above results indicate that macrophage CREBZF-specific knockout significantly alleviated chronic inflammation in animal adipose tissue induced by a high-fat and high-sugar diet.

[0192] Example 6. Comparison of CREBZF macrophage-specific knockout and CREBZF hepatocyte-specific knockout

[0193] The results of comparing CREBZF macrophage-specific knockout (MKO) with CREBZF liver-specific knockout (CREBZF LKO) are shown in Figure 2 Figure 6 shown.

[0194] In terms of plasma triglyceride (TG) content, the improvement effect of MKO was significantly better than that of LKO.

[0195] In addition, MKO also improved insulin resistance and inflammation-related indicators, including macrophage infiltration and inflammatory factor expression.

[0196] The above results indicate that macrophage CREBZF-specific knockout significantly improved the plasma triglyceride (TG) level of animals induced by a high-fat and high-sugar diet compared with hepatocyte CREBZF-specific knockout, and can effectively prevent macrophages in adipose tissue from secreting excessive pro-inflammatory factors and alleviate chronic inflammation.

[0197] discuss

[0198] The present invention found that macrophage-specific knockout of CREBZF can not only significantly reduce insulin resistance and increase glucose tolerance in animal models induced by a high-fat and high-sugar diet (diabetic animal models), but also has an important inhibitory effect on the pro-inflammatory state of macrophages, effectively preventing macrophages in adipose tissue from secreting excessive pro-inflammatory factors and alleviating chronic inflammation. Therefore, macrophage-specific knockout of CREBZF can reduce insulin resistance and chronic inflammation at the same time.

[0199] This discovery of the present invention shows that specifically targeting CREBZF in macrophages for regulation has significant advantages. While effectively preventing and treating metabolic diseases caused by excessive diet, such as insulin resistance, type 2 diabetes, and hyperlipidemia, it can further effectively reduce macrophage infiltration in adipose tissue and alleviate inflammation.

[0200] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims. At the same time, all the documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference separately.

Claims

1. Use of a CREBZF inhibitor in the preparation of a drug for treating or preventing macrophage-related diseases; the CREBZF inhibitor specifically targets macrophages; the macrophage-related diseases include: Adipose tissue inflammation, adipose tissue macrophage infiltration diseases, and lipid metabolism diseases.

2. The use according to claim 1, characterized in that The adipose tissue inflammation includes: chronic adipose tissue inflammation.

3. The use according to claim 1, characterized in that The adipose tissue macrophage infiltration diseases include: diseases of increased macrophages in adipose tissue, diseases of increased pro-inflammatory macrophages in adipose tissue, and diseases of lack of anti-inflammatory macrophages in adipose tissue.

4. The use according to claim 3, characterized in that The pro-inflammatory macrophages include CD206-CD11c+ macrophages; or The anti-inflammatory macrophages include CD206+CD11c- macrophages.

5. The use according to claim 1, characterized in that The sugar and lipid metabolic diseases include: metabolic diseases caused by overeating; preferably, the sugar and lipid metabolic diseases include: insulin resistance, diabetes, hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, and obesity.

6. The use according to claim 1, characterized in that The CREBZF inhibitor is an agent that takes CREBZF as a target and inhibits the expression or activity of CREBZF.

7. The use according to claim 6, characterized in that The CREBZF inhibitors include: agents for knocking out or silencing CREBZF, binding molecules that specifically bind to CREBZF, and chemical small molecule antagonists or inhibitors targeting CREBZF.

8. The use according to claim 7, characterized in that The reagent for knocking out or silencing CREBZF includes: a CREBZF loss-of-function mutation reagent, or an interfering molecule that specifically interferes with the expression of the gene encoding CREBZF; preferably, the CREBZF loss-of-function mutation reagent includes: a homologous recombination reagent for CREBZF, a CRISPR gene editing reagent, or a site-directed mutagenesis reagent.

9. A method for establishing an animal model for resistance to macrophage-related diseases, characterized in that: The method comprises: (a) Providing animals for modeling; (b) specifically inhibiting the expression or activity of CREBZF in macrophages of the animal described in (a); Wherein, the macrophage-related diseases include: adipose tissue inflammation, adipose tissue macrophage infiltration diseases, and glycolipid metabolism diseases.

10. The method according to claim 9, characterized in that The method comprises: (1) Knock out CREBZF in animal embryonic stem cells by homologous recombination, screen out embryonic stem cells that have undergone homologous recombination, and develop them into animals; (2) The animal of (1) is crossed with an animal whose bone marrow cell lineage expresses the cre enzyme, and then the heterozygous animal is self-fertilized to obtain the animal model.

11. The method according to claim 9, characterized in that The animal is a mouse; preferably, the animal whose bone marrow cell lineage expresses the Cre enzyme is a LysM-Cre mouse.

12. A method for screening a potential substance for treating or preventing a macrophage-related disease, the method comprising: (1) providing a system comprising macrophages, wherein the macrophages express CREBZF; (2) adding the candidate substance to the system of (1) and observing its effect on the system; If it can specifically inhibit the expression or activity of macrophage CREBZF, the candidate substance is a potential substance for treating or preventing macrophage-related diseases; Wherein, the macrophage-related diseases include: adipose tissue inflammation, adipose tissue macrophage infiltration diseases, and glycolipid metabolism diseases.

Images