Phage for enriching and separating environmental endocrine disrupter and preparation method thereof
By inserting Spy-tag on the phage P8 protein and inserting Spy-catcher into the nuclear receptor, the nuclear receptor is displayed on the phage surface, the problem of low concentration of EDCs in environmental samples is solved, and the efficient enrichment of EDCs is achieved and Separation improves detection sensitivity.
Patent Information
- Application Number
- CN202411618525.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-13
- Publication Date
- 2025-02-18
AI Technical Summary
The concentration of environmental endocrine disruptors (EDCs) in environmental samples is too low, making it difficult to detect effectively, and requires enrichment and isolation.
By inserting Spy-tag before phage P8 protein and inserting Spy-catcher into the nuclear receptor, the nuclear receptor is displayed to the phage surface by using the covalent bond of Spy-tag to Spy-catcher, thereby capturing and enriching the environment EDCs in the sample.
Since there are about 2700 copies of the phage P8 protein, the coupled nuclear receptors on a single phage are theoretically the same number, which achieves efficient enrichment and separation of EDCs and improves the detection sensitivity.
Smart Images
Figure CN119464227A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and particularly relates to a bacteriophage for enriching and separating environmental endocrine disruptors and a preparation method thereof. Background Art
[0002] Environmental endocrine disruptors (EDCs) refer to exogenous chemical substances that are released into the environment due to human production and life, affecting the normal hormone levels in humans and animals. When they enter a living organism, the endocrine system in the body will mistake them for natural hormones and absorb them, occupying the position of normal hormones in cells, thereby causing endocrine disorders and causing abnormal regulation of normal hormones in living organisms, which manifests in developmental disorders, reproductive abnormalities, organ lesions, etc. Therefore, it is necessary to control environmental endocrine disruptors, and the premise of control is detection. The environmental concentration of EDCs is low, and enrichment and separation are required before detection.
[0003] In organisms, EDCs mainly bind to nuclear receptors to produce adverse health effects. Therefore, based on the specific binding of EDCs to nuclear receptors, nuclear receptors can be used to capture EDCs. Since the concentration of EDCs in environmental samples is too low, in practical applications, it is often necessary to increase the number of nuclear receptors to capture more EDCs in order to improve the sensitivity of detection.
[0004] Bacteriophages are a class of viruses that infect bacteria. They are widely found in nature, especially in water, soil, and animal intestines. They also play an important role in molecular biology research and have potential applications in biotechnology and medicine. Bacteriophages are microorganisms composed of nucleic acids and proteins. Among them, proteins not only protect nucleic acids, but also determine the shape and surface characteristics of bacteriophages.
[0005] The nucleic acid type of a phage can be DNA or RNA, and it can be double-stranded or single-stranded, and circular or linear. Filamentous phages are a type of phage that are shaped like elongated filaments, usually between 800 and 1000 nanometers in length and about 6 to 7 nanometers in diameter, and contain single-stranded circular DNA as their genetic material. The life cycle of filamentous phages is continuous, they replicate inside the host cell and are secreted through the cell wall without causing lysis of the host cell. This means that the host bacteria can continue to grow and divide during the infection. M13 phage is a filamentous phage that is about micrometers in length and 6 nanometers in diameter. The core is a single-stranded DNA (ssDNA) that is wrapped in a protein tube consisting of the major coat protein P8 (about 2700 copies). In addition, there are 5 copies of P3 and P6 proteins at one end of the phage, forming the "head" of the phage, and 5 copies of P7 and P4 proteins at the other end, forming the "tail" of the phage. These are called microcapsid proteins. The M13K07 phage has a kanamycin resistance gene inserted into the genome of the M13 phage. The protein encoded by this gene enables the host bacteria to grow in a culture medium containing kanamycin. The introduction of this resistance gene helps to select and maintain host bacteria containing the M13K07 phage in the laboratory.
[0006] Phage display technology is a technology that connects exogenous peptides or proteins to their genotypes. Through this technology, specific peptides or proteins can be displayed on the surface of filamentous phages. Filamentous phages such as M13K07 phage have multiple copies of protein shells (P3 or P8) on their surfaces. These proteins can be genetically engineered to carry exogenous peptide or protein sequences. Phage display technology is widely used in various fields, such as antibody engineering, protein-small molecule interaction research, drug development, vaccine development, etc. The P8 protein of M13 phage has about 2700 copies. If nuclear receptors can be coupled to the P8 protein, then the nuclear receptors will also have about 2700 copies, which can capture a large number of EDCs, thereby achieving the enrichment of EDCs. Summary of the invention
[0007] The purpose of the present invention is to solve the problem of enrichment and separation required due to too low concentration of EDCs when detecting EDCs in environmental samples. Spy-tag is inserted in front of the bacteriophage P8 protein, and Avi-tag is inserted in front of the P3 protein. At the same time, Spy-catcher is inserted into the nuclear receptor expressed in Escherichia coli. The Spy-tag on the bacteriophage P8 protein forms a covalent bond with the Spy-catcher on the nuclear receptor, so that the nuclear receptor is displayed on the surface of the bacteriophage, so that the nuclear receptor captures the endocrine disrupting substances in the environmental sample. Since the bacteriophage P8 protein has about 2700 copies, the nuclear receptors coupled to a single bacteriophage theoretically have the same number, so the endocrine disrupting substances in the sample can be enriched and separated in large quantities.
[0008] The objective of the present invention is achieved through the following technical solutions: as a first aspect, the present invention provides a method for preparing a bacteriophage for enriching and separating environmental endocrine disruptors, inserting a Spy-tag in front of a bacteriophage P8 protein and an Avi-tag in front of a bacteriophage P3 protein to obtain a modified bacteriophage; infecting Escherichia coli with the modified phage to replicate the phage, and fusion-expressing the Spy-tag and Avi-tag through the P8 and P3 proteins; inserting a Spy-catcher into a nuclear receptor expressed in Escherichia coli; connecting the Avi-tag of the bacteriophage P3 protein to a streptavidin-biotin complex, forming a covalent bond between the Spy-tag and the Spy-catcher of the nuclear receptor, and coupling the nuclear receptor to the surface of the phage particles to form an enrichment and separation system for endocrine disruptors.
[0009] In the above method, the modified phage is a filamentous phage, which can replicate in the host cell and be secreted through the cell wall without causing host cell lysis.
[0010] Preferably, the bacteriophage is M13 phage.
[0011] In the above method, the Escherichia coli is a strain designed to express and replicate bacteriophages, including XL1-Blue, JM109, TG1, etc.
[0012] Furthermore, the Avi-tag of the bacteriophage P3 protein is connected to the streptavidin-biotin complex by biotinylating the Avi-tag under the action of biotin ligase, and mixing the bacteriophage connected with the Avi-tag with streptavidin magnetic beads so that streptavidin and biotin are combined to form a streptavidin-biotin complex.
[0013] Furthermore, the Spy-catcher is inserted into the nuclear receptor expressed in E. coli, specifically: the ligand binding domain of the nuclear receptor and the Spy-catcher gene are amplified and subcloned into a plasmid, the plasmid is transferred into E. coli for expression, the cells are lysed after the E. coli is amplified, the protein is purified, and the obtained protein is verified to be the target protein. The nuclear receptor is artificially synthesized.
[0014] Furthermore, the method for transferring the plasmid into Escherichia coli is heat shock method, the method for lysing cells is ultrasonic disruption, the method for purifying proteins is nickel column affinity chromatography, and the method for verifying proteins is SDS-PAGE gel electrophoresis.
[0015] In the above method, the Spy-tag is designed with a DNA sequence, which contains the coding sequence of the Spy-tag, followed by an appropriate linker sequence, and then the coding sequence of the P8 protein. The Spy-tag is inserted in front of the bacteriophage P8 protein as follows: the Spy-tag sequence and the P8 protein sequence are cloned into a vector, connected by restriction endonucleases and ligases, and inserted into an expression vector. The method of inserting the Avi-tag into the P3 protein is the same as the idea of inserting the Spy-tag into the P8 protein, specifically: the Avi-tag sequence and the P3 protein sequence are cloned into a vector, connected by restriction endonucleases and ligases, and inserted into an expression vector. Afterwards, the constructed expression vector is transformed into Escherichia coli for expression and amplification.
[0016] In the above method, the Spy-tag DNA sequence (SEQ ID NO.14):
[0017] GCACACATTGTCATGGTGGACGCTTATAAACCTACTAAG; Avi-tag DNA sequence (SEQ ID NO. 15): GGCCTGAATGATAATTTTTGAAGCCCAAAAAATTGAATGGCACGAA.
[0018] Furthermore, the molar ratio of the nuclear receptor to the phage is greater than or equal to 2800:1, so that the reaction can proceed fully.
[0019] As a second aspect, the present invention also provides a bacteriophage prepared by the above-mentioned method for preparing bacteriophage for enriching and separating environmental endocrine disruptors.
[0020] As a third aspect, the present invention also provides a use of the above-mentioned bacteriophage in enriching and separating environmental endocrine disruptors.
[0021] The beneficial effects of the present invention are as follows:
[0022] When the present invention is used to detect EDCs in environmental samples, since there are about 2700 copies of the bacteriophage P8 protein, the nuclear receptors coupled to a single bacteriophage theoretically have the same number, so endocrine disrupting substances in the sample can be enriched and separated in large quantities.
[0023] Nuclear receptors can specifically bind to endocrine disruptors. Nuclear receptors usually have a specific ligand binding domain (LBD), which can recognize and bind to specific ligands.
[0024] The life cycle of M13 filamentous phage is continuous. They replicate inside host cells and are secreted through the cell wall without causing host cell lysis, allowing host bacteria to continue to grow and divide during infection. Filamentous phages are long and have a large surface area. Nuclear receptors are evenly coupled to the surface of the phage, making the space utilization rate higher when nuclear receptors bind to endocrine disrupting substances.
[0025] In the enrichment and separation system of endocrine disrupting substances, the Avi-tag of the P3 protein reacts with biotin under the action of biotin ligase, binding the phage to the streptavidin-biotin complex, where streptavidin is a tetrameric protein and the complex formed by each subunit and biotin is very stable.
[0026] A key advantage of the Spy-catcher system is its specificity and stability. Due to the formation of covalent bonds, this connection is more stable in the cellular environment and is not easily destroyed by enzymatic or other chemical processes. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 It is a schematic diagram of the genetically modified M13 bacteriophage;
[0028] Figure 2 is a schematic diagram of the assembly enrichment and separation system;
[0029] Figure 3 Schematic diagram of capturing environmental endocrine disruptors using an enrichment and separation system. DETAILED DESCRIPTION
[0030] In the following examples, unless otherwise specified, the technical means used are conventional means well known to those skilled in the art.
[0031] In the following examples, unless otherwise specified, the reagents, methods and equipment used are conventional reagents, methods and equipment in the art.
[0032] In order to facilitate the understanding of the present invention, a more detailed description is given below in conjunction with specific embodiments, but it should not be understood as limiting the present invention. Among them, the drawings of the present invention are all drawn by Figdraw.
[0033] Example 1: Preparation of bacteriophage for enrichment and isolation of environmental endocrine disruptors
[0034] 1. Modifying the phage genome
[0035] 1. The design map is named: M13K07-avi-spy;
[0036] 2. Extract the M13K07 genome using plasmid-derived phages;
[0037] 3. Using M13K07-F and R1 as primers and M13K07 genome as template, the amplified product was named P1;
[0038] 4. Use primers F2, R2, F3, R3, F4, and R4 to splice and obtain a product named P2;
[0039] 5. F5 and M13K07-R were used as primers, the phage genome was used as template, and the amplified product was named P3;
[0040] 6. Use M13K07-F and M13K07-R as primers and amplify products P1, P2, and P3 as templates to obtain the full-length product P-full;
[0041] 7. Double digest the phage genome and P-full with Snab I and BamH I, separate by agarose gel electrophoresis, and recover the gel using a kit;
[0042] 8. Ligate the digested genome and product using T4 ligase;
[0043] 9. Transform E. coli TG1 with the ligation product, pick a single clone for sequencing, and confirm that the sequence is correct; use the clone with the correct sequence to prepare phage.
[0044] Table 1 Primer design sequences
[0045]
[0046] 2. Biotinylated phage
[0047] 1. Transfer the biotin ligase plasmid into TG1 (the ligase plasmid can be purchased externally);
[0048] 2. Cultivate TG1 to the logarithmic growth phase;
[0049] 3. Infect TG1 with the modified helper phage (i.e., the modified M13K07 phage in the previous section);
[0050] 4. After shaking culture at 37°C and 80 rpm for 2 h, spread on 2YT / kan / biotin resistance plates and culture overnight;
[0051] 5. Pick a single colony from the resistance plate into 2YT / biotin liquid medium and culture overnight at 37°C and 220 rpm;
[0052] 6. The next day, centrifuge the culture medium at 10,000 rpm at 4°C for 20 minutes. Transfer the supernatant to a fresh tube and add 1 / 5 volume of PEG8000 / NaCl solution (which needs to be autoclaved and pre-cooled in advance) to precipitate the phage particles, and incubate on ice for 1 hour;
[0053] 7. Centrifuge at 10,000 rpm at 4°C for 20 minutes and discard the supernatant. Remove the remaining supernatant with a micropipette. Add 1 / 20 volume of PBS to resuspend the phage pellet;
[0054] 8. After amplification and purification, the phages were packaged and stored at -80°C;
[0055] 9. When measuring the titer, you can do a plaque assay or count the clones after infection.
[0056] 3. Preparation of Nuclear Receptors (This Example Takes Estrogen Receptor as an Example)
[0057] 1. Design recombinant plasmids. Amplify the ligand binding domain (residues 125-444) of human estrogen receptor ERα and the spy-catcher gene and subclone them into the pCold trigger factor (TF) vector;
[0058] Table 2 Gene sequences
[0059]
[0060] 2. Prepare competent TG1. Culture TG1 to the logarithmic growth phase, and subsequent operations must be performed in an ice bath. After centrifugation at 4°C and 4000rpm, discard the supernatant, resuspend in a sterilized 0.1mol CaCl2 solution, and place in an ice bath for 30mins. Repeat this step at least once, centrifuge and resuspend repeatedly to wash the cells. After the last wash, resuspend TG1 in a sterilized 0.1mol CaCl2+15% Glycerol solution. At this time, TG1 opens the cell wall and is in a chemically competent state;
[0061] 3. Use the heat shock method to transfer the recombinant plasmids pCold-His-TF-ERα and pCold-His-TF into TG1. Add 1-5μl of 1ng / μl pre-cooled plasmid to 50μl of competent TG1 solution and mix gently. Place the mixture of TG1 and plasmid on ice for 30 minutes. After the time is up, place the competent TG1 mixture in a 42℃ water bath for heat shock for 30 seconds. Immediately take it out and place it on ice, add 450μl of culture solution, and culture it on a shaker at 37℃ and 225rpm for 1 hour to allow the cells to recover. Under sterile conditions, pipette an appropriate amount of bacterial solution onto a solid culture plate containing resistance and spread it evenly, then invert and culture it at 37℃ overnight. Calculate the transformation efficiency, transformation efficiency = amount successfully transferred / total amount of DNA;
[0062] 4. Induce protein. After culturing the TG1 with the recombinant plasmid inserted to the logarithmic growth phase, add IPTG stock solution to a final concentration of 0.2mmol under sterile conditions to induce expression. To ensure protein folding, culture overnight at 18°C, 120rpm for 16-18h;
[0063] 5. Ultrasonicate the E. coli to obtain protein. Harvest the bacteria, mix well and retain 1 mL. Centrifuge at 4°C and 14,000 rpm for 30 minutes. After centrifugation, take the precipitate. For the bacterial mass harvested from 1L of culture medium, add 20-40 ml of buffer to the centrifuge tube, and then add lysozyme to degrade the cell wall and assist in cell lysis. Mix and resuspend the cells, and use an ultrasonic disruptor to lyse the cells. After completion, transfer the lysate to a 50 ml centrifuge tube and centrifuge at 4°C and 15,000 rpm for 30 minutes. The insoluble cell fragments will aggregate at the bottom. Pour out the supernatant and take the soluble portion, and filter out other impurities through a 0.45 μm syringe filter;
[0064] 6. Purify and verify the protein. The nuclear receptor was purified by nickel column affinity chromatography, and the target protein was verified by SDS-PAGE gel electrophoresis.
[0065] 4. Assembling the Enrichment and Separation System
[0066] 1. Use BirA enzyme to catalyze the biotinylation of Avi-tag on phage in vitro. Purchase the Avi-Tag fusion protein biotinylation kit and perform the incubation reaction according to the experimental steps of the kit to fully biotinylate the substrate. The biotin-labeled phage is mixed with streptavidin magnetic beads. The affinity between streptavidin and biotin is very strong, and the biotinylated phage will quickly and firmly bind to the streptavidin on the magnetic beads;
[0067] 2. The Spy-tag on the phage and the Spy-catcher on the estrogen receptor protein are connected by spontaneously formed isopeptide bonds. The molar ratio of estrogen receptor protein to phage is greater than or equal to 2800:1. Mix and react at room temperature for 1 hour. Use a magnet to attract and gather the magnetic beads on the side or bottom of the container, and absorb the remaining solution.
[0068] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.
Claims
1. A method for preparing bacteriophages for enriching and separating environmental endocrine disruptors, characterized in that: A Spy-tag is inserted in front of a bacteriophage P8 protein, and an Avi-tag is inserted in front of a bacteriophage P3 protein to obtain a modified bacteriophage; the modified bacteriophage is used to infect Escherichia coli so that the bacteriophage is replicated, and the P8 and P3 proteins are fused to express the Spy-tag and the Avi-tag; a Spy-catcher is inserted into a nuclear receptor expressed in the Escherichia coli; the Avi-tag of the bacteriophage P3 protein is connected to a streptavidin-biotin complex, the Spy-tag forms a covalent bond with the Spy-catcher of the nuclear receptor, and the nuclear receptor is coupled to the surface of the bacteriophage particles to form an enrichment and separation system for endocrine disruptors.
2. The method for preparing bacteriophage for enriching and separating environmental endocrine disruptors according to claim 1, characterized in that: The method of connecting the Avi-tag of the bacteriophage P3 protein with the streptavidin-biotin complex specifically comprises: biotinylating the Avi-tag under the action of biotin ligase, mixing the bacteriophage connected with the Avi-tag with streptavidin magnetic beads, so that the streptavidin and biotin are combined to form a streptavidin-biotin complex.
3. The method for preparing bacteriophage for enriching and separating environmental endocrine disruptors according to claim 1, characterized in that: The Spy-catcher is inserted into the nuclear receptor expressed in Escherichia coli, specifically: the ligand binding domain of the nuclear receptor and the Spy-catcher gene are amplified and subcloned into a plasmid, the plasmid is transferred into Escherichia coli for expression, the cells are lysed after Escherichia coli amplification, the protein is purified, and the obtained protein is verified to be the target protein.
4. The method for preparing bacteriophage for enriching and separating environmental endocrine disruptors according to claim 3, characterized in that: The plasmid was transformed into Escherichia coli using a heat shock method, the cells were lysed using ultrasonic disruption, the protein was purified using a nickel column affinity chromatography method, and the protein was verified using SDS-PAGE gel electrophoresis.
5. The method for preparing bacteriophage for enriching and separating environmental endocrine disruptors according to claim 1, characterized in that: The bacteriophage is M13 bacteriophage.
6. The method for preparing bacteriophage for enriching and separating environmental endocrine disruptors according to claim 1, characterized in that: The inserting of Spy-tag in front of the bacteriophage P8 protein is specifically: cloning the Spy-tag sequence and the P8 protein sequence into a vector, connecting them by restriction endonuclease and ligase, and inserting them into an expression vector; the inserting of Avi-tag in front of the bacteriophage P3 protein is specifically: cloning the Avi-tag sequence and the P3 protein sequence into a vector, connecting them by restriction endonuclease and ligase, and inserting them into an expression vector.
7. The method for preparing bacteriophage for enriching and separating environmental endocrine disruptors according to claim 1, characterized in that: The molar ratio of the nuclear receptor to the phage is greater than or equal to 2800:1, so that the reaction can proceed fully.
8. A bacteriophage prepared by the method for preparing bacteriophage for enriching and separating environmental endocrine disruptors according to any one of claims 1 to 7.
9. Use of the bacteriophage according to claim 8 in enriching and separating environmental endocrine disruptors.