African swine fever virus replication-deficient strain as well as preparation method and application thereof

Abstract

The invention discloses an African swine fever virus replication-deficient strain as well as a preparation method and application thereof, and belongs to the technical field of African swine fever viruses. The African swine fever virus replication-deficient strain is obtained by fusing escherichia coli dihydrofolate reductase on p54 protein of African swine fever virus, the nucleotide sequence of the escherichia coli dihydrofolate reductase is as shown in SEQ ID No.1, and the African swine fever virus is an ASFV CN / GS 2018 strain. The African swine fever virus replication-deficient strain is obtained by fusing an unstable structural domain onto a p54 protein, degradation of the p54 protein is regulated and controlled by using a micromolecular ligand trimethoprim, so that replication and proliferation of the virus are regulated and controlled, and the strain has important application values in the aspects of reducing virus toxicity, enhancing vaccine safety, promoting vaccine research and development and the like.

Description

Technical Field

[0001] The present invention belongs to the technical field of African swine fever virus, and specifically relates to a replication-deficient strain of African swine fever virus and a preparation method and application thereof. Background Art

[0002] African swine fever virus (ASFV) is a highly contagious and lethal virus that poses a huge threat to the global pig industry. The development of an effective vaccine is key to controlling the spread of the virus. ASFV enters host cells via receptor-mediated endocytosis, a process that requires dynein, which the virus uses to promote internalization and intracellular trafficking. p54 interacts with dynein, thereby promoting ASFV infection. p54 is a transmembrane protein encoded by the E183L gene, which contains 1 transmembrane domain and a homodimeric structure bound by disulfide bonds. The 13 amino acid domain of p54 binds to the cytoplasmic dynein light chain LC8 to form a transmembrane domain that participates in viral replication. During viral replication, the interaction between LC8 and p54 protein allows the virus to exploit host cells to promote viral trafficking and replication. Therefore, the p54 protein is critical in the early stages of ASFV infection.

[0003] The current focus of vaccine research is to obtain attenuated African swine fever strains by knocking out virulence genes, immunosuppressive genes, etc. The strains used in vaccine preparation often need to be considered to be both immunogenic and have reduced pathogenicity so that the immune host can obtain immune protection. In the prior art, different genotypes use the same gene deletion strategy, resulting in different pathogenicity and induced immune protection effects; incomplete gene deletion may cause immune side effects; deleting some genes may cause the virus to be unable to replicate; excessive attenuation caused by multiple gene deletions will cause the attenuated strain to lose its immune protection. Summary of the invention

[0004] In response to the above-mentioned prior art, the present invention provides a replication-deficient strain of African swine fever virus and a preparation method and application thereof, so as to solve the problem that the African swine fever virus vaccine in the prior art cannot take into account both the virulence and safety of the virus.

[0005] In order to achieve the above-mentioned purpose, the technical solution adopted by the present invention is: to provide an African swine fever virus replication-deficient strain, the African swine fever virus replication-deficient strain is a fusion of Escherichia coli dihydrofolate reductase on the p54 protein of African swine fever virus, and the nucleotide sequence of Escherichia coli dihydrofolate reductase is shown in SEQ ID No.1.

[0006] The beneficial effects of the above technical solution adopted by the present invention are: the destabilizing domain (DD) is a protein region that can bind to a small molecule ligand, and the stability of this protein is controlled by forming a fusion protein with a protein of interest (POI). In the absence of a small molecule ligand, the fusion protein formed by DD and DD will be degraded by the proteasome; in the presence of a small molecule ligand, the small molecule ligand will bind to DD to stabilize the fusion protein and prevent it from being degraded by the proteasome, so that this protein can function normally. Escherichia coli dihydrofolate reductase (ecDHFR) is a DD that can be stabilized by the small molecule inhibitor trimethoprim (TMP). This system is a regulatory system at the post-translational level of protein. Compared with the regulatory system at the DNA or RNA transcription level, it has more direct and rapid action characteristics, and this regulatory system has reversibility and dose-dependent effects. In addition, TMP is a low-cost, stable, and almost non-toxic small molecule. It is also a commonly used antibiotic in clinical practice. It can penetrate the blood-brain barrier and the placental barrier and is suitable for in vivo experiments. The p54 structural protein encoded by the E183L gene of the African swine fever virus mediates the invasion of the virus and is an important component protein of the virus factory outside the cell nucleus. DD was fused to the p54 protein, and the small molecule TMP was used to regulate the degradation of the p54 protein to control the proliferation of virus particles, thus obtaining a replication-deficient strain of the African swine fever virus.

[0007] Based on the above technical solution, the present invention can also be improved as follows.

[0008] Furthermore, the African swine fever virus is the ASFV CN / GS2018 strain.

[0009] Furthermore, E. coli dihydrofolate reductase was fused to the C-terminus of p54 protein.

[0010] Furthermore, a fluorescent protein was fused to the p54 protein.

[0011] Furthermore, the method for preparing the replication-deficient strain of African swine fever virus comprises the following steps:

[0012] (1) constructing a donor vector for homologous recombination, wherein the donor vector comprises left and right homologous arms of the upstream and downstream sequences of the terminator of the E183L gene encoding the p54 protein and a nucleotide sequence corresponding to the protein fused to the p54 protein between the homologous arms;

[0013] (2) infecting host cells with African swine fever virus;

[0014] (3) Transfecting the donor vector obtained in step (1) into the host cell obtained in step (2) to screen for African swine fever replication-deficient strains.

[0015] Furthermore, in step (1), the proteins fused to the p54 protein are Escherichia coli dihydrofolate reductase and fluorescent protein.

[0016] Furthermore, in step (3), African swine fever replication-deficient strains are screened by adding or not adding trimethoprim.

[0017] Furthermore, the use of replication-deficient strains of African swine fever virus in the preparation of African swine fever vaccines.

[0018] The beneficial effects of the present invention are: first, by limiting the replication ability of ASFV, the virulence of the virus is effectively reduced, the pathological damage to the host is reduced, and the safety of the vaccine is enhanced. Secondly, the replication-deficient strain of African swine fever virus reduces the risk of virus mutation, limits the replication and mutation of the virus, and reduces the possibility of the virus escaping the host immune response. At the same time, the present invention will also promote the development of vaccines, especially for those viruses that are difficult to develop vaccines with traditional methods. Provide a new research strategy. In addition, replication-deficient virus strains can be used as an important tool for studying viral replication mechanisms, host interactions, and viral pathogenicity, which helps to deeply understand the vulnerable links in the virus life cycle and provide potential targets for the development of antiviral drugs. Finally, the replication-deficient strain of African swine fever virus can be used to prepare safe and effective antigens for establishing and optimizing the serological diagnosis method of ASFV. In short, the method of regulating the replication of African swine fever virus by destabilizing the structural domain has important application potential and research value in reducing viral virulence, enhancing vaccine safety, and promoting vaccine development. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the construction of the p54-GFP-DD ASFV CN / GS / 2018 recombinant strain;

[0020] Figure 2 To detect the purity of the p54-GFP-DD ASFV CN / GS / 2018 recombinant strain;

[0021] Figure 3 This is the cell fluorescence after the p54-GFP-DD ASFV CN / GS / 2018 recombinant strain infected BMDM cells;

[0022] Figure 4 Shown are the growth curves of different ASFV strains. DETAILED DESCRIPTION

[0023] The specific implementation modes of the present invention are described in detail below with reference to the embodiments.

[0024] Example 1: Construction of a donor vector for homologous recombination

[0025] The donor vector for homologous recombination was constructed using the Gibson molecular cloning strategy, which contains the left and right homologous arms upstream and downstream of the E183L gene terminator and the GFP-3×FLAG-DD element fused to the E183L gene between the homologous arms. These elements were cloned into the pUC19 vector to obtain the donor vector for homologous recombination. The donor vector and the construction diagram are shown in Figure 1 The nucleotide sequences corresponding to DD, 3×FLAG and GFP are shown in SEQ ID No. 1 to SEQ ID No. 3, and the nucleotide sequence inserted into the pUC19 vector is shown in SEQ ID No. 4. The specific construction steps are as follows:

[0026] First, the ASFV genome was used as a template, and the left and right homologous arms before and after the E183L gene terminator and the prokaryotic skeleton of the pUC19 vector were amplified by PCR using Q5 high-fidelity enzyme. The first 1029bp in the sequence shown in SEQ ID No.4 was the left homologous arm (LA), and the last 1020bp was the right homologous arm (RA). The three fragments were connected using the Gibson method to construct an intermediate vector with only homologous arms and prokaryotic skeletons, wherein PacI and BamHI restriction sites were left between the left and right homologous arm vectors. After sequencing confirmed that the vector was successfully constructed, the intermediate vector was digested with PacI and BamHI, and then the GFP-3×FLAG-DD element was amplified by PCR. Using the Gibson method, the two fragments were connected to the intermediate vector skeleton that was digested with PacI and BamHI and purified by gel recovery, thereby obtaining a donor vector for homologous recombination.

[0027] The reaction system for PCR amplification using Q5 high-fidelity enzyme is shown in Table 1:

[0028] Table 1 Reaction system for Q5 high-fidelity enzyme PCR amplification

[0029]

[0030] The reaction program for PCR amplification using Q5 high-fidelity enzyme is shown in Table 2:

[0031] Table 2 Reaction procedure for Q5 high-fidelity enzyme PCR amplification

[0032]

[0033] The Gibson connection system is shown in Table 3:

[0034] Table 3 Gibson connection system

[0035]

[0036]

[0037] The Gibson reaction procedure is shown in Table 4:

[0038] Table 4 Gibson connection procedure

[0039]

[0040] Example 2: Obtaining the p54-GFP-DD ASFV CN / GS / 2018 recombinant strain

[0041] Bone marrow macrophages (BMDM) from healthy SPF Bama miniature pigs aged 2 to 4 months were selected and inoculated with ASFV CN / GS / 2018 strain (MOI = 1.0). About 4 hours after inoculation, the medium was replaced with 1640 medium containing 10% FBS (the amount of medium was halved); the homologous recombination donor vector prepared in Example 1 and -Macrophage DNA transfection reagent was fully mixed and transfected into BMDM cells. After 4 hours of transfection, the medium was replaced with 1640 medium containing 1 μM TMP and 10% (v / v) FBS (the addition of TMP will ensure the stable presence of p54 protein, and TMP will be added in subsequent purification to ensure viral activity). A small number of GFP-positive cells can be observed 24 hours after transfection. The GFP-positive cells were digested and collected, resuspended in a small amount of culture medium, and then added dropwise to a new culture dish. After the cells settled, single fluorescent cells in the transfection wells were selected under a fluorescence microscope and transferred to a 96-well plate. Subsequently, the cells were frozen and thawed twice at -80°C and inoculated into a monolayer of BMDM cells in a 96-well plate. After 24 hours of culture, if fluorescent cells were observed, it indicated that the recombinant virus was successfully constructed. 72 hours after virus inoculation, single cells were picked again from the positive wells, and the recombinant viruses in the remaining positive wells were frozen and thawed twice at -80°C and divided into two parts. One part was inoculated into BMDM cells pre-laid in a 96-well plate and treated at 75°C for 30 minutes to inactivate the virus. The ASFV viral genomic DNA was extracted using the Quick-DNA Viral DNA kit from Zymo Research according to the product instructions, and PCR detection was performed, and the PCR product was detected by agarose gel electrophoresis; the other part was frozen for later amplification.

[0042] The specific PCR detection method is as follows: Use a pair of cross-target primers to detect whether the exogenous GFP-3×FLAG-DD element is integrated in front of the E183L gene terminator. The primer sequences used are as follows:

[0043] Primer 3029: 5′-AGTGTTTCACACCTGAGGAGAAG-3′ (SEQ ID No. 5);

[0044] Primer 3030: 5'-ATCAAGATCAGCAGTGGGTAGAA-3' (SEQ ID No. 6).

[0045] PCR was performed using the Promega GoTaq enzyme system. Each PCR amplification system was 25 μL, as follows:

[0046] Table 5 GoTaq enzyme PCR amplification system

[0047]

[0048] The PCR reaction procedure is as follows:

[0049] Table 6 GoTaq enzyme PCR amplification reaction program

[0050]

[0051]

[0052] If there is no integration, the PCR product will only have a 625bp band in gel electrophoresis, and if an integration event occurs, a 1926bp band will appear in the gel electrophoresis test results; if the virus is not purified, both bands will appear, and if the purification is complete, only a 1926bp band will appear. Since small bands are easier to obtain during PCR, this method will make it easier to distinguish recombinant virus strains that are purified and free of wild ASFV.

[0053] By picking GFP-positive cells and combining with the limiting dilution method, 6 virus strains were obtained at the 5th generation. PCR detection was performed using the above primers 3029 and 3030. The results are as follows Figure 2 As shown, three pure p54-GFP-DD ASFV CN / GS / 2018 recombinant virus strains containing the destabilizing domain DD were found, and their corresponding numbers were F5#2, F5#3 and F5#4.

[0054] The purified strain p54-GFP-DD ASFV F5#2 was blindly cultured, and 100 TCID 50 The virus particles were inoculated into BMDM cells in 2 wells of a 12-well plate, and the venom was removed 2 h after inoculation. After washing twice with PBS buffer, normal 1640 culture medium was added to one well and 1640 culture medium containing 1 μM TMP was added to the other well for about four days of culture and observation.

[0055] The cell status and fluorescence were observed by fluorescence microscopy. Figure 3 As shown, compared with the wells with TMP added, there are very few GFP-positive cells in the wells without TMP added, and there are still many cells that have not undergone pathological changes; while in the wells with TMP added, there are many GFP-positive cells, and almost all cells have undergone pathological changes, indicating that the pure strain p54-GFP-DD ASFVF5#2 is a replication-deficient strain of African swine fever virus, and its replication and proliferation can be regulated by TMP.

[0056] Example 3: Growth curve detection of African swine fever virus

[0057] The growth curves of ASFV CN / GS / 2018 strain and p54-GFP-DD ASFV CN / GS / 2018 recombinant strain were detected. The specific steps are as follows:

[0058] First, bone marrow-derived macrophages (BMDM) were prepared in 96-well plates, and the cells were infected with the ASFV CN / GS / 2018 strain and the p54-GFP-DD ASFV F5#2 recombinant strain (MOI=0.01) prepared in Example 2, respectively, and the groups with 1 μM TMP and without TMP were set. After adsorption at 37°C for 1 hour, the supernatant was removed and the cells were rinsed twice with PBS buffer. Fresh 1640 medium was then added, and the cells were cultured at 37°C and 5% CO2. Virus samples cultured for 2h, 24h, 48h, 72h and 96h were collected, and the cells were frozen (-80°C) and thawed twice to lyse the virus, and then the content of ASFV virus in the virus samples at different times was determined by absolute quantitative method.

[0059] The results are as follows Figure 4 As shown in the figure, WT ASFV represents the ASFV CN / GS / 2018 strain. For the ASFV CN / GS / 2018 strain, the addition of TMP will not affect the proliferation of the ASFV virus. For the p54-GFP-DD ASFV recombinant strain, under the condition of adding TMP drugs, the proliferation of the recombinant strain is the same as that of the ASFV CN / GS / 2018 strain, and without the addition of TMP drugs, the recombinant strain hardly proliferates. The above results show that TMP can significantly regulate the stability of p54 protein, thereby regulating the replication and proliferation of ASFV virus, and successfully obtain the replication-deficient strain of African swine fever virus.

[0060] The nucleotide sequence of ecDHFR is:

[0061] 5’-TTAGCGGCGCTCCAGGATCTCGAAGCAGTAGCTGTGGCTGTTCTGGGCGTCGGC GTCGTGGAACTCGCTGAACACGCTCTCCCAGTCGTCGGGCTCGTAGTCGGGGAAGTGGGTGTCGCCCTCCACCTCGGCGTCGATGTGGGTCAGGTACAGCTTCTGGGCCTTGGGCAGGAACTGCTCGATCACGCGGCCGCCGCCGATCACCATGATCTCGGGCACGTCGCCGCAGGCGGCGATGGCCTCGTCCACGCTCTTCACCCAGGTCACGCGGTCGTCGGTGCCGGGCTGGCTGCTCAGGATGATGTTCTTGCGGCCGGGCAGGGGGCGGCCGATGCTCTCCCAGGTGTGGCGGCCCATGATCACGGGCTTGTTCAGGGTGTTGCGCTTGAACCAGGCCAGGTCGGCGGGCAGGTTCCAGGGCATGGCGTTCTCCATGCCGATCACGTAGTCCACGGCCAGGGCGGCGATCAGGCTGAT-3’(SEQ ID No.1).

[0062] The nucleotide sequence of 3×FLAG is:

[0063] 5’-CTTATCGTCATCGTCTTTGTAATCAATATCATGATCCTTGTAGTCTCCGTCGTGGTCCTTATAGTC-3’(SEQ ID No.2).

[0064] The nucleotide sequence of GFP is:

[0065] 5’-CTTGTACAGCTCGTCCATGCCGAGAGTGATCCCGGCGGCGGTCACGAACTCCAG CAGGACCATGTGATCGCGCTTCTCGTTGGGGTCTTTGCTCAGGGCGGACTGGGTGCTCAGGTAGTGGTTGTCGGGCAGCAGCACGGGGCCGTCGCCGATGGGGGTGTTCTGCTGGTAGTGGTCGGCGAGCTGCACGCTGCCGTCCTCGATGTTGTGGCGGATCTTGAAGTTCACCTTGATGCCGTTCTTCTGCTTGTCGGCCATGATATAGACGTTGTGGCTGTTGTAGTTGTACTCCAGCTTGTGCCCCAGGATGTTGCCGTCCTCCTTGAAGTCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTGTCGCCCTCGAACTTCACCTCGGCGCGGGTCTTGTAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGCCTTCGGGCATGGCGGACTTGAAGAAGTCGTGCTGCTTCATGTGGTCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGTCAGGGTGGTCACGAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGCTTGCCGTAGGTGGCATCGCCCTCGCCCTCGCCGGACACGCTGAACTTGTGGCCGTTTACGTCGCCGTCCAGCTCGACCAGGATGGGCACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCAC-3’(SEQ ID No.3).

[0066] The sequences corresponding to the left and right homologous arms and DD-3×FLAG-GFP between the homologous arms are as follows. The first 1029 bp is the left homologous arm (LA), and the last 1020 bp is the right homologous arm (RA):

[0067]

[0068] Although the specific implementation of the present invention is described in detail in conjunction with the embodiments, it should not be understood as limiting the scope of protection of this patent. Within the scope described in the claims, various modifications and variations that can be made by those skilled in the art without creative work still fall within the scope of protection of this patent.

Claims

1. A replication-deficient strain of African swine fever virus, characterized in that: The African swine fever virus replication-deficient strain is obtained by fusion of Escherichia coli dihydrofolate reductase to the p54 protein of the African swine fever virus, and the nucleotide sequence of the Escherichia coli dihydrofolate reductase is shown in SEQ ID No.

1.

2. The African swine fever virus replication-deficient strain according to claim 1, characterized in that: The African swine fever virus is the ASFV CN / GS2018 strain.

3. The African swine fever virus replication-deficient strain according to claim 1 or 2, characterized in that: The E. coli dihydrofolate reductase is fused to the C-terminus of the p54 protein.

4. The African swine fever virus replication-deficient strain according to claim 3, characterized in that: The p54 protein is fused with a fluorescent protein.

5. The method for preparing the replication-deficient strain of African swine fever virus according to any one of claims 1 to 4, characterized in that: The following steps are involved: (1) constructing a donor vector for homologous recombination, wherein the donor vector comprises left and right homology arms of the upstream and downstream sequences of the E183L gene terminator encoding the p54 protein and a nucleotide sequence corresponding to the protein fused to the p54 protein according to any one of claims 1 to 4 between the homology arms; (2) infecting host cells with African swine fever virus; (3) Transfecting the donor vector obtained in step (1) into the host cell obtained in step (2) to screen for African swine fever replication-deficient strains.

6. The method for preparing a replication-deficient strain of African swine fever virus according to claim 5, characterized in that: The proteins fused to the p54 protein in step (1) are Escherichia coli dihydrofolate reductase and fluorescent protein.

7. The method for preparing a replication-deficient strain of African swine fever virus according to claim 5, characterized in that: In the step (3), African swine fever replication-deficient strains are screened by adding or not adding trimethoprim.

8. Use of the replication-deficient strain of African swine fever virus according to any one of claims 1 to 4 in the preparation of African swine fever vaccine.

Images