Protein glutaminase mutant, coding gene, recombinant vector, recombinant bacterium, preparation method and application

Abstract

The invention relates to a protein glutaminase mutant, a coding gene, a recombinant vector, a recombinant bacterium, a preparation method and application, and relates to the technical field of bioengineering, the protein glutaminase mutant has a sequence with amino acid mutation as shown in SEQ ID NO: 1, the amino acid mutation site is any one mutation site of 63W, 65I, 87A, 102S, 136M, 144P, 193S, 204F, 211V, 261F, 262G, 264L, 271V and 289M or a combination of at least two mutation sites of 63W, 65I, 87A, 102S, 136M, 144P, 193S, 204F, 211V, 261F, 262G, 264L, 271V and 289M. According to the invention, active protein glutaminase is directly generated through a double-plasmid co-expression system, a single-site mutant and a combined mutant of the protein glutaminase are constructed through site-specific mutagenesis, and the specific enzyme activity and thermal stability of the provided mutants are greatly improved; the method has important significance in improving the solubility and emulsibility of protein in food and the like, and is more beneficial to meeting the requirements of social production.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to a protein glutaminase mutant, a coding gene, a recombinant vector, a recombinant bacterium, and a preparation method and application thereof. Background Art

[0002] Protein-Glutaminase (PGase or PG for short), usually referred to as PG, has an enzyme name EC3.5.1, which is an amido-hydrolase. PG is a new type of protein glutaminase that can hydrolyze and remove the amide group of glutamine on the side chain of protein to generate glutamate. Since PG can directly catalyze the deamidation of macromolecular proteins without the need to hydrolyze the protein first, the deamidation process will not cause adverse changes in the protein structure; and it has high specificity and only acts on glutamine on the side chain of protein, but cannot deamidate asparagine. Therefore, it is called the most promising protein modification tool. For example, PG can deamidate soy protein isolate in soy protein functional beverages to increase the hydrolysis degree of soy protein isolate, thereby increasing the clarity of soy protein functional beverages without causing bad flavors; deamidation of egg white can improve the foaming property of egg white, increase the softness of the cake and reduce the amount of egg white.

[0003] Protein glutaminase consists of a leader peptide containing 114 amino acids and a mature peptide containing 185 amino acids. The role of the mature peptide is to perform the biological function of the protein. The role of the leader peptide is to assist the protease to fold correctly, affect its structure and function, and avoid the protease from misfolding or forming aggregates; in addition, it can keep the protease in an inactive state before the protease is released from the cell. Changes in the leader peptide structure may greatly change the function of the protein itself. Therefore, in order to obtain active protein glutaminase, the leader peptide must be removed. At present, trypsin, neutral protease, and alkaline protease are mostly used for cleavage, but their action time is long and the effective cleavage time is difficult to control; secondly, the specificity of these enzymes is not high. For example, trypsin acts on the peptide bond composed of arginine and lysine carboxyl groups, but there are multiple arginines and lysines on the surface of PG, especially on the mature peptide, which will lead to loss of activity. Therefore, it is particularly important to find a method to effectively cut the leader peptide. In addition, wild protein glutaminase has the disadvantages of low activity, low yield, and poor thermal stability. In view of this, the present invention provides protein glutaminase mutants, encoding genes, recombinant vectors, recombinant bacteria, and preparation methods and applications. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a protein glutaminase mutant, a coding gene, a recombinant vector, a recombinant bacterium, a preparation method and an application thereof, and the purpose is to provide a protein glutaminase mutant with high specific enzyme activity and thermal stability.

[0005] The present invention solves the above technical problems. In a first aspect, a protein glutaminase mutant is provided. The protein glutaminase mutant has a sequence in which an amino acid mutation occurs in the sequence shown in SEQ ID NO: 1, and the site where the amino acid mutation occurs is any one of 63W, 65I, 87A, 102S, 136M, 144P, 193S, 204F, 211V, 261F, 262G, 264L, 271V, and 289M, or a combination of at least two of the mutated sites.

[0006] Among them, the site 63W where the amino acid mutation occurs indicates that the glycine (G) at position 63 of the sequence SEQ ID NO:1 is mutated to tryptophan (W); the other 65I, 87A, 102S, 136M, 144P, 193S, 204F, 211V, 261F, 262G, 264L, 271V, and 289M have similar meanings and are not described one by one.

[0007] The beneficial effects of the present invention are as follows: a series of mutants are obtained by site-directed mutagenesis, and specific enzyme activity and thermal stability analysis are performed, and the sequence SEQ ID NO: 1 is modified, and it is found that amino acid mutation occurs at any mutated site among 63W, 65I, 87A, 102S, 136M, 144P, 193S, 204F, 211V, 261F, 262G, 264L, 271V, and 289M, or at least a combination of two mutated sites, to obtain protein glutaminase mutants (including single-point mutants and combined mutants), which achieve high specific activity and high thermal stability and have important application value.

[0008] Based on the above technical solution, the present invention can also be improved as follows.

[0009] Further, the protein glutaminase mutant is G63W, L65I, G87A, T102S, S144P, A193S, Y204F, T211V, S261F, Y264L, I271V / I204F, T211V / Y204F, Y204F / G63W, Y204F / L65I, Y204F / G87A, Y204F / T102S , Y204F / S144P, Y204F / A193S, I271V / T211V, T211V / Y204F / Y264L, T211V / Y204F / A193S, T211V / Y204F / A193S / G87A, T211V / Y204F / Y264L / S144P or T211V / Y204F / Y264L / L65I. For example, the protein glutaminase mutant I271V / T211V is a mutant in which the threonine at position 211 corresponding to SEQ ID NO: 1 is mutated (T) to valine (V), and the isoleucine at position 271 (I) is mutated to valine (V).

[0010] Furthermore, the protein glutaminase mutant is I271V / T211V.

[0011] The beneficial effect of adopting the above further scheme is that compared with the wild type, the I271V / T211V mutant obtained by the present invention has an enzyme activity increased by 4.14 times and a significantly improved thermal stability; therefore, the I271V / T211V mutant provided by the present invention is more conducive to meeting the needs of social production and has better utilization value in plant protein modification.

[0012] The second aspect of the present invention is to provide a coding gene, wherein the coding gene encodes any of the above-mentioned protein glutaminase mutants.

[0013] The third aspect of the present invention is to provide a recombinant plasmid, which includes a recombinant plasmid I for expressing HRV3C protease and a recombinant plasmid II connected with the above-mentioned encoding gene.

[0014] Furthermore, the plasmid vector of the recombinant plasmid I is pEVOL, and the plasmid vector of the recombinant plasmid II is pET28a.

[0015] The fourth aspect of the present invention is to provide a recombinant bacterium, comprising the above-mentioned recombinant plasmid, preferably the Escherichia coli BL21 (DE3) strain.

[0016] The fifth aspect of the present invention is to provide a method for directly preparing active protein glutaminase, comprising the following steps:

[0017] (1) preparing the recombinant plasmid I and the recombinant plasmid II as described above, and transforming the recombinant plasmid I and the recombinant plasmid II into a host to obtain the recombinant bacteria as described above;

[0018] (2) inducing the recombinant bacteria with an inducer to obtain bacterial cells containing the recombinant plasmid I and the recombinant plasmid II expressed intracellularly, and disrupting the bacterial cells to obtain a crude enzyme solution;

[0019] (3) separating and purifying the crude enzyme solution to obtain the protein glutaminase mutant.

[0020] Among them, HRV3C protease (recombinant) is a recombinant protease modified by genetic engineering. This protease specifically recognizes the eight-amino acid sequence of Leu-Glu-Val-Leu-Phe-Gln-Gly-Pro (LEVLFQGP), and cleaves it with high specificity and activity (the cleavage site is between Gln-Gly). It contains GST and His tags and can be removed by GSH resin or nickel column after the action is completed.

[0021] The beneficial effect of adopting the above scheme is: the present invention adds the HRV3C protease recognition sequence LEVLFQGP to the N-terminus of the mature peptide of protein glutaminase, and directly produces single-point mutants and combined mutants of active protein glutaminase through the recombinant plasmid I and the recombinant plasmid II, that is, a dual-plasmid co-expression system, and the mutants have greatly improved specific enzyme activity and thermal stability.

[0022] Furthermore, the inducers in step (2) are IPTG and arabinose; in step (3), the crude enzyme solution is separated and purified by passing through a nickel column and a desalting column in sequence. IPTG (Isopropylβ-D-Thiogalactoside) is used to induce recombinant plasmid II to express protein glutaminase, and the specific amount used can be 0.1 mM; arabinose is used to induce recombinant plasmid II to express HRV3C protein, and the specific amount used can be 0.2wt.%.

[0023] The sixth aspect of the present invention is to provide the application of the protein glutaminase mutant, wherein the protein glutaminase mutant is used to modify plant proteins, specifically to change the emulsification, solubility, foaming, allergenicity and other aspects of the plant proteins. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the electrophoresis diagram of the purification of the protein glutaminase mutant of the present invention;

[0025] Figure 2 Determination of the specific enzyme activity of the protein glutaminase mutant of the present invention;

[0026] Figure 3 It is a thermal stability test of the protein glutaminase mutant of the present invention;

[0027] Figure 4 The thermal stability of the wild type and I271V / T211V mutant of the protein glutaminase of the present invention is determined;

[0028] Figure 5 The optimum temperature of the wild type and I271V / T211V mutant of the protein glutaminase of the present invention is determined. DETAILED DESCRIPTION

[0029] The principles and features of the present invention are described below, and the examples are only used to explain the present invention and are not used to limit the scope of the present invention. If no specific technology or conditions are specified in the embodiments, the technology or conditions described in the literature in this field or the product instructions are used. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased through regular channels.

[0030] Example 1: Construction of a dual plasmid co-expression system and expression and purification of active protein glutaminase

[0031] 1. Construction of dual-plasmid co-expression system

[0032] The MBP-HRV3C fragment was constructed on the pEVOL vector (purchased from Addgene), and the PG fragment was constructed on the pET28a vector (purchased from Addgene). The recognition sequence LEVLFQGP of HRV3C was added between the leader peptide and the mature peptide of PG by reverse PCR. The primer sequences used are as follows: F-MPG-SUB: 5'AAGTTTTGTTCCAAGGTCCAGCCTCAGTGATTCCGGATGTTG 3' P-PRO-PG-SUB: 5'TGGACCTTGGAACAAAACTTCCAATTCTTTTGTAAGAATCGTTTT3' pET28a-PG was used as a template, and the reverse PCR system was shown in Table 1:

[0033] Table 1 Reverse amplification PCR system

[0034] Components volume <![CDATA[ddH2O]]> up to 50μL 2×Phanta Flash Master Mix 25μL Upstream primer (10 μM) 2μL Downstream primer (10 μM) 2μL template 1μL

[0035] PCR reaction conditions: 98℃ pre-denaturation for 30s, 98℃ denaturation for 30s, 55℃ annealing for 5s, 72℃ extension for 35s, 25 cycles, and finally 72℃ extension for 10min. The yield and specificity of the PCR product were detected by 0.8% agarose gel electrophoresis and purified with a DNA purification kit. The purified PCR product was demethylated with DpnI and transformed into Escherichia coli DH5α cloning competent cells (purchased from Qingke Biotechnology). Three transformants were selected for sequencing to obtain the correct recombinant vector, named pET28a-Pgsub, which carries the nucleotide sequence expressed in SEQ ID NO.1.

[0036] 2. Expression and purification of active protein glutaminase

[0037] pEVOL-MBP-HRV3C and pET28a-PGsub were co-transformed into BL21 (DE3) expression strain to obtain recombinant bacteria pEVOL-MBP-HRV3C + pET28a-PGsub. The recombinant bacteria were picked and placed in LB medium containing 50 mg / mL kanamycin and 10 mg / mL chloramphenicol. The seed solution was obtained by inoculating 1% in 100 mL of LB medium at 37°C until 0 D 600 =0.6-0.8, add 0.1mM IPTG and 0.2% arabinose at the same time, transfer to 18℃ and continue to culture for 18-20h.

[0038] The cells were collected by centrifugation at 4000rpm for 10min, resuspended in 50mM Tris-HCl at pH7.5, and broken by ultrasonication at a power ratio of 42%, with an on / off ratio of 2s for 2s for a total of 10min. The supernatant was centrifuged at 12000rpm for 10min to obtain the supernatant. The supernatant was purified by nickel column and desalted by desalting column. Buffer A (20mM imidazole, 50mM Tris, 500mM NaCl, pH7.5), buffer B (50mM imidazole, 50mM Tris, 500mM NaCl, pH7.5), and buffer C (500mM imidazole, 50mM Tris, 500mM NaCl, pH7.5) were used for purification. The desalting buffer used was pH7.5 50mM Tris-HCl buffer.

[0039] SDS-PAGE electrophoresis showed that the molecular weight of the purified PG was 34KDa for the proenzyme, 20KDa for the mature peptide, and 14KDa for the leader peptide. Figure 1 shown.

[0040] Example 2: Construction, expression and purification of protein glutaminase mutants

[0041] Using the nucleotide sequence of the recombinant plasmid pET28a-PGsub as a template, primers containing mutation sites were designed (Table 2).

[0042] PCR reaction conditions: 98℃ pre-denaturation for 30s, 98℃ denaturation for 30s, 55℃ annealing for 5s, 72℃ extension for 35s, 25 cycles, and finally 72℃ extension for 10min. The PCR product was tested for yield and specificity by 0.8% agarose gel electrophoresis and purified with a DNA purification kit. The purified PCR product was demethylated with DpnI and transformed into Escherichia coli DH5α cloning competent cells (purchased from Qingke Biotechnology). Three transformants were selected for sequencing to obtain the correct recombinant vector.

[0043] Table 2 Mutant primer sequences

[0044]

[0045]

[0046] pEVOL-MBP-HRV3C and a series of correct mutants of PG were co-transformed into BL21 (DE3) expression strain to obtain mutant recombinant bacteria. The recombinant bacteria were picked and incubated in LB medium containing 50 mg / ml kanamycin and 10 mg / mL chloramphenicol at 37°C for 6 h to obtain seed solution. The seed solution was inoculated at a 1% inoculum in 100 mL of LB medium at 37°C until 0 D 600 =0.6-0.8, add 0.1mM IPTG and 0.2% arabinose at the same time, transfer to 18℃ and continue to culture for 18-20h.

[0047] The cells were collected by centrifugation at 4000rpm for 10min, resuspended in pH7.5 50mMTris-HCl, and broken by ultrasonication at a power ratio of 42%, with an on / off ratio of 2s for 2s for a total of 10min. The supernatant was centrifuged at 12000rpm for 10min to obtain the supernatant. The supernatant was purified by nickel column and desalted by desalting column. Purification used bufferA (20mM imidazole, 50mM Tris, 500mM NaCl, pH7.5), bufferB (50mM imidazole, 50mM Tris, 500mM NaCl, pH7.5), and bufferC (500mM imidazole, 50mM Tris, 500mM NaCl, pH7.5). The desalting buffer used was pH7.5 50mMTris-HCl buffer.

[0048] Example 3: Determination of specific enzyme activity, optimal temperature and thermal stability of protein glutaminase mutants

[0049] 1. Enzyme activity assay

[0050] Definition: Under certain conditions, the amount of enzyme required to generate 1 μmol of ammonia per minute is defined as an enzyme activity unit u.

[0051] Reagents: potassium dihydrogen phosphate, disodium hydrogen phosphate, trichloroacetic acid, phenol, sodium nitroprusside, potassium hydroxide, anhydrous potassium carbonate, sodium hypochlorite (food grade), Cbz-Gln-Gly (M=337), ammonium chloride;

[0052] Reagent preparation: (1) Phosphate buffer (0.176 mol / L pH 6.5): Weigh 23.95 g potassium dihydrogen phosphate, dissolve in water, and dilute to 1000 ml (Solution I); Weigh 24.98 g disodium hydrogen phosphate, dissolve in water, and dilute to 1000 ml (Solution II); Add appropriate amount of Solution I to Solution II and adjust the pH to 6.5.

[0053] (2) Trichloroacetic acid solution: Weigh 65.36 g of trichloroacetic acid, dissolve it in water, and make up to 1000 ml.

[0054] (3) Color developer A: Weigh 40.06 g of phenol and 0.15 g of sodium nitroprusside, dissolve in water, and adjust the volume to 1000 ml; store at 4°C in the dark.

[0055] (4) Color developer B: Weigh 49.94 g KOH, dissolve in water, make up to 1000 ml, and store at 4°C.

[0056] (5) Color developer C: weigh 200.04 g of anhydrous potassium carbonate and 8.33 ml of sodium hypochlorite (food grade), add water to make up to 1000 ml, prepare before use. (6) Substrate solution (10 mM Cbz-Gln-Gly, M=337): weigh 0.337 g of Cbz-Gln-Gly, dissolve it in 0.176 mol / L, pH 6.5 phosphate buffer, and make up to 100 mL.

[0057] Standard curve drawing: Weigh 0.5349g ammonium chloride (bake at 105℃ for 2 hours), dissolve in water, and dilute to 1000ml. Then take 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1mL in test tubes, add water to 10ml, so that the final concentration in each test tube is 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1μmol / ml respectively. Take 0.24ml of the above ammonium chloride solution, add 0.96ml water, mix well, then add 1.2ml A solution in turn, mix well, add 0.6ml color developer B, mix well, then add 1.2ml C, mix well, warm bath at 37℃ for 20min, cool in running water, use water as reference (i.e. replace 0.18ml of ammonium chloride solution with water), and measure OD value at A630nm.

[0058] Enzyme activity determination: (1) Sample: Take 0.1ml of sample solution and add it to a test tube, incubate at 37℃ for 5min; then add 1ml of substrate solution that has been preheated at 37℃ for 10min, incubate at 37℃ for 30min, immediately add 1ml of trichloroacetic acid solution, mix well, terminate the reaction, and then determine the ammonia content. (2) Blank: Take 0.1ml of sample solution, add 1ml of trichloroacetic acid solution, mix well, incubate at 37℃ for 30min, then add 1ml of substrate solution, mix well. Take 0.12ml of the above sample and blank reaction solution, add 0.48ml of water, mix well, then add 0.6ml of A solution in turn, mix well, add 0.3ml of color developer B, mix well, then add 0.6ml of C, mix well, incubate at 37℃ for 20min, cool with running water, and measure the OD value by A630.

[0059] The results show that: E = (ΔA*2.1*N) / 17.03 / 30 / K;

[0060] Wherein, E: protein-protein glutaminase activity, u / ml; ΔA: OD630 difference; 2.1: total volume of reaction solution (ml); N: sample dilution factor; 17.03: ammonia molecular weight; 30: reaction time (min); K: standard curve slope.

[0061] Protein concentration determination: Grayscale analysis of mature peptides was performed using ImageJ to obtain the concentration of mature peptides (mg / mL).

[0062] The wild type (abbreviated as WT) and all mutants were subjected to comparative enzyme activity assay. Figure 2 As shown. Figure 2It can be seen that the mutants G63W, L65I, G87A, T102S, S144P, A193S, Y204F, T211V, S261F, Y264L, I271V / I204F, T211V / Y204F, Y204F / G63W, Y204F / L65I, Y204F / G87A, Y204F / A193S, I271V / T211V , T211V / Y204F / A193S, T211V / Y204F / A193S / G87A, T211V / Y204F / Y264L / S144P or T211V / Y204F / Y264L / L65I were all higher than that of the wild type, especially the mutant I271V / T211V, whose specific enzyme activity reached 3.97U / mg, which was 4.14 times that of the wild type.

[0063] 2. Thermal stability determination

[0064] Thermal stability assay: The wild-type protein glutaminase and all mutants were subjected to thermal stability assay at 37°C for 0 h, 0.5 h, 1 h, and 2 h. Figure 3 ;Depend on Figure 3 It can be seen that the protein glutaminase mutants G63W, L65I, G87A, T102S, S144P, A193S, Y204F, T211V, S261F, Y264L, I271V / I204F, T211V / Y204F, Y204F / G63W, Y204F / L65I, Y204F / G87A, Y204F / A193S, I271V / T211V, T211V / Y204F / A193S, T211V / Y204F / A193S / G87A, T211V / Y204F / Y264L / S144P and T211V / Y204F / Y264L / L65I have good thermal stability.

[0065] The wild-type protein glutaminase and mutant I271V / T211V were treated at 37°C and 55°C for 0 h, 0.5 h, 1 h, and 2 h. Figure 4 The mutant I271V / T211V retained 90% of its activity after being treated at 55°C for 0.5h, while the wild-type protein glutaminase retained 65% of its activity after being treated at 55°C for 0.5h. The thermal stability of the mutant I271V / T211V was significantly improved compared with that of the wild-type protein glutaminase.

[0066] 3. Determination of optimum temperature

[0067] Optimum temperature determination: The enzyme activity of wild-type protein glutaminase and mutant I271V / T211V was determined at 15°C, 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, 60°C, and 65°C. The results are as follows: Figure 5 The mutant I271V / T211V had higher activity at different temperatures.

[0068] In summary, the present invention directly produces active protein-protein glutaminase through a dual-plasmid co-expression system, and constructs single-point mutants and combination mutants of protein-protein glutaminase through a computer-aided design method. The provided mutants have greatly improved specific enzyme activity and thermal stability, which is of great significance for improving the solubility and emulsification of protein in food, and is more conducive to meeting the needs of social production.

[0069] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0070] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. A protein glutaminase mutant, characterized in that The protein glutaminase mutant has a sequence in which an amino acid mutation occurs in the sequence shown in SEQ ID NO: 1, and the site where the amino acid mutation occurs is any one of 63W, 65I, 87A, 102S, 136M, 144P, 193S, 204F, 211V, 261F, 262G, 264L, 271V, and 289M, or a combination of at least two of the mutated sites.

2. The protein glutaminase mutant according to claim 1, characterized in that: The protein glutaminase mutant is G63W, L65 I, G87A, T102S, S144P, A193S, Y204F, T211V, S261 F, Y264L, I 271V / I204F, T211V / Y204F, Y204F / G63W, Y204F / L65 I, Y204F / G87A, Y204F / A193S, I 271V / T211V, T211V / Y204F / A193S, T211V / Y204F / A193S / G87A, T211V / Y204F / Y264L / S144P or T211V / Y204F / Y264L / L65 I.

3. The protein glutaminase mutant according to claim 1, characterized in that: The protein glutaminase mutant is I 271V / T211V.

4. A coding gene, characterized in that The coding gene encodes the protein glutaminase mutant according to any one of claims 1 to 3.

5. A recombinant plasmid, characterized in that: The recombinant plasmid comprises a recombinant plasmid I for expressing HRV3C protease and a recombinant plasmid II connected with the coding gene according to claim 4.

6. The recombinant plasmid according to claim 6, characterized in that: The plasmid vector of the recombinant plasmid I is pEVOL, and the plasmid vector of the recombinant plasmid II is pET28a.

7. A recombinant bacterium, characterized in that: Comprising the recombinant plasmid described in claim 6 or 7.

8. A method for directly preparing active protein glutaminase, characterized in that: The steps include: (1) preparing the recombinant plasmid I and the recombinant plasmid II as claimed in claim 6 or 7, and transforming the recombinant plasmid I and the recombinant plasmid II into a host to obtain the recombinant bacterium as claimed in claim 8; (2) inducing the recombinant bacteria with an inducer to obtain bacterial cells containing the recombinant plasmid I and the recombinant plasmid II expressed intracellularly, and disrupting the bacterial cells to obtain a crude enzyme solution; (3) separating and purifying the crude enzyme solution to obtain the protein glutaminase mutant.

9. The method for preparing a protein glutaminase mutant according to claim 8, characterized in that: In step (2), the inducing agents are IPTG and arabinose; in step (3), the crude enzyme solution is separated and purified by passing through a nickel column and a desalting column in sequence.

10. Use of a protein glutaminase mutant, characterized in that: The protein glutaminase mutant according to any one of claims 1 to 3 is used in modifying plant protein.

Images