Application of rice low-potassium response transcription factor gene KTR2 in regulation of drought stress tolerance

Abstract

The invention discloses application of a rice low-potassium response transcription factor KTR2. The sequence of the coding gene KTR2 of the low-potassium response transcription factor is shown as SEQ ID NO. 1. The gene can be applied to the aspects of controlling drought stress tolerance of rice and the like. The biological function of the low-potassium response transcription factor KTR2 in the rice is found through a large number of experiments, and after the gene is over-expressed, the tolerance of the rice to drought stress can be enhanced; after the gene is knocked out, the rice is sensitive to drought stress.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and relates to the application of rice low potassium response transcription factor gene KTR2 in drought stress tolerance. Background Art

[0002] Drought stress is one of the most important abiotic stresses in agricultural production and is also an abiotic factor that causes the most serious losses to plant growth and crop productivity (Flowers, 2004; Godfray et al., 2010; Tester and Langridge, 2010; Agarwal et al., 2013). When facing different degrees of drought stress, plants will activate different coping mechanisms to improve their resistance to external stimuli, thereby regulating their own growth and reproduction. For example, when water stress does not last too long and is not too strong, plants usually respond by strengthening their K + and water absorption ( and Kirkby, 2010; et al., 2014), reducing transpiration, increasing salt excretion and other mechanisms to maintain growth as much as possible (Munns, 2005; Shabala et al., 2010). When the stress is persistent and intense, plants may complete life reproduction as much as possible by reducing growth rate and shortening growth period (Flowers, 2004; Godfray et al., 2010; Tester and Langridge, 2010; Agarwal et al., 2013).

[0003] Potassium (K + ) is the most abundant inorganic cation in plant cells, with a content of up to 2-10% of the plant's dry weight. It is one of the three essential nutrients for plant growth and development (Adams and Shin, 2014; Leigh and Wyn Jones, 1984; Walker et al., 1996). It is widely involved in many physiological processes of plant growth and development, including osmotic regulation, enzyme activation, ion balance, stomatal movement, and resistance to biotic and abiotic stresses (Wang et al., 2013; Anschütz et al., 2014). As an important inorganic osmotic ion, K + It can regulate the osmotic potential of plant cells and play an important role in plant response to osmotic / drought stress. + It can also regulate plant photosynthesis and the transfer and metabolism of carbohydrates, ultimately determining the yield and quality of crops. +When the supply is insufficient, plants will show yellowing of leaves due to water loss, weak plants, and sensitivity to abiotic stresses such as drought, which seriously affects the growth and development of plants (Munson, 1985). + When adequately supplied, plants can enhance their resistance to biotic and abiotic stresses. + It will cause K deficiency in the root epidermal cells + signals, including Ca 2+ , ROS, plant hormones, microRNAs, etc. These signals are further transmitted and trigger downstream target genes (especially K + channel and high affinity K + transporter) and ultimately achieve plant resistance to low K + Adaptation to the environment (Wang and Wu, 2013).

[0004] There are about 58 transcription factor families in higher plants, of which six major transcription factor families, AP2 / ERF, WRKY, bZIP, NAC, MYB and bHLH, have been shown to be involved in the regulatory response of plants to stresses such as drought. Among them, APELATA2 / ethylene response factor (AP2 / ERF) transcription factors are believed to play an important role in the response of plants to multiple hormones as well as drought and salt stresses (Zhang et al., 2009). AP2 / ERF is one of the largest plant transcription factor families, containing 119-200 family members (Du et al. 2014; Nakano et al. 2006; Rao et al. 2015; Zhuang et al. 2008), which are involved in physiological processes such as plant ethylene signal transduction, stress response, metabolism, and response to external stimuli (Han et al., 2016; Koyama et al. 2013; Lee et al. 2012; Li et al. 2007; Fits and Memelink 2000; Trujillo et al. 2008; Zhu et al. 2014). Arabidopsis thaliana ERF transcription factor subfamily Vb member RAP2.11 regulates high affinity K + Transporter AtHAK5 gene and low K + The expression of other related genes in the signal transduction pathway improves the plant's resistance to low K +Environmental tolerance (Kim et al., 2012). A small number of AP2 / ERF members can respond to two or more environmental stresses at the same time. For example, overexpression of JERF3 and SodERF3 in rice and tobacco improves the tolerance of plants to drought, osmotic stress, salinity, and freezing stress (Trujillo et al. 2008; Wu et al. 2008; Zhang et al. 2010c). The expression of rice AP2 / ERF transcription factor KTR2 is upregulated by low potassium, and KTR2 overexpression enhances rice's tolerance to K. + In this study, we investigated how KTR2 affects K + The mechanism by which rice responds to drought stress deserves further exploration. Summary of the invention

[0005] The purpose of the present invention is to provide an application of rice low potassium response transcription factor KTR2 in rice tolerance to drought stress, mainly that the self-promoter overexpression material can increase the relative yield of rice under drought stress at the booting stage.

[0006] The purpose of the present invention is achieved through the following technologies:

[0007] Application of rice low potassium response transcription factor KTR2 in regulating rice tolerance to drought stress, wherein the CDS sequence of the rice low potassium response transcription factor KTR2 is as shown in SEQ ID NO.1 (shown as ATGGAGCTCAACTTCCAAGTGCAACCTCCAGTGTTCCAGCTGCAAGACTACTGCTACTACTACAGCC AAGAGGTGGCGGCGGCGGCGTCGCCGGCGGCGAAGCCGACGAAGCCGCGGGGGAGGAAGAAGGGCAGCACGAGCCACAGCAAGTTCGTCGGCGTCCGGCAGCGGCCGTCGGGGCGGTGGGTGGCGGAGATCAAGGACACGACGCAGAAGATCCGCATGTGGCTCGGCACCTTCGAGACCGCCGACGCCGCCGCGCGCGCCTACGACGAGGCCGCGCGCCTCCTCCGCGGCGCCGAGGCGCGCACCAACTTCGCGCCACGCATCTCGCCGGACTGCCCGCTCGCCGTCCGCATCCGCGGAATCCTCCACCACAAGAAGCTCAAGAAGGCCAGGTCCGCCGCCGCGGCCACGGCCGGCTCCCCCGGCGCCGCATCCAAGAAGAGGTCCACCACGGCGGCGGCGGCGGCGGCCACTCCGACGATCACAACCACAAGCAATAGCAATAGCGATGGTGCGGGTAGTGCTTGTGGTGGCTCGAGCAGCAGCAGCAGCAGCACGGACAGCTGCGACGGCGCCGTGAAGCAAGGCGGCGGCGGCGGCGGCGCACCAACGGACGCCAGCGAGGTGTACCGGCCGGACTTCGTCCACGCGGGCGCCGAGGAGTTCGATTCTTGGATGTTCGACACGGCGTTCGGCCCGTTCCCAGAGCTGGACAGCTTCGCCGCCGTCGACGCCGTCACGCCACCGCCAGCAACGGCGTCGCCGGAGGAGTCAAGCGCCGGCACGCCGCCGGTCGAGATGGCGGAGTTCGAGCGGATAAAGGTGGAGCGGCGGATCTCGGCGTCCCTGTACGCCATGAACGGCCTGCAGGAGTACTTCGACAAGGTGTTCGACGCGTCCGCCTGCGACCCGTTCTGGGATTTCTCGCCACTGTGCCATTAG).

[0008] As a preferred embodiment of the present invention, overexpression of rice low potassium response transcription factor KTR2 can enhance the tolerance of rice to drought stress at the booting stage.

[0009] As a further preferred embodiment of the present invention, the method for enhancing the tolerance of rice to drought stress at the booting stage is selected from any one or more of the following:

[0010] (1) Enhance the tolerance of rice seedlings to drought stress;

[0011] (2) Improve the potassium content of rice under drought stress during the booting stage;

[0012] (3) Improve the relative yield of rice under drought stress during the heading stage.

[0013] As a preferred embodiment of the present invention, knocking out the rice low potassium response transcription factor OsKTR2 reduces the tolerance of rice to drought stress at the seedling stage and the booting stage.

[0014] The invention discloses an application of a recombinant expression vector for overexpressing the rice low potassium response transcription factor OsKTR2 in increasing the relative yield of rice under drought stress, thereby improving the drought resistance of rice.

[0015] As a preferred embodiment of the present invention, the recombinant expression vector is obtained by inserting the rice low potassium response transcription factor KTR2 into the SacI and PstI restriction sites of the starting vector pCAMBIA1305, then using EcoRI and SacI to remove the Ubiquitin promoter and inserting the KTR2 gene's own promoter.

[0016] The recombinant expression vector for overexpressing the rice low potassium response transcription factor OsKTR2 is characterized in that the recombinant expression vector is obtained by inserting the rice low potassium response transcription factor OsKTR2 described in claim 1 into the SacI and PstI restriction sites of the starting vector pCAMBIA1305, then using EcoRI and SacI double restriction enzymes to remove the Ubiquitin promoter and insert the OsKTR2 gene's own promoter.

[0017] The vector for knocking out the rice low potassium response transcription factor OsKTR2 is used to reduce the relative yield of rice under drought stress, ultimately leading to high sensitivity of rice to drought stress.

[0018] As a preferred embodiment of the present invention, the vector for knocking out the rice low potassium response transcription factor OsKTR2 is based on the pYLCRISPR / Cas9-Pubi-B vector, and primers are designed and synthesized for the target sequences T1 (SEQ ID No. 2: GGTGGCGGCGGCGGCGTCGCCGG), T2 (SEQ ID No. 3: ACGAGCCACAGCAAGTTCGTCGG), T3 (SEQ ID No. 4: GCCGTCGGGGCGGTGGGTGGCGG) and T4 (SEQ ID No. 5: CAGAAGATCCGCATGTGGCTCGG) of OsKTR2, and the primers are annealed and inserted between the BsaI restriction sites of the basic vector.

[0019] A vector for knocking out the rice low potassium response transcription factor OsKTR2 is provided. The pYLCRISPR / Cas9-Pubi-B vector is used as a basic vector, primers are designed and synthesized for the target sequences T1 (SEQ ID No. 2: GGTGGCGGCGGCGGCGTCGCCGG), T2 (SEQ ID No. 3: ACGAGCCACAGCAAGTTCGTCGG), T3 (SEQ ID No. 4: GCCGTCGGGGCGGTGGGTGGCGG) and T4 (SEQ ID No. 5: CAGAAGATCCGCATGTGGCTCGG) of OsKTR2, and the primers are annealed and inserted between the BsaI restriction sites of the basic vector.

[0020] Beneficial effects of the present invention:

[0021] 1. In the present invention, a recombinant expression vector constructed by rice low potassium response transcription factor KTR2 is discovered for the first time in the world. It is transfected into wild-type rice Nipponbare (Oryza sativa.ssp.cv.Japonica) through Agrobacterium-mediated rice transgenic technology. The tolerance of KTR2 overexpressing material to drought stress at the seedling stage is significantly improved compared with wild-type rice.

[0022] 2. The KTR2 gene in the present invention is derived from rice, and the promoter is also a sequence upstream of the KTR2 gene, which is not an exogenous gene, and therefore has biosafety. The constructed rice low-potassium response transcription factor KTR2 plant expression vector can be directly used for Agrobacterium-mediated plant genetic transformation to obtain new germplasm that can enhance rice tolerance to drought stress.

[0023] 3. Overexpression of the KTR2 gene in the present invention can enhance the tolerance of rice to drought stress during the booting stage, and improve the potassium absorption of rice sheaths, thereby increasing the relative yield of rice under drought stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 , Molecular identification and plant type screening of OsKTR2 transgenic rice materials

[0025] Figure A: Phenotypes of Nipponbare wild-type rice WT and OsKTR2 self-promoter overexpressing material Pro-KTR2; Figure B: The expression level of OsKTR2 in Pro-KTR2 relative to WT; Figures CD: Biomass of roots and aboveground parts of WT and Pro-KTR2 materials.

[0026] Figure 2 , KTR2 expression is upregulated by mannitol and ABA stress

[0027] Figure AB: KTR2 gene is affected by 120.4 g L -1 Figure CD: The expression levels of KTR2 gene in the root and aboveground at different time points after Mannitol stress; Figure CD: The expression levels of KTR2 gene in the root and aboveground at different time points after 30 μM ABA stress.

[0028] Figure 3 The expression of KTR2 in different rice tissues is upregulated by drought stress

[0029] Figure 4 Differences in tolerance to drought stress among KTR2 knockout and corresponding wild-type materials at the seedling stage

[0030] Figure 5 Leaf curling phenotypes of KTR2 promoter overexpression, knockout and corresponding wild-type materials under drought stress

[0031] Figure 6 , KTR2 own promoter overexpression, knockout and corresponding wild-type materials under drought stress. Figure A: Single plant yield of WT and KTR2 overexpression and knockout materials under drought stress; Figure B: Relative single plant yield of WT and KTR2 overexpression and knockout materials under drought stress.

[0032] Figure 7 Potassium content in different tissues of WT and KTR2 overexpression and knockout materials under drought stress. Figure A: Potassium content in roots of WT and KTR2 overexpression and knockout materials under drought stress; Figure B: Potassium content in stems and leaf sheaths of WT and KTR2 overexpression and knockout materials under drought stress; Figure C: Potassium content in leaves of WT and KTR2 overexpression and knockout materials under drought stress.

[0033] Figure 8 , map of pCAMBIA1305 expression vector.

[0034] Fig. 9, pYLCRISPR / Cas9-Pubi-B basic vector map. DETAILED DESCRIPTION

[0035] Example 1. Cloning of OsKTR2 gene

[0036] 1. Template: RNA was extracted from leaves of Nipponbare (NB) wild-type rice grown in normal hydroponics for 2 weeks and reverse transcribed into cDNA, which was used as a template for cloning the OsKTR2-CDS sequence.

[0037] 2. PCR primer design: Find the gene sequence of OsKTR2 on the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), design primers using the primer design software Primer5.0, add SacI (GAGCTC) and PstI (CTGCAG) restriction site sequences to the 5' and 3' ends of the primers, and add a sequence on the pCAMBIA1305 plasmid vector to form a 41bp homologous recombination primer (F1 and R1).

[0038] Upstream primer F1:

[0039] 5'-ATTTACGAACGATAG GAGCTC ATGGAGCTCAACTTCCAAGT-3′;

[0040] Downstream primer R1:

[0041] 5'-GTGATTTTTGCGGAC CTGCAG CTAATGGCACAGTGGCGAGA-3'.

[0042] 3. PCR amplification of OsKTR2 gene: PCR Buffer 2μl, dNTP Mix 2μl, upstream and downstream primers 1μl each, template 1μl, KOD high-fidelity enzyme 1μl, redistilled water 13μl. The PCR amplification program is as follows: 94℃ pre-denaturation for 5min, 94℃ denaturation for 30s, 62℃ annealing for 30s, 72℃ renaturation extension for 1min, after 35 cycles, 72℃ 10min full extension,

[0043] Keep at 10℃. The amplified PCR product was detected by 1% agarose gel electrophoresis to have a size of 948bp for the OsKTR2 gene. Example 2. Construction of plant recombinant expression vector pCAMBIA1305-OsKTR2 and acquisition of rice transgenic materials 1. Construction of OsKTR2 gene expression vector: pCAMBIA1305 plasmid vector was double-digested with SacI and PstI, and the cut linearized expression vector was gel-recovered, and then homologous recombination reaction was carried out with the PCR linear product containing OsKTR2. The homologous recombination product was transformed into Escherichia coli DH5α competent cells, and after antibiotic screening, positive single clones were picked, and positive clones were saved. The Escherichia coli plasmid was extracted and sent to the company for sequencing. After correct sequencing, the pCAMBIA1305-OsKTR2 intermediate vector containing the Ubiquitin strong promoter was obtained. On this basis, we used EcoRI (GAATTC) and SacI (GAGCTC) to double-digest this vector, and obtained a pCAMBIA1305 intermediate vector carrying the OsKTR2 gene but removing the Ubiquitin promoter, and recovered the digestion product by gel. According to the promoter sequence of the OsKTR2 gene itself, a 1964bp sequence was intercepted, and a pair of homologous recombination primers (F2 and R2) for amplifying the promoter of the OsKTR2 gene itself were designed using the software Primer 5.0. EcoRI (GAATTC) and SacI (GAGCTC) restriction site sequences were added to the 5' and 3' ends of the primers, and a sequence on the pCAMBIA1305 plasmid vector was added. Using wild-type Nipponbare rice gDNA as a template, the target promoter linear fragment was obtained by PCR technology. After verification, it was homologously recombined with the pCAMBIA1305-OsKTR2 linear vector with the Ubiquitin promoter removed. The homologous recombination product was transformed into Escherichia coli DH5α competent cells. After antibiotic screening, the positive single clones were picked and preserved. The Escherichia coli plasmid was extracted and sent to the company for sequencing. After correct sequencing, the recombinant expression vector pCAMBIA1305-OsKTR2 was obtained, which was transferred into EHA105 Agrobacterium competent cells by electroporation. After antibiotic screening, the positive clones were picked and the plasmid was extracted and transformed back into Escherichia coli. After the extracted plasmid was verified by sequencing, an equal volume of 30% glycerol was added to the Agrobacterium liquid and stored in a -70°C refrigerator for subsequent experiments.

[0044] Upstream primer F2:

[0045] 5'-TATGACCATGATTAC GAATTC TTGTGGGATAGTAAACGAGA-3′;

[0046] Downstream primer R1:

[0047] 5'-GGATCCCCGGGTACC GAGCTC GTGTTTGTGTGTGAGCTTGT-3'.

[0048] 2. Obtaining transgenic rice: The Agrobacterium obtained above with the self-promoter overexpression vector of pCAMBIA1305-OsKTR2 was used to infect rice callus tissue, and after co-cultivation (dark culture) for 2.5 days, the bacteria were washed, and the dried callus was transferred to the selection medium containing 500 mg / L carbenicillin and 50 mg / L hygromycin for the first round of selection culture, and cultured at 28°C for 2 weeks. The resistant callus was transferred to the selection medium containing 500 mg / L carbenicillin and 80 mg / L hygromycin for the second round of selection culture, and cultured at 28°C for light until granular resistant callus tissue grew. Pick the bright yellow resistant callus from the same callus and transfer it to a plastic wide-mouth bottle filled with differentiation medium for differentiation culture, wait for differentiation into seedlings (25-30 days), and when the seedlings grow to about 2-3 cm, put them into the rooting medium for seedling strengthening. Pick out the differentiated seedlings from the rooting tube, add an appropriate amount of sterile water, and harden the seedlings for one week. The root agar medium is washed off, and the plants are transplanted into rice nutrient solution for growth and positive seedling identification is performed, and the positive seedlings are transferred to the field for harvesting to obtain T1 generation transgenic seeds. The culture media used are all prior art.

[0049] 3. Identification of overexpression effect of OsKTR2 transgenic rice material: The T1 generation transgenic seeds of the OsKTR2 overexpression strain obtained above and the wild-type rice seeds of Nipponbare were germinated by water. Select healthy seeds, soak them in 30% sodium hypochlorite solution for 30 minutes, then rinse them with clean water 5 times, place them in a paper cup covered with a 20-mesh nylon mesh, submerge half of the seeds with clean water, and then put them in a 37°C oven for germination for 24-36 hours. Ten days after emergence, all overexpression strains were identified by GUS staining, and positive seedlings were selected and moved to turnover boxes for hydroponics. After culturing with full IRRI nutrient solution for 2 weeks, a part of the seedlings was selected, and the total RNA in the tissues of each OsKTR2 gene overexpression strain and wild-type Nipponbare wild-type rice was extracted using Trizol reagent, and cDNA was obtained by reverse transcription. Using this as a template, RT-qPCR was used to identify the expression level of the OsKTR2 gene at the transcriptional level. The internal reference and OsKTR2 gene primers used for RT-qPCR are shown in Table 1. Another part of the seedlings were used to screen plant types, and the biomass of all plants was counted ( Figure 1 Among the 9 OsKTR2 overexpressing seedlings tested ( Figure 1 A), the expression of OsKTR2 was upregulated to varying degrees ( Figure 1 B), In addition, the root dry weight of these overexpressing seedlings ( Figure 1 C) and aboveground dry weight ( Figure 1D) No significant difference with the wild type. Combining the expression level of OsKTR2 and the dry weight of seedlings, we selected three representative strains from these nine overexpressing seedlings and named them Pro1, Pro2 and Pro3 for subsequent physiological experiments.

[0050] Table 1 Primer sequences of OsActin and OsKTR2 used for RT-qPCR

[0051]

[0052] Example 3. Construction of KTR2 knockout material and identification of homozygotes

[0053] 1. Construction of KTR2 knockout vector and acquisition of transgenic rice: Based on the appendix of the article published by Miao et al. (2013), the Spacer sequence of KTR2 was designed using the Spacer design website (http: / / crispr.tefor.net / ), and sequences with good cutting efficiency and specificity scores were selected as candidate targets for relevant primer design. Target sequences T1 (SEQ ID No. 2: GGTGGCGGCGGCGGCGTCGCCGG), T2 (SEQ ID No. 3: ACGAGCCACAGCAAGTTCGTCGG), T3 (SEQ ID No. 4: GCCGTCGGGGCGGTGGGTGGCGG) and T4 (SEQ ID No. 5: CAGAAGATCCGCATGTGGCTCGG). The designed F and R primers (Table 2) were sent to Genewise for synthesis, and the obtained dry powder of the primers was centrifuged, diluted, and mixed before use. Take equal volumes of the corresponding F and R primers, mix thoroughly and centrifuge, place in the PCR instrument, set the temperature gradient program (95℃, 2min; 72℃, 2min; 55℃, 2min; 45℃, 2min; 37℃, 2min; 25℃, 2min; 15℃, ∞) to obtain the annealed double-stranded product. The expression vector containing the U6a::sgRNA backbone treated with BsaI endonuclease linearization and the annealed double-stranded product were subjected to enzyme ligation reaction by T4 ligase to obtain the U6a::Spacer::sgRNA expression vector. The enzyme-linked product was transformed into competent Escherichia coli DH5α and cultured overnight on a medium containing corresponding antibiotics. The monoclonal colony was selected and sent to Jinweizhi Company for Sanger sequencing verification. After the sequencing alignment was correct, the plasmid was extracted and stored at -20℃ for standby use. According to the same construction method, the U3::Spacer::sgRNA expression vector was obtained. Finally, according to the experimental needs, different U::Spacer::sgRNA expression cassettes were assembled into the pYLCRISPR / Cas9-Pubi-B expression vector through the GoldenGate cloning strategy to obtain the final gene targeting vector. In the same way, the gene targeting vector was transformed into competent Escherichia coli DH5α, and the desired positive clones were obtained after antibiotic screening. The plasmid of the extracted positive bacteria was transformed into EHA105 competent Agrobacterium, and the desired KTR2 knockout transgenic plants were finally obtained by infecting rice callus with Agrobacterium.

[0054] Table 2 Primers used for knockout of KTR2 using the CRISPR-Cas9 system

[0055]

[0056] 2. Identification of super homozygous KTR2 knockout materials and strain screening: KTR2 knockout strains require two rounds of PCR testing. First, extract the mutant material and the corresponding wild-type gDNA samples. In the first round, use the Cas9 universal primer (Table 3) to verify the Cas9 sequence. In the second round, use KTR2-CRISPR-F / R primers (Table 3) to amplify the gDNA of the transgenic strain as a template. The product was sent to the company for sequencing, and the homozygous knockout material was selected. By sequencing and verifying the mutant material, we obtained 10 KTR2 knockout homozygous strains. Further through physiological and quantitative experimental data, we screened two strains with similar phenotypes and named them ktr2-1 and ktr2-2 for subsequent experiments.

[0057] Table 3 KTR2 knockout material identification primers

[0058]

[0059] Example 4. Identification of the response of rice KTR2 to environmental stresses such as drought using RT-qPCR technology

[0060] In order to explore the response of KTR2 gene to environmental stress, we subjected 10-day-old Nipponbare wild-type rice to different environmental stresses, and took samples from the roots and aboveground parts for RT-qPCR analysis of KTR2 expression patterns, and used samples without any treatment as the control group. The specific steps of RT-qPCR are as follows: according to the instructions of the TaKaRa kit, use 10μL of the reaction system: SYBR PremixExTaq 5μL, 0.2μL of each upstream and downstream primer, 0.2μL of 50×ROX Reference Dye, 2.4μL of ddH2O, and 2μL of diluted cDNA template. The reaction conditions are: 95℃ 5min, 95℃ 5s, 60℃ 30s, 40cycles; 95℃ 15s, 60℃ 1min, 95℃ 15s. The quantitative results are based on the C T (Threshold Cycle) value is 2 -ΔCt Methods Calculation and analysis. RT-qPCR internal reference and KTR2 gene quantitative primers are shown in Table 1.

[0061] The experimental results showed that the expression of KTR2 was upregulated by drought and other stresses. -1 When treated with mannitol for 12h and 24h, the expression level of KTR2 reached about 3-10 times that of WT ( Figure 2When treated with 30uM ABA (abscisic acid) for 24h and 72h, the expression of KTR2 was significantly upregulated, reaching 2-5 times that of WT. However, when treated with ABA for 3h and 6h, the expression level of KTR2 in the root was only about 1 / 2 times that of WT ( Figure 2 CD). At the same time, we used barrel-cultured seedlings at the booting stage under drought stress for 7 days and detected that the expression level of KTR2 in various tissues reached about 100 times that of WT ( Figure 3 ). This indicates that the expression of KTR2 is induced by environmental stresses such as drought.

[0062] Example 5 Water loss test of wild type and transgenic rice seedlings

[0063] We found through RT-qPCR experiments that the expression of KTR2 was upregulated in response to drought and abscisic acid stress. To further explore the role of KTR2 in controlling rice tolerance to drought stress, we first conducted a rice seedling dehydration experiment. 10-day-old transgenic and wild-type rice seedlings were exposed to 1 mM K + After culturing in IRRI nutrient solution for 4 weeks, the rice transgenic and wild-type seedlings were placed back into the nutrient solution containing 1 mM K and dehydrated for 2.5 h. When the leaves of the KTR2 knockout material were observed to be completely curled, the seedlings were + After continuing to culture in IRRI nutrient solution for 12 hours, the survival rate of KTR2 knockout materials and corresponding wild-type rice seedlings was counted. The experimental results showed that compared with the wild type, the survival rate of KTR2 knockout strains after water supply restoration was only about 50% of that of the wild type ( Figure 4 ), resulting in a significant decrease in the tolerance of rice to drought stress at the seedling stage.

[0064] Example 6 Tolerance test of wild type and transgenic rice to drought stress at booting stage

[0065] To further explore the role of KTR2 in controlling the tolerance of rice to drought stress during the booting stage (rice is prone to drought stress during its growth period). We conducted a drought stress experiment during the booting stage of rice. First, several 20L barrels were prepared, each containing 19kg of mixed soil and river sand, and 12.5g of basal fertilizer (2g each of N, P2O5 and K2O) was applied for standby use. 10-day-old KTR2 self-promoter overexpression, knockout and Nipponbare wild-type rice seedlings were cultured in normal nutrient solution for 2-4 weeks and then transplanted into barrels, with 3 seedlings per barrel. Drought stress treatment was started at the early stage of booting, and the second round of drought stress treatment was carried out 24 hours after the water supply was restored. The curling degree of the leaves of KTR2 self-promoter overexpression, knockout and Nipponbare wild-type rice during drought stress was observed and counted. The results showed that when rice faced drought stress, the leaves of wild-type rice curled up completely, while the leaves of KTR2 promoter-overexpressing materials were fully extended; while the leaves of KTR2 knockout materials curled up completely, while the leaves of wild-type rice were fully extended ( Figure 5 ).

[0066] After two rounds of drought stress treatment, the rice was cultured normally until it was fully mature, and relevant agronomic statistics were performed on the KTR2 promoter overexpression, knockout and Nipponbare wild-type rice. The results showed that after drought stress, the relative yield of the KTR2 promoter overexpression line was about 20-30% higher than that of the wild type ( Figure 6 ). This indicates that KTR2 overexpression enhances rice tolerance to drought stress, ultimately leading to an increase in the relative yield of crops under drought stress. The phenotype of the KTR2 knockout material is opposite to that of the self-promoter overexpression strain, that is, the relative yield of rice after KTR2 knockout is significantly reduced compared with the wild type ( Figure 6 ).

[0067] The KTR2 expression in roots, leaves, stems and sheaths of KTR2 overexpression, knockout and WT materials at full maturity under drought stress was detected. + The results showed that KTR2 promoter overexpression in stems and leaf sheaths + The content was significantly higher than that of the wild type, about 23%, and the K + The content is significantly lower than that of the wild type, about 14% ( Figure 7 ).

[0068] The above results show that KTR2 overexpression enhances the resistance of rice stems and leaf sheaths to K + The absorption of α-terminal locust 2 increased the tolerance of rice to drought stress at the booting stage, while its knockout caused the rice to be highly sensitive to drought stress at the booting stage.

Claims

1. Application of rice low potassium response transcription factor OsKTR2 in regulating rice tolerance to drought stress, characterized in that: The CDS sequence of the rice low potassium response transcription factor OsKTR2 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: Overexpression of the rice low-potassium-responsive transcription factor OsKTR2 enhances the tolerance of rice to drought stress at the seedling and booting stages.

3. The use according to claim 2, characterized in that: The method for enhancing the tolerance of rice to drought stress at the booting stage is selected from any one or more of the following: (1) Enhance the tolerance of rice seedlings to drought stress; (2) Improve the potassium content of rice under drought stress during the booting stage; (3) Improve the relative yield of rice under drought stress during the heading stage.

4. The use according to claim 1, characterized in that: Knocking out the rice low potassium response transcription factor OsKTR2 described in claim 1 reduces the tolerance of rice to drought stress at the seedling stage and the booting stage.

5. Use of a recombinant expression vector overexpressing the rice low potassium response transcription factor OsKTR2 as claimed in claim 1 in increasing the relative yield of rice under drought stress, thereby improving the drought resistance of rice.

6. The use according to claim 4, characterized in that: The recombinant expression vector is obtained by inserting the rice low potassium response transcription factor OsKTR2 described in claim 1 into the SacI and PstI restriction sites of the starting vector pCAMBIA1305, then removing the Ubiquitin promoter with EcoRI and SacI double restriction enzymes and inserting the OsKTR2 gene's own promoter.

7. Use of a vector for knocking out the rice low potassium response transcription factor OsKTR2 as claimed in claim 1 to reduce the relative yield of rice under drought stress, ultimately leading to high sensitivity of rice to drought stress.

8. The use according to claim 7, characterized in that: The vector for knocking out the rice low-potassium response transcription factor OsKTR2 described in claim 1 is based on the pYLCRISPR / Cas9-Pubi-B vector, and primers are designed and synthesized for the target sequences T1, T2, T3 and T4 of the low-potassium response transcription factor OsKTR2. After the primers are annealed, they are inserted between the BsaI restriction sites of the basic vector, wherein the target sequence T1 is shown in SEQ ID NO.2, the target sequence T2 is shown in SEQ ID NO.3, the target sequence T3 is shown in SEQ ID NO.4, and the target sequence T4 is shown in SEQ ID NO.

5.

9. A recombinant expression vector for overexpressing the rice low potassium response transcription factor OsKTR2 according to claim 1, characterized in that: The recombinant expression vector is obtained by inserting the rice low potassium response transcription factor OsKTR2 described in claim 1 into the SacI and PstI restriction sites of the starting vector pCAMBIA1305, then removing the Ubiquitin promoter with EcoRI and SacI double restriction enzymes and inserting the OsKTR2 gene's own promoter.

10. A vector for knocking out the rice low potassium response transcription factor OsKTR2 as claimed in claim 1, characterized in that: Using the pYLCRISPR / Cas9-Pubi-B vector as the basic vector, primers were designed and synthesized for the target sequences T1, T2, T3 and T4 of the low potassium response transcription factor OsKTR2, and the primers were annealed and inserted between the BsaI restriction sites of the basic vector, wherein the target sequence T1 is shown in SEQ ID NO.2, the target sequence T2 is shown in SEQ ID NO.3, the target sequence T3 is shown in SEQ ID NO.4, and the target sequence T4 is shown in SEQ ID NO.5.

Images