Application of OsHTT4 protein in regulation and control of heat resistance and yield of rice

Abstract

The invention discloses application of OsHTT4 protein in regulation and control of heat resistance and yield of rice. According to the invention, a CRISPR / Cas9 gene editing system is utilized to perform mutation on a rice OsHTT4 gene, and an OsHTT4 protein function deletion mutant strain is constructed. The heat stress of the obtained mutant strain shows that the tolerance of the rice to the heat stress can be remarkably improved by inhibiting the expression of the OsHTT4 protein. In addition, by inhibiting the expression of the OsHTT4 protein, the grain number per ear, the yield per plant, the tiller number and the maturing rate of the rice can be remarkably improved, and the rice yield is improved. On the basis, the invention further provides a method for improving the heat stress tolerance and / or yield of the rice, and the method is beneficial to cultivation of heat stress-resistant and high-yield rice varieties.

Description

Technical Field

[0001] The present invention belongs to the field of gene engineering technology, and more specifically, relates to the application of OsHTT4 protein in regulating the heat resistance and yield of rice. Background Art

[0002] Abiotic stress (such as high temperature, low temperature, drought, waterlogging, high salt, etc.) is an important factor affecting crop yield and quality. In recent decades, the frequent human activities have increased greenhouse gas emissions, leading to the continuous accumulation of greenhouse effect, causing global warming, and the warming rate is significant, faster than at any time in the past two thousand years, increasing the probability of heat damage events that affect crop yields. More frequent, extreme and prolonged heat waves will endanger food security.

[0003] Rice is one of the most important food crops and a plant that is sensitive to heat. Temperature has become one of the main environmental factors that restrict its yield and quality. As a sessile organism, rice cannot move to a favorable environment when experiencing high temperatures. Therefore, when exposed to high temperatures, rice suffers from heat stress, which seriously affects its growth, development, and metabolism, and is even fatal, resulting in a significant decrease in rice yield. In addition to cultivating new heat-resistant rice germplasm, there is currently no ideal method for environmental heat stress. Continuously exploring proteins related to rice's resistance to heat stress is of great significance to the cultivation of new heat-resistant rice germplasm.

[0004] Heat shock transcription factors (HSFs) are key regulators of plant heat stress responses and can be divided into three categories: HSFA, HSFB, and HSFC. Class A HSFs are mainly responsible for the expression and regulation of heat shock genes, while Class B and Class C lack the short peptide AHA motif and do not have activation function. Plant HSFs are involved in the response to various stresses such as high temperature, high salt, drought, and oxidative stress. Overexpression of HSFs can improve the heat tolerance of plants. For example, wheat plants overexpressing TaHsfA6b have enhanced heat tolerance, Arabidopsis AtHsfA4a can enhance the tolerance of plants to salt and oxidative stress, and plants are highly sensitive to salt after being knocked out. However, the stresses involved in HSFs in different plants are not the same, and it is impossible to predict based on the same genes. Moreover, HSFs do not necessarily increase yield while improving the tolerance of plants to stress. For example, whether OsHsf18 is overexpressed or interfered, the fruit setting rate of rice is reduced and the thousand-grain weight is reduced. Summary of the invention

[0005] In order to promote the cultivation of new heat-resistant rice germplasm, the present invention discovered a protein related to the heat stress resistance of rice, namely, OsHTT4 protein, thereby providing the application of OsHTT4 protein in regulating the heat resistance and yield of rice.

[0006] The first object of the present invention is to provide an application of OsHTT4 protein in regulating the tolerance of rice to heat stress.

[0007] The second object of the present invention is to provide an application of a gene encoding OsHTT4 protein in regulating the tolerance of rice to heat stress.

[0008] The third object of the present invention is to provide the application of OsHTT4 protein in regulating rice yield.

[0009] The fourth object of the present invention is to provide the use of the gene encoding OsHTT4 protein in regulating rice yield.

[0010] A fifth object of the present invention is to provide a method for improving the heat stress tolerance and / or yield of rice.

[0011] The sixth object of the present invention is to provide an agent for interfering with or inhibiting the expression of OsHTT4 protein for use in improving the tolerance of rice to heat stress or in preparing a product for improving the tolerance of rice to heat stress.

[0012] A seventh object of the present invention is to provide use of an agent that interferes with or inhibits the expression of OsHTT4 protein in cultivating rice plants with improved tolerance to heat stress.

[0013] The eighth object of the present invention is to provide use of an agent that interferes with or inhibits the expression of OsHTT4 protein in increasing rice yield or in preparing a product for increasing rice yield.

[0014] The ninth object of the present invention is to provide use of an agent that interferes with or inhibits the expression of OsHTT4 protein in cultivating rice plants with improved yield.

[0015] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0016] The present invention mutates the gene encoding OsHTT4 protein in rice, constructs a mutant strain with loss of function of OsHTT4 protein, and finds that inhibiting the expression of OsHTT4 protein can improve the tolerance of rice to heat stress (heat resistance), while overexpressing OsHTT4 protein will further increase the sensitivity of rice to heat stress. In addition, inhibiting the expression of OsHTT4 protein can also increase the number of grains per panicle, yield per plant, number of tillers and fruit setting rate of rice, thereby increasing rice yield, while overexpressing OsHTT4 protein will reduce the number of grains per panicle, yield per plant, number of tillers and fruit setting rate of rice. Therefore, the present invention claims the use of OsHTT4 protein in regulating the tolerance of rice to heat stress.

[0017] The present invention also claims to protect the application of OsHTT4 protein in regulating rice yield.

[0018] Specifically, the amino acid sequence of the OsHTT4 protein is shown in SEQ ID NO.2.

[0019] Specifically, the OsHTT4 protein regulates rice yield by regulating the number of grains per panicle, yield per plant, number of tillers and fruit setting rate of rice.

[0020] The present invention also claims to protect the use of the gene encoding the OsHTT4 protein in regulating the tolerance of rice to heat stress.

[0021] The present invention also claims to protect the use of the gene encoding OsHTT4 protein in regulating rice yield.

[0022] In a specific embodiment of the present invention, the regulating the tolerance of rice to heat stress is regulating the tolerance of rice to heat stress at the seedling stage.

[0023] Optionally, the nucleotide sequence of the gene encoding the OsHTT4 protein is shown in SEQ ID NO.1.

[0024] The present invention also provides a method for improving the heat stress tolerance and / or yield of rice, which comprises inhibiting the expression of OsHTT4 protein in rice.

[0025] The method of inhibiting the expression of OsHTT4 protein in rice of the present invention includes reducing the expression amount of OsHTT4 protein in rice or making OsHTT4 protein unable to exert its original function.

[0026] In order to inhibit the expression of OsHTT4 protein in rice, RNA interference technology can be used to inhibit the expression of the gene encoding OsHTT4 protein; or a gene editing system can be used to cause functional mutations such as insertion, deletion or base conversion of a few bases in the coding region or promoter region of the gene encoding OsHTT4 protein; or gene editing technology can be used to delete the gene sequence encoding OsHTT4 protein.

[0027] Optionally, the gene editing system is a CRISPR / Cas9-based gene editing system.

[0028] In a specific embodiment of the present invention, the expression of OsHTT4 protein in rice is inhibited by mutating the gene encoding OsHTT4 protein.

[0029] Specifically, the method for inhibiting the expression of OsHTT4 protein in rice is as follows: designing a CRISPR / Cas9-based sgRNA sequence for the gene (or target sequence) encoding the OsHTT4 protein, connecting a DNA fragment containing the sgRNA sequence encoding the sgRNA sequence to a pCRISPR / Cas9 vector carrying a Cas9 expression cassette and transforming rice callus to achieve site-directed mutagenesis of the gene encoding the OsHTT4 protein, thereby rendering the OsHTT4 protein inoperable.

[0030] Specifically, the target sequence recognized by sgRNA conforms to the 5'-N X -NGG-3' or 5'-N X -NTT-3' sequence rule; where N represents any one of A, T, C, G, x is an integer between 19 and 20, N X express X consecutive deoxyribonucleotides.

[0031] As an optional embodiment, the nucleotide sequence of the target site recognized by the sgRNA is shown in SEQ ID NO.3.

[0032] In addition to using CRISPR / Cas9 genome editing technology, gene editing technologies such as zinc finger nucleases (ZFNs) or transcription activator-like effector nucleases (TALENs) can also be used to mutate the gene encoding the OsHTT4 protein.

[0033] Specifically, the present invention obtains a mutant strain with loss of OsHTT4 protein function by mutating the gene encoding the OsHTT4 protein in rice, comprising the following steps:

[0034] S1. Design sgRNA target sequence and adapter primer;

[0035] S2. Constructing the sgRNA vector containing the target sequence fragment: synthesizing the adapter primer, denaturing the adapter primer and moving it to room temperature to cool and complete annealing; connecting the annealed primer pair to the sgRNA vector after enzyme digestion, and verifying the positive plasmid by PCR amplification and sequencing;

[0036] S3. Construction of pCRISPR / Cas9 vector containing target sequence fragment: Cut the gRNA expression cassette containing the target sequence fragment from the gRNA, and then connect it to the pCRISPR / Cas9 vector containing the Cas9 expression cassette;

[0037] S4. Transformation: The pCRISPR / Cas9 vector containing the target site is transformed into rice callus tissue, and positive transgenic plants are identified through screening, differentiation and rooting.

[0038] S5. Identification of mutation sites: Extract DNA from positive plants, design identification primers to amplify the extracted DNA, purify it, sequence it, and analyze the mutation.

[0039] Specifically, when the target sequence is the nucleotide sequence shown in SEQ ID NO.3, the nucleotide sequences of the adapter primers are shown in SEQ ID NO.4 and SEQ ID NO.5.

[0040] Specifically, the nucleotide sequences of the primer pair used to identify the mutation site are shown in SEQ ID NO.6 and SEQ ID NO.7.

[0041] Specifically, the rice is indica rice.

[0042] More specifically, the rice is the indica rice variety Nan Guizhan.

[0043] The present invention also claims to protect the use of an agent that interferes with or inhibits the expression of OsHTT4 protein in improving the tolerance of rice to heat stress or in preparing a product for improving the tolerance of rice to heat stress.

[0044] The present invention also claims the use of agents that interfere with or inhibit the expression of OsHTT4 protein in cultivating rice plants with improved tolerance to heat stress.

[0045] The present invention also claims the use of the reagent for interfering with or inhibiting the expression of OsHTT4 protein in increasing rice yield or in preparing a product for increasing rice yield.

[0046] The present invention also claims the use of agents that interfere with or inhibit the expression of OsHTT4 protein in cultivating rice plants with improved yield.

[0047] The rice yield is increased by increasing the number of grains per panicle, the yield per plant, the number of tillers and the fruit setting rate of the rice.

[0048] The present invention has the following beneficial effects:

[0049] The present invention utilizes the CRISPR / Cas9 gene editing system to mutate the rice OsHTT4 gene, and constructs a mutant strain with loss of OsHTT4 protein function. The obtained mutant strain was subjected to heat stress, and it was found that inhibiting the expression of OsHTT4 protein can significantly improve the tolerance of rice to heat stress. In addition, inhibiting the expression of OsHTT4 protein can significantly increase the number of grains per panicle, yield per plant, number of tillers and fruit setting rate of rice, thereby increasing rice yield. Based on this, the present invention also provides a method for improving the tolerance and / or yield of rice to heat stress, which is conducive to the cultivation of heat stress-resistant and high-yield rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 The expression response of OsHTT4 gene in rice seedlings under heat stress conditions.

[0051] Figure 2 The expression of OsHTT4 gene in OsHTT4 gene mutant strain, overexpression transgenic strain and wild-type NGZ strain.

[0052] Figure 3 The phenotypes of the OsHTT4 gene mutant strain, overexpression transgenic strain and wild-type NGZ strain before and after heat stress treatment.

[0053] Figure 4 These are the test results of the heat stress tolerance of the OsHTT4 gene mutant strain, the overexpression transgenic strain and the wild-type NGZ strain. A to D in the figure are the ion leakage rate, relative water content, chlorophyll fluorescence parameters and hydrogen peroxide content test results, respectively; **p<0.001 in the figure.

[0054] Figure 5 The results of yield trait analysis of OsHTT4 gene mutant lines, overexpression transgenic lines and wild-type NGZ lines. A to E in the figure are the rice panicle phenotypes of wild-type NGZ, OsHTT4 gene mutant lines htt4-1 and htt4-2, and OsHTT4 gene overexpression transgenic lines OEHTT4-1 and OEHTT4-2, respectively. F to I in the figure are the statistical results of grain number per panicle, yield per plant, tiller number and seed setting rate, respectively; ***p<0.001 in the figure. DETAILED DESCRIPTION

[0055] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0056] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0057] The nucleotide sequence of the OsHTT4 gene of the present invention is shown in SEQ ID NO.1, and the amino acid sequence of the OsHTT4 protein encoded by the gene is shown in SEQ ID NO.2.

[0058] Example 1 Expression response of OsHTT4 gene under heat stress treatment conditions

[0059] The present invention detects the expression response of the OsHTT4 gene in rice seedlings under heat stress treatment conditions by qPCR.

[0060] The rice used in the experiment was 14-day-old seedlings of the indica rice variety Nanguizhan (NGZ). Rice seedlings cultured under normal conditions of 28°C and 12h light / 12h were used as controls. The heat stress treatment conditions were 45°C, 12h light / 12h dark. Samples were taken at 0, 2, 4, 6, 8, 10, 12, 16, 20, 24, 36 and 48h of heat treatment, and total RNA was extracted and reverse transcribed into cDNA. The obtained cDNA was used as a template for qPCR detection, and the internal reference used was Actin.

[0061] The nucleotide sequences of the qPCR primers and internal reference primers used in qPCR detection are as follows:

[0062] qPCR Primer F: TGGACAGCGGCTACTAAAGC

[0063] qPCR Primer R: ACAGCCACTTCGTCCAAACA

[0064] Internal reference primer F: CACATTCCAGCAGATGTGGA

[0065] Internal reference primer R: GCGATAACAGCTCCTCTTGG

[0066] The qPCR reaction system and reaction conditions are shown in Tables 1 and 2 below respectively:

[0067] Table 1 qPCR reaction system

[0068]

[0069] Table 2 qPCR reaction conditions

[0070]

[0071] The expression response of OsHTT4 gene in rice seedlings under heat stress conditions is shown in Figure 2. Figure 1 As shown. Figure 1 It can be seen that the RNA expression level of OsHTT4 increased in the wild-type plants at 8h after heat stress treatment, indicating that it responded to heat stress.

[0072] Example 2 Obtaining OsHTT4 gene mutant strains

[0073] The present invention utilizes CRISPR / Cas9 technology to mutate the OsHTT4 gene, thereby constructing an OsHTT4 gene mutant strain, and the specific process is as follows:

[0074] 1. Design of sgRNA target sequence and adapter primer

[0075] The present invention designs the target sequence for the OsHTT4 gene using the targetDesign applet (http: / / skl.scau.edu.cn / targetdesign / ) (reference: DOI: http: / / dx.doi.org / 10.1016 / j.molp.2017.06.004).

[0076] The sgRNA target sequence (5'→3') designed in this example is:

[0077] Target-HTT4-U3: CCGACGGCGTCATCGCCTG (shown in SEQ ID NO. 3)

[0078] Based on the target sequence, the adapter primer (5'→3') with sticky ends was designed as follows:

[0079] Target-HTT4-U3F: ggcaCCGACGGCGTCATCGCCTG (shown in SEQ ID NO.4)

[0080] Target-HTT4-U3R: aaacCAGGCGATGACGCCGTCGG (shown in SEQ ID NO.5)

[0081] 2. Construction of pU3-gRNA vector containing Target-HTT4 fragment

[0082] The designed adapter primer with sticky ends was commissioned to Beijing Qingke Biotechnology Co., Ltd. for synthesis. The synthesized adapter primer was heated at 90°C for 30 seconds for denaturation and then moved to room temperature for cooling to complete annealing. The annealed primer was connected to the pU3-gRNA vector after enzyme digestion. The positive plasmid was verified by PCR amplification and sequencing to obtain the pU3-gRNA vector containing the Target-HTT4-U3 fragment.

[0083] The PCR primers used to verify the positive plasmid were Target-HTT4-U3F / Target-HTT4-U3R.

[0084] 3. Construction of pCRISPR / Cas9 vector containing Target-HTT4-U3 fragment

[0085] The expression cassette containing the Target-HTT4-U3 fragment was cut out from the positive plasmid constructed above, and then ligated to the pCRISPR / Cas9 vector containing the Cas9 expression cassette. The positive plasmid was verified by PCR amplification and sequencing to obtain the pCRISPR / Cas9 vector containing the Target-HTT4-U3 fragment.

[0086] 4. Obtaining mutant strains

[0087] The pCRISPR / Cas9 vector containing the target (Target-HTT4-U3) was transformed into callus tissue of the rice indica variety Nanguizhan through Agrobacterium tumefaciens-mediated genetic transformation; after secondary screening, differentiation and rooting into seedlings, the resulting plants were planted in a net room, and mutant strains were identified and screened by sequencing.

[0088] 5. Sequencing and identification of mutation sites in mutant strains

[0089] The genomic DNA of the positive mutant strain was extracted, and the extracted genomic DNA was used as a template for PCR amplification with primers HTT4TF (AGGGCGCGCACACGCGTCCT; shown in SEQ ID NO.6) and HTT4TR (AACAAGAGCACGAATCTCAA; shown in SEQ ID NO.7). The product was purified and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the target sequence of the wild-type Nanguizhan plant before mutation to analyze the mutation.

[0090] The PCR amplification reaction system is shown in Table 3:

[0091] Table 3 PCR amplification reaction system

[0092]

[0093] The PCR amplification reaction conditions were as follows: 94°C for 2 min; 94°C for 20 sec, 58°C for 20 sec, 72°C for 30 sec, 30 cycles; 72°C for 5 min.

[0094] In this example, two different mutant strains were obtained, named htt4-1 and htt4-2. The sequencing results (5'→3') of the wild-type Nanguizhan and the mutant strains are as follows:

[0095] WT: GCCACCGACGGCGTCATCGCCTGGGGC

[0096] htt4-1:GCCACCGACGGCGTCATCGCC CC GGGC

[0097] htt4-2:GCCACCGACGGCGTCATC--CTGGGGC

[0098] Among them, WT represents the wild type; htt4-1 and htt4-2 represent different mutant strains; in the sequence shown in SEQ ID NO.9, " CC” is the mutated base; “--” in the sequence shown in SEQ ID NO.10 indicates base deletion. By comparison, compared with the wild type, the mutant strain obtained in this embodiment has base deletion or mutation in the target sequence, indicating that the present invention successfully mutated the OsHTT4 gene and obtained the OsHTT4 gene mutant strain (OsHTT4 protein function loss mutant strain).

[0099] Example 3 Obtaining OsHTT4 gene overexpression transgenic strain

[0100] The present invention uses the genetic transformation method mediated by Agrobacterium EHA105 to transfer the overexpression recombinant vector of the OsHTT4 gene into the callus tissue of the wild-type indica rice variety Nanguizhan, thereby constructing a transgenic strain of the OsHTT4 gene overexpression, specifically referring to the method described in the literature (Zhou Lingyan, Jiang Dagang, Wu Hao, et al. Establishment of a rice transformation system based on TAC vector [J]. Journal of Genetics, 2005, 32(005): 514-518.). After screening, pre-differentiation and differentiation, T0 generation transformed plants are obtained and PCR and fluorescence quantitative PCR are performed on them to determine whether they are positive transformed plants. The positive transformed plants were self-pollinated to obtain transgenic 1 (T1) generation strains, and 10 plants that tested positive by PCR were selected from each strain for self-pollination to obtain T2 generation strains; the T2 generation strains were further subjected to PCR testing to obtain two T2 generation homozygous strains derived from different T0 generation plants, which were named OEHTT4-1 and OEHTT4-2 respectively.

[0101] Total RNA was extracted from the flag leaves of the OsHTT4 mutant strains htt4-1 and htt4-2 and the overexpression transgenic strains OEHTT4-1 and OEHTT4-2 at the flowering stage and reverse transcribed to obtain cDNA. The obtained cDNA was used as a template for qPCR to detect the expression level changes of the target gene OsHTT4, and the detection results of the wild-type (WT) plants were used as a control. The primers and methods used for qPCR detection were the same as those in Example 1.

[0102] The expression of OsHTT4 gene in OsHTT4 gene mutant strains, overexpression transgenic strains and wild-type NGZ strains is shown in Figure 2. Figure 2 As shown. Figure 2 It can be seen that the OsHTT4 gene is lowly expressed in the wild-type NGZ strain, is basically not expressed in the OsHTT4 gene mutant strains htt4-1 and htt4-2, and is highly expressed in the OsHTT4 gene overexpression transgenic strains OEHTT4-1 and OEHTT4-2, which are significantly different from the wild-type NGZ (p < 0.001), indicating that the present invention successfully constructed the OsHTT4 mutant strain and overexpression transgenic strain.

[0103] Example 4 Detection of heat resistance of OsHTT4 gene mutant strains and overexpression transgenic strains

[0104] In this example, the positive mutant strains and overexpression transgenic strains identified in Example 2 and Example 3 were subjected to heat stress treatment, and the phenotypic changes of the plants before and after the heat stress treatment were compared, and the ion leakage rate (R1 / R2), relative water content, chlorophyll fluorescence parameters (Fv / Fm) and hydrogen peroxide (H2O2) content of the plants after the heat stress treatment were detected to observe the effect of the mutation or overexpression of the OsHTT4 gene on the tolerance (heat resistance) of rice to heat stress.

[0105] Heat stress treatment: Select a number of plump seeds of the wild-type NGZ, OsHTT4 mutant strains htt4-1 and htt4-2, and overexpression transgenic strains OEHTT4-1 and OEHTT4-2, water them, and clamp them on a 96-well plate for hydroponics after the seeds germinate; after growing for 14 days, select seedlings with consistent growth and treat them with heat stress. The heat stress treatment conditions are: 45℃, 12h light / 12h dark, and the heat stress treatment time is 7 days; after heat stress treatment, place them at 28℃ for recovery, and the recovery time is 5 days.

[0106] Determination of ion leakage rate (R1 / R2): add 10 mL of sterilized ddH2O to a 15 mL sterilized centrifuge tube, cut 0.05 g of rice seedling leaves of equivalent size into small pieces, put them into the above 15 mL centrifuge tube, completely immerse the leaves therein, and shake at 100 rpm at room temperature overnight; after overnight, turn the 15 mL centrifuge tube upside down to mix well, and then measure it with a conductivity meter to obtain the value R1; after obtaining the value R1, put the 15 mL centrifuge tube into boiling water and boil it for 15 minutes, cool it naturally to room temperature, and measure it for the second time with a conductivity meter to obtain the value R2; the ratio of R1 to R2 is the ion leakage rate.

[0107] Determination of hydrogen peroxide (H2O2) content: Use the Bio-Tech Hydrogen Peroxide Content Detection Kit (Cat. No.: S0038) for determination. For specific operations, refer to the kit instructions.

[0108] The phenotypes of OsHTT4 mutant strains, overexpression transgenic strains and wild-type NGZ strains before and after heat stress treatment are as follows: Figure 3 As shown. Figure 3 It can be seen that after heat stress treatment, the leaves of htt4-1 and htt4-2 mutant strains did not shrink or die, while the NGZ strain and the plants overexpressing OsHTT4 showed high temperature intolerance.

[0109] The results of ion leakage rate, relative water content, chlorophyll fluorescence parameters and hydrogen peroxide content of OsHTT4 gene mutant strain, overexpression transgenic strain and wild-type NGZ strain after heat stress treatment are shown in the table below. Figure 4 As shown in A to D. Figure 4 It can be seen that compared with the wild-type NGZ strain, the ion leakage rate and hydrogen peroxide content of the OsHTT4 gene mutant strains htt4-1 and htt4-2 after heat stress treatment decreased, and the relative water content and chlorophyll fluorescence parameters increased, with significant differences (p < 0.001), indicating that hindering the normal expression of the OsHTT4 gene through mutation can significantly improve the stress resistance of rice and improve its heat tolerance.

[0110] Example 5 Yield trait analysis of OsHTT4 gene mutant strains and overexpression transgenic strains

[0111] Several full seeds of the wild-type NGZ, OsHTT4 mutant lines htt4-1 and htt4-2, and overexpression transgenic lines OEHTT4-1 and OEHTT4-2 were selected and grown to maturity according to conventional planting and management methods, and yield traits were analyzed (grain number per panicle, plant weight, tiller number, and seed setting rate were counted).

[0112] The yield trait analysis results of OsHTT4 gene mutant strains, overexpression transgenic strains and wild-type NGZ strains are shown in Figure 5 As shown in the figure; A to E in the figure are the rice panicle phenotypes of wild-type NGZ, OsHTT4 gene mutant lines htt4-1 and htt4-2, and OsHTT4 gene overexpression transgenic lines OEHTT4-1 and OEHTT4-2, respectively, and F to I in the figure are the statistical results of grain number per panicle, single plant yield, tillering number and seed setting rate. Figure 5 It can be seen that the number of grains per panicle, yield per plant, number of tillers and fruit setting rate of the OsHTT4 gene mutant strains htt4-1 and htt4-2 were significantly different from those of the wild type NGZ (p < 0.001), indicating that blocking the expression of the OsHTT4 gene through mutation can significantly increase the number of grains per panicle, yield per plant, number of tillers and fruit setting rate of rice, thereby increasing rice yield.

[0113] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Application of OsHTT4 protein in regulating the tolerance of rice to heat stress, characterized in that: The amino acid sequence of the OsHTT4 protein is shown in SEQ ID NO.

2.

2. Application of a gene encoding OsHTT4 protein in regulating the tolerance of rice to heat stress, characterized in that: The amino acid sequence of the OsHTT4 protein is shown in SEQ ID NO.

2.

3. Application of OsHTT4 protein in regulating rice yield, characterized in that: The amino acid sequence of the OsHTT4 protein is shown in SEQ ID NO.

2.

4. Application of a gene encoding OsHTT4 protein in regulating rice yield, characterized in that: The amino acid sequence of the OsHTT4 protein is shown in SEQ ID NO.

2.

5. A method for improving the tolerance and / or yield of rice to heat stress, characterized in that: The method is to inhibit the expression of OsHTT4 protein in rice, and the amino acid sequence of the OsHTT4 protein is shown in SEQ ID NO.

2.

6. The method according to claim 5, characterized in that: The expression of OsHTT4 protein in rice is inhibited by mutating or knocking out the gene encoding OsHTT4 protein.

7. Use of an agent for interfering with or inhibiting the expression of OsHTT4 protein in improving the tolerance of rice to heat stress or in preparing a product for improving the tolerance of rice to heat stress, characterized in that: The amino acid sequence of the OsHTT4 protein is shown in SEQ ID NO.

2.

8. Use of an agent that interferes with or inhibits the expression of OsHTT4 protein in cultivating rice plants with improved tolerance to heat stress, characterized in that: The amino acid sequence of the OsHTT4 protein is shown in SEQ ID NO.

2.

9. Use of an agent for interfering with or inhibiting the expression of OsHTT4 protein in increasing rice yield or in preparing a product for increasing rice yield, characterized in that: The amino acid sequence of the OsHTT4 protein is shown in SEQ ID NO.

2.

10. Use of an agent for interfering with or inhibiting the expression of OsHTT4 protein in cultivating rice plants with increased yield, characterized in that: The amino acid sequence of the OsHTT4 protein is shown in SEQ ID NO.2.

Images