Specific molecule identity card for identifying pier-head pigs and application of specific molecule identity card

Abstract

The invention discloses a specific molecular identity card for identifying a pier-head pig and application of the specific molecular identity card. The specific molecular identity card is a unique homozygous SNP (Single Nucleotide Polymorphism) site set of the pier-head pig. According to the method, the specific molecular marker of the pier-head pig is screened at the genome level through a molecular biological technology, and the symbolic genetic difference between the pier-head pig and other varieties can be revealed, so that the purpose of identifying the varieties is achieved. The method for obtaining the specific molecular marker of the pier head pig comprises the following steps: carrying out selective clearance analysis by calculating a genetic differentiation index (Fst) and a nucleotide polymorphism (pi) ratio, screening a selected region of the pier head pig, selecting a homozygous SNP site of the pier head pig in the region as candidate specific SNPs, carrying out genetic typing by virtue of a KASP typing technology, and screening out the specific molecular marker of the pier head pig. And counting the genotype frequency of each site in different varieties so as to screen out the specific molecular marker of the pier-head pig.

Description

Technical Field

[0001] The invention belongs to the field of pig breed identification, relates to the germplasm resources of Duntou pigs, and particularly refers to a specific molecular identity card for identifying Duntou pigs and an application thereof. Technical Background

[0002] The protection and development of local breeds in Hainan will contribute to the sustainable development of Hainan's pig industry and the enrichment of livestock resource diversity. In particular, the study of the specific genetic structure and characterization of local pig breeds will help to formulate special breed protection plans based on the genetic situation of the breeds, promote the specific protection of local breeds, and preserve the unique variations, genes and characteristics of each breed. It is essential to maintain biodiversity and adapt to future environmental changes. Therefore, the use of bioinformatics to identify the unique genetic characteristics of the Duntou pig, a local pig breed in Hainan, is an important part of accurately protecting local pig breed resources.

[0003] Duntou pigs are produced in coastal villages (fishing villages) such as Duntou, Xinjie, Gangbei, Beili, Jianbanyuan, Changyi, and Yixing in Basuo Town, Dongfang City. As the central production area of ​​Duntou pigs is located by the sea and Xinjie Salt Field, and the Beili River flows by, green fodder and animal protein feed (small fish and shrimp) are extremely abundant, especially wild green fodder seaweed and seaweed, which are rich in salt. The pork of suckling pigs has a light milky smell, thin skin, tender meat, and fragrant taste. It is a superior raw material for making roast suckling pigs and white-cut suckling pigs. With the gradual improvement of bioinformatics, whole genome sequencing analysis has been widely used to analyze livestock and poultry genome information. In the process of selecting local pig breeds, a large number of selection marks are left in their genomes, forming unique breed characteristics, which have certain advantages in meat quality, disease resistance and reproductive performance. Therefore, protecting local pig breeds can greatly enrich the genetic resources of Hainan Province, protect the diversity of local pigs, and retain the excellent genes of local pig breeds.

[0004] In order to further accurately identify Duntou pigs, the present invention uses a selective clearing method to explore the specific sites of Duntou pigs and combines KASP typing technology to develop and verify the specific molecular identity card of Duntou pigs, which can clarify the genetic background of local pig breeds and provide technical support for the identification, breeding and protection of Hainan Duntou pigs. Summary of the invention

[0005] To achieve the above-mentioned purpose, the present invention proposes a specific molecular ID card for identifying Duntou pigs and its application.

[0006] The technical solution of the present invention is achieved in this way:

[0007] In the first aspect, the present invention protects a specific molecular ID card for identifying Duntou pigs, wherein the specific molecular ID card is a collection of homozygous SNP sites unique to Duntou pigs.

[0008] The collection of SNP sites includes:

[0009] SNP1 site: CHR1:124873505, SNP2 site: CHR1:129629182,

[0010] SNP3 site: CHR1:129717791, SNP4 site: CHR7:57455527,

[0011] SNP5 site: CHR7:57455569, SNP6 site: CHR7:57459036,

[0012] SNP7 site: CHR7:57459855, SNP8 site: CHR7:57460468;

[0013] The genotype of the SNP1 site is A / A, the genotype of the SNP2 site is C / C, the genotype of the SNP3 site is C / C, the genotype of the SNP4 site is A / A, the genotype of the SNP5 site is G / G, the genotype of the SNP6 site is G / G, the genotype of the SNP7 site is G / G, and the genotype of the SNP8 site is G / G.

[0014] Furthermore, its specific information is shown in Table 1.

[0015] Table 1 Specific loci of Duntou pig breed

[0016] Serial number chromosome Location Mutation type 1 CHR1 124873505 G / A 2 CHR1 129629182 C / A 3 CHR1 129717791 C / A 4 CHR7 57455527 A / G 5 CHR7 57455569 A / G 6 CHR7 57459036 A / G 7 CHR7 57459855 A / G 8 CHR7 57460468 C / G

[0017] In the second aspect, the present invention protects KASP typing primers for specific sites for identifying Duntou pig breeds, and the sites and corresponding primers are as follows:

[0018] SNP1 site: CHR1:124873505

[0019] Upstream primer F1: ACTGCATCAAACACTATTTCTCTGAC, as shown in SEQ ID NO: 1;

[0020] Upstream primer F2: CACTGCATCAAACACTATTTCTCTGAT, as shown in SEQ ID NO: 2;

[0021] Downstream primer R: ACGCACAGCATTTATGAAGTATCCCATTT, as shown in SEQ ID NO: 3;

[0022] SNP2 site: CHR1:129629182

[0023] Upstream primer F1: GTGCCATCCTATGCAAACCCAGA, as shown in SEQ ID NO: 4;

[0024] Upstream primer F2: GCCATCCTATGCAAACCCAGC, as shown in SEQ ID NO: 5;

[0025] Downstream primer R: GCAACYGTGTCCCGTGGGAGAA, as shown in SEQ ID NO: 6;

[0026] SNP3 site: CHR1:129717791

[0027] Upstream primer F1: TCTCCCACGGGACACCG, as shown in SEQ ID NO: 7;

[0028] Upstream primer F2: CCTTCTCCCACGGGACACCA, as shown in SEQ ID NO: 8;

[0029] Downstream primer R: CTACCTCTGGTTATTGTTAGGAATTGCAA, as shown in SEQ ID NO: 9;

[0030] SNP4 site: CHR7:57455527

[0031] Upstream primer F1: AAGGAAATTCTTGCAGGCTGAGC, as shown in SEQ ID NO: 10;

[0032] Upstream primer F2: CAAGGAAATTCTTGCAGGCTGAGT, as shown in SEQ ID NO: 11;

[0033] Downstream primer R: GGCATCAAGAGTTGCATGAGGAGTT, as shown in SEQ ID NO: 12;

[0034] SNP5 site: CHR7:57455569

[0035] Upstream primer F1: CCCACCCAGAAAGGTCTGTGTA, as shown in SEQ ID NO: 13 Upstream primer F2: CCACCCAGAAAGGTCTGTGTG, as shown in SEQ ID NO: 14 Downstream primer R: TCTCCTCTTTAGCACTCATCATACAGAAA, as shown in SEQ ID NO: 15;

[0036] SNP6 site: CHR7:57459036

[0037] Upstream primer F1: GACCTTACACTTTAGTTGTGTTCAGG, as shown in SEQ ID NO: 16 Upstream primer F2: GACCTTACACTTTAGTTGTGTTCAGA, as shown in SEQ ID NO: 17 Downstream primer R: GACACCTCGGAAACCATTGTTAGAATTAT, as shown in SEQ ID NO: 18;

[0038] SNP7 site: CHR7:57459855

[0039] Upstream primer F1: AACCTACATGCATCTTAGAGCTCC, as shown in SEQ ID NO: 19;

[0040] Upstream primer F2: CAACCTACATGCATCTTAGAGCTCA, as shown in SEQ ID NO: 20; Downstream primer R: GCTTAGAAGAAAGAACAGGCTGACAAATT, as shown in SEQ ID NO: 21;

[0041] SNP8 site: CHR7:57460468

[0042] Upstream primer F1: GGATGTCAGGTGTTATTGTTATCTCG, as shown in SEQ ID NO: 22;

[0043] Upstream primer F2: AGGATGTCAGGTGTTATTGTTATCTCA, as shown in SEQ ID NO: 23; downstream primer R: TGATTATCCAGAGCTTAAATGAAACCTGTT, as shown in SEQ ID NO: 24.

[0044] In a third aspect, the present invention protects a reagent containing the primers described above.

[0045] In a fourth aspect, the present invention protects a kit containing the primers or reagents described above.

[0046] In a fifth aspect, the present invention also protects the use of the aforementioned molecular ID card, the aforementioned primer, the aforementioned reagent or the aforementioned kit in identifying the Duntou pig breed.

[0047] In a sixth aspect, the present invention also protects the use of the aforementioned molecular ID card, the aforementioned primer, the aforementioned reagent or the aforementioned kit in detecting whether there is a Duntou pig breed in a sample to be tested.

[0048] In a seventh aspect, the present invention also protects the use of the aforementioned molecular ID card, the aforementioned primer, the aforementioned reagent or the aforementioned kit in the preparation of a product for identifying the Duntou pig breed.

[0049] In an eighth aspect, the present invention also protects the use of the aforementioned molecular ID card, the aforementioned primer, the aforementioned reagent or the aforementioned kit in the preparation of a product for detecting whether a sample to be tested contains the Duntou pig breed.

[0050] In a specific embodiment, the product can be a system, a device, etc.

[0051] Preferably, the system or device is equipped with the primers described above, the reagents described above or the kit described above.

[0052] In the ninth aspect, the present invention also protects a method for identifying the Duntou pig breed.

[0053] In a specific embodiment, the method comprises the steps of:

[0054] (1) Collecting tissue samples from the pigs to be tested and extracting genomic DNA;

[0055] (2) Using KASP typing technology to detect the genotypes of the above 8 SNP sites of the test samples;

[0056] (3) When the genotype of the SNP1 site is A / A, the genotype of the SNP2 site is C / C, the genotype of the SNP3 site is C / C, the genotype of the SNP4 site is A / A, the genotype of the SNP5 site is G / G, the genotype of the SNP6 site is G / G, the genotype of the SNP7 site is G / G, and the genotype of the SNP8 site is G / G, the test sample is Duntou pig.

[0057] The present invention has the following beneficial effects:

[0058] By screening breed-specific molecular markers at the genome level through molecular biology technology, the standard differences between breeds can be revealed. The present invention uses molecular biology technology to explore the characteristics of precious genetic resources of local pigs, which is conducive to promoting the protection and innovative use of local pig genetic resources in Hainan Province, and promoting the high-quality development of pig farming, breeding and seed conservation in Hainan Province.

[0059] Genotype detection was performed on eight loci of the test sample DNA, including CHR1:124873505, CHR1:129629182, CHR1:129717791, CHR7:57455527, CHR7:57455569, CHR7:57459036, CHR7:57459855, and CHR7:57460468. When the genotype of CHR1:124873505 is A / A, the genotype of CHR1:129629182 is C / C, the genotype of CHR1:129717791 is C / C, the genotype of CHR7:57455527 is A / A, the genotype of CHR7:57455569 is G / G, the genotype of CHR7:57459036 is G / G, the genotype of CHR7:57459855 is G / G, and the genotype of CHR7:57460468 is G / G, the test sample is Duntou pig. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0061] Figure 1 This is the selection signal analysis result of the Duntou pig genetic differentiation index (Fst) provided by the present invention.

[0062] Figure 2 The present invention provides the analysis results of the Duntou pig nucleic acid polymorphism (π).

[0063] Figure 3 This is a principal component analysis verification diagram of the candidate specific loci of the Duntou pig variety provided by the present invention. (BMX = Bama Xiang pig, DT = Duntou pig, LC = Luchuan pig, TC = Tunchang pig, LG = Lingao pig, WC = Wenchang pig, WZS = Wuzhishan pig) DETAILED DESCRIPTION

[0064] The technical scheme of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention and application examples. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without paying creative work are within the scope of protection of the present invention. If the manufacturer is not indicated in the reagents or instruments and equipment, they are deemed to be conventional products that can be purchased on the market.

[0065] Example 1

[0066] A method for screening and verifying the specific molecular ID card of the Duntou pig breed, the specific steps are:

[0067] (1) The screening test data were the whole genome resequencing data of 131 pigs collected in the laboratory in the early stage, including seven breeds: Duntou pig (DT, n = 29), Luchuan pig (LC, n = 15), Tunchang pig (TC, n = 29), Lingao pig (LG, n = 6), Wuzhishan pig (WZS, n = 29), Wenchang pig (WC, n = 29), and Bama Xiang pig (BMX, n = 6).

[0068] (2) Genetic data quality control and genotype filling

[0069] (3) PLINK software was used to perform quality control on genomic data. Genotype data were filtered using the following parameters: individual genotype detection rate (--mind) > 90%, marker genotype detection rate (--geno) > 95%, minimum allele frequency (--maf) > 1%, minimum Hardy-Weinberg equilibrium (--hwe) > 10 -6 , located in the autosomes. The missing genotypes were filled in the BEAGLE software using the Hidden Markov Model (HMM) algorithm.

[0070] (4) Selective removal analysis

[0071] In this study, 10kb was used as the sliding window and 5kb as the sliding step. The ratio of genetic differentiation index (Fst) and nucleotide polymorphism (π) in each window was calculated to perform selective clearance analysis. The two selection analysis methods of Fst and π value were combined to detect the strong selection signal between Duntou pigs and non-Duntou pigs, and the top 5% of the windows were taken as candidate regions to screen the selected regions of Duntou pigs.

[0072] (5) Screening of Duntou pig-specific SNP loci

[0073] The homozygous SNPs sites specific to Duntou pigs in the selected area of ​​Duntou pigs in step (3) are extracted as candidate specific SNPs for Duntou pigs and subjected to principal component analysis.

[0074] (6) Total DNA extraction, quality testing and genotyping

[0075] The validation test samples were tissue samples of 80 Duntou pigs, 40 Erhualian pigs, 40 Sanyuan pigs and 40 Binary pigs retained in the laboratory.

[0076] The DNA of the above individuals was extracted by chloroform method, and the purity and concentration of the extracted DNA were detected by agarose gel electrophoresis and Nanodrop-2000 UV spectrophotometer, and the DNA samples with qualified quality were retained.

[0077] Primers were designed for the candidate specific SNPs screened in step (4), and FAM tag sequences and HEX tag sequences were added to the upstream primer ends, respectively, as shown in Table 2. KASP typing was performed on the DNA sample retained in step (5), the KASP reaction system was shown in Table 3, the KASP reaction procedure was shown in Table 4, and the genotypes of each candidate site in the sample were statistically verified.

[0078] The genotypes of eight SNPs: CHR1:124873505, CHR1:129629182, CHR1:129717791, CHR7:57455527, CHR7:57455569, CHR7:57459036, CHR7:57459855, CHR7:57460468 in Duntou pig breed are A / A, C / C, C / C, A / A, G / G, G / G, G / G, G / G, respectively, while the above sites are mostly heterozygous or wild-type in non-Duntou pig breeds, and the specific information is shown in Table 5. This shows that the combination of these 8 sites can be used as a molecular ID card for identifying Duntou pigs, with an accuracy rate of more than 95%.

[0079] Table 2 KASP typing primers for breed-specific loci of Duntou pig

[0080]

[0081] Table 3 KASP reaction system

[0082]

[0083] Table 4 KASP reaction procedure

[0084]

[0085] Table 5 Statistics of KASP typing results of each variety

[0086]

[0087] Application Examples

[0088] A method for identifying a pig breed to be tested specifically comprises the following steps:

[0089] Take tissue samples from the pigs to be tested and extract DNA from the tissue samples.

[0090] Genotype detection was performed on eight loci of the test sample DNA, including CHR1:124873505, CHR1:129629182, CHR1:129717791, CHR7:57455527, CHR7:57455569, CHR7:57459036, CHR7:57459855, and CHR7:57460468.

[0091] When the genotype of CHR1:124873505 is A / A, the genotype of CHR1:129629182 is C / C, the genotype of CHR1:129717791 is C / C, the genotype of CHR7:57455527 is A / A, the genotype of CHR7:57455569 is G / G, the genotype of CHR7:57459036 is G / G, the genotype of CHR7:57459855 is G / G, and the genotype of CHR7:57460468 is G / G, the test sample is Duntou pig.

[0092] The protection content of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention and are protected by the attached claims.

Claims

1. A specific molecular ID card for identifying Duntou pigs, characterized in that: The specific molecular ID card is a collection of homozygous SNP sites unique to Duntou pigs, and the collection of SNP sites includes: SNP1 site: located at CHR1:124873505, SNP2 site: located at CHR1:129629182, SNP3 site: located at CHR1: 129717791, SNP4 site: located at CHR7: 57455527, SNP5 site: located at CHR7:57455569, SNP6 site: located at CHR7:57459036, SNP7 site: located at CHR7:57459855, SNP8 site: located at CHR7:57460468; When the genotype of the SNP1 site is A / A, the genotype of the SNP2 site is C / C, the genotype of the SNP3 site is C / C, the genotype of the SNP4 site is A / A, the genotype of the SNP5 site is G / G, the genotype of the SNP6 site is G / G, the genotype of the SNP7 site is G / G, and the genotype of the SNP8 site is G / G, it is a Duntou pig.

2. KASP typing primers for identifying the SNP loci of Duntou pig breed, the loci and their corresponding primers are as follows: SNP1 site: located at CHR1:124873505 Upstream primer F1: ACTGCATCAAACACTATTTCTCTGAC, as shown in SEQ ID NO: 1; Upstream primer F2: CACTGCATCAAACACTATTTCTCTGAT, as shown in SEQ ID NO: 2; Downstream primer R: ACGCACAGCATTTATGAAGTATCCCATTT, as shown in SEQ ID NO: 3; SNP2 site: located at CHR1:129629182 Upstream primer F1: GTGCCATCCTATGCAAACCCAGA, as shown in SEQ ID NO: 4; Upstream primer F2: GCCATCCTATGCAAACCCAGC, as shown in SEQ ID NO: 5; Downstream primer R: GCAACYGTGTCCCGTGGGAGAA, as shown in SEQ ID NO: 6; SNP3 site: located at CHR1:129717791 Upstream primer F1: TCTCCCACGGGACACCG, as shown in SEQ ID NO: 7; Upstream primer F2: CCTTCTCCCACGGGACACCA, as shown in SEQ ID NO: 8; Downstream primer R: CTACCTCTGGTTATTGTTAGGAATTGCAA, as shown in SEQ ID NO: 9; SNP4 site: located at CHR7:57455527 Upstream primer F1: AAGGAAATTCTTGCAGGCTGAGC, as shown in SEQ ID NO: 10; Upstream primer F2: CAAGGAAATTCTTGCAGGCTGAGT, as shown in SEQ ID NO: 11; Downstream primer R: GGCATCAAGAGTTGCATGAGGAGTT, as shown in SEQ ID NO: 12; SNP5 site: located at CHR7:57455569 Upstream primer F1: CCCACCCAGAAAGGTCTGTGTA, as shown in SEQ ID NO: 13 Upstream primer F2: CCACCCAGAAAGGTCTGTGTG, as shown in SEQ ID NO: 14 Downstream primer R: TCTCCTCTTTAGCACTCATCATACAGAAA, as shown in SEQ ID NO: 15; SNP6 site: located at CHR7:57459036 Upstream primer F1: GACCTTACACTTTAGTTGTGTTCAGG, as shown in SEQ ID NO: 16 Upstream primer F2: GACCTTACACTTTAGTTGTGTTCAGA, as shown in SEQ ID NO: 17 Downstream primer R: GACACCTCGGAAACCATTGTTAGAATTAT, as shown in SEQ ID NO: 18; SNP7 site: located at CHR7:57459855 Upstream primer F1: AACCTACATGCATCTTAGAGCTCC, as shown in SEQ ID NO: 19; Upstream primer F2: CAACCTACATGCATCTTAGAGCTCA, as shown in SEQ ID NO: 20 Downstream primer R: GCTTAGAAGAAAGAACAGGCTGACAAATT, as shown in SEQ ID NO: 21; SNP8 site: located at CHR7:57460468 Upstream primer F1: GGATGTCAGGTGTTATTGTTATCTCG, as shown in SEQ ID NO: 22; Upstream primer F2: AGGATGTCAGGTGTTATTGTTATCTCA, as shown in SEQ ID NO: 23 Downstream primer R: TGATTATCCAGAGCTTAAATGAAACCTGTT, as shown in SEQ ID NO:

24.

3. A reagent containing the primer according to claim 2.

4. A kit comprising the primer according to claim 2 or the reagent according to claim 3.

5. Use of the molecular ID card described in claim 1, the primer described in claim 2, the reagent described in claim 3 or the kit described in claim 4 in identifying Duntou pig breeds.

6. Use of the molecular ID card of claim 1, the primer of claim 2, the reagent of claim 3 or the kit of claim 4 in detecting whether there is a Duntou pig breed in a sample to be tested.

7. Use of the molecular ID card of claim 1, the primer of claim 2, the reagent of claim 3 or the kit of claim 4 in the preparation of a product for identifying Duntou pig breeds.

8. Use of the molecular ID card of claim 1, the primer of claim 2, the reagent of claim 3 or the kit of claim 4 in preparing a product for detecting whether a sample to be tested contains the Duntou pig breed.

9. The use according to claim 7 or 8, characterized in that: The product may be a system or a device.

10. A method for identifying the breed of Duntou pigs, characterized in that: The method comprises the following steps: (1) Collect tissue samples from the pigs to be tested and extract genomic DNA; (2) using KASP typing technology to detect the genotype of the specific molecular ID card described in claim 1 in the sample to be tested; (3) When the genotype of the SNP1 site is A / A, the genotype of the SNP2 site is C / C, the genotype of the SNP3 site is C / C, the genotype of the SNP4 site is A / A, the genotype of the SNP5 site is G / G, the genotype of the SNP6 site is G / G, the genotype of the SNP7 site is G / G, and the genotype of the SNP8 site is G / G, the test sample is Duntou pig.

Images