MWCNTs-Au electrochemical biosensor based on RPA-CRISPR as well as preparation method and application of MWCNTs-Au electrochemical biosensor

Abstract

The invention provides an MWCNTs-Au electrochemical biosensor based on RPA-CRISPR as well as a preparation method and application of the MWCNTs-Au electrochemical biosensor, and belongs to the technical field of preparation of electrochemical biosensors and detection of pathogenic bacteria of dairy products. The electrochemical biosensor disclosed by the invention comprises a multi-walled carbon nanotube-nanogold-hairpin nucleotide probe modified silk-screen printing carbon electrode and a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-crRNA-Target DNA (Deoxyribose Nucleic Acid) ternary complex, the CRISPR-crRNA-Target DNA ternary complex is assembled on the surface of the multi-walled carbon nanotube-nanogold-hairpin nucleotide probe modified silk-screen printing carbon electrode, and the CRISPR-crRNA-Target DNA ternary complex is assembled on the surface of the multi-walled carbon nanotube-nanogold-hairpin nucleotide probe The electrochemical biosensor shows wide linear response in a range of 1.04 * 10 < 1 > to 1.04 * 10 < 8 > CFU / mL, and the detection limit is as low as 3 CFU / mL; and the method has good practicability in detection of staphylococcus aureus.

Description

Technical Field

[0001] The present invention belongs to the technical field of electrochemical biosensor preparation and dairy pathogen detection, and specifically relates to an RPA-CRISPR-based MWCNTs-Au electrochemical biosensor and a preparation method and application thereof. Background Art

[0002] Dairy products are nutritious, rich in calcium, and can provide high-quality protein, but they are also a hotbed for the growth and reproduction of microorganisms. During the production and processing process, microbial contamination such as foodborne pathogens will accelerate the deterioration of dairy products, affecting their shelf life and storage stability. Staphylococcus aureus is one of the common foodborne pathogens, which can grow in dairy products and produce heat-resistant toxins, causing food poisoning. Therefore, it is necessary to establish an ultra-specific, highly sensitive, and accurate Staphylococcus aureus analysis method, which can quickly trace the source by taking early intervention measures, and then implement emergency response to avoid large-scale contamination incidents, which is of great significance for protecting consumer health.

[0003] At present, the detection methods of foodborne pathogens such as Staphylococcus aureus mainly include molecular biological methods such as plate coating method, PCR, immunoassays such as ELISA, and electrochemical methods. Although most methods such as plate coating method, PCR and ELISA have advantages such as sensitive detection, they have shortcomings such as cumbersome and time-consuming detection process, high detection cost, and difficulty in miniaturizing detection equipment, which limits their application in practical detection. In contrast, electrochemical methods have significant advantages in the detection of foodborne pathogens such as Staphylococcus aureus due to their high sensitivity, rapidity and portability, especially in food safety monitoring occasions that require rapid response. With the development of sensors, the linear range of Staphylococcus aureus detection is getting larger and larger, and the detection limit is getting lower and lower, but the specificity and stability of the detection are still low, which restricts the development of sensors. Therefore, it is necessary to develop a sensor with high sensitivity, good specificity and strong stability for the detection of foodborne pathogens such as Staphylococcus aureus. Summary of the invention

[0004] In view of some deficiencies in the prior art, the present invention provides a MWCNTs-Au electrochemical biosensor based on RPA-CRISPR and a preparation method and application thereof; the present invention prepares a MWCNTs-Au electrochemical biosensor based on RPA-CRISPR; the electrochemical biosensor comprises a multi-walled carbon nanotube-nanogold-hairpin nucleotide probe modified screen-printed carbon electrode and a CRISPR-crRNA-Target DNA ternary complex; the CRISPR-crRNA-Target DNA ternary complex is assembled on the surface of a multi-walled carbon nanotube-nanogold-hairpin nucleotide probe modified screen-printed carbon electrode; the electrochemical biosensor can improve the time efficiency and anti-interference ability of trace Staphylococcus aureus determination, and the detection result is 1.04×10 1 to 1.04×10 8 It shows a wide linear response in the range of CFU / mL, and the detection limit is as low as 3 CFU / mL; it has good practicality in the detection of Staphylococcus aureus.

[0005] In order to achieve the above technical objectives, the present invention adopts the following technical means:

[0006] The present invention first provides a MWCNTs-Au electrochemical biosensor based on RPA-CRISPR, wherein the electrochemical biosensor comprises a multi-walled carbon nanotube-nanogold-hairpin nucleotide probe modified screen-printed carbon electrode and a CRISPR-crRNA-Target DNA ternary complex; the CRISPR-crRNA-Target DNA ternary complex is assembled on the surface of the multi-walled carbon nanotube-nanogold-hairpin nucleotide probe modified screen-printed carbon electrode;

[0007] In the multi-walled carbon nanotube-nanogold-hairpin nucleotide probe, the sensitizing material multi-walled carbon nanotube is assembled with the fixed support nanogold, and the hairpin nucleotide hpDNA is modified with thiol at the 5' end and methylene blue (MB) at the 3' end and fixed therein via Au-S bonds.

[0008] Preferably, the sequence of the hpDNA is HS-SH C6-TGCTTGCCAAGCTGTATGCTTTTCTCTTTTGCATTGTAGTTTTCTTTTT-MB;

[0009] The CRISPR-crRNA-Target DNA ternary complex is obtained by compounding CRISPR / Cas12a, crRNA and Target DNA, and the sequence of the crRNA is UAAUUUCUAAGUGUAGAUGUUGAAGUUGCACUAUAUAC (SEQ ID NO.1);

[0010] The sequence of the Target DNA is GCATCACAAACAGATAATGGCGTAAATAGAAGTGGTTCTGAAGATCCAACAGTATATAGTGCAACTTCAACTAAAAAATTACATAAAGAACCTGCGACATTAATTAAAGCGATTGATGGTGATACGGTTAAATTAATGT (SEQ ID NO. 2).

[0011] The present invention also provides a method for preparing the above-mentioned MWCNTs-Au electrochemical biosensor, the preparation method comprising:

[0012] (1) Preparation of multi-walled carbon nanotube-nano-gold-hairpin nucleotide probe modified screen-printed carbon electrode:

[0013] The MWCNTs material was ultrasonically dispersed in pure water and drop-coated on the surface of the screen-printed carbon electrode SPCE. The screen-printed carbon electrode modified with the multi-walled carbon nanotube material was dried and recorded as MWCNTs / SPCE.

[0014] Then, a polymerization solution containing tetrachloroauric acid HAuCl4·4H2O was used for electropolymerization on the surface of MWCNTs / SPCE to obtain a nano-gold-multi-walled carbon nanotube material modified screen-printed carbon electrode, which was recorded as MWCNTs-Au / SPCE;

[0015] Then, hpDNA was added dropwise onto the surface of MWCNTs-Au / SPCE, and after incubation, it was washed several times with PBS, and then mercaptoethanol (MCH) was added dropwise, washed, and dried to obtain a hairpin nucleotide-nanogold-multi-walled carbon nanotube modified screen-printed carbon electrode, which was denoted as hpDNA-MWCNTs-Au / SPCE;

[0016] (2) Preparation of a novel MWCNTs-Au electrochemical biosensor based on RPA-CRISPR / Cas12a:

[0017] CRISPR / Cas12a, crRNA, 10×NE buffer 2.1, enzyme-free water and target nucleic acid (Target DNA) of Staphylococcus aureus were mixed and self-assembled to obtain a CRISPR-crRNA-Target DNA ternary complex;

[0018] The CRISPR-crRNA-Target DNA ternary complex is dropped onto the surface of the hpDNA-MWCNTs-Au / SPCE electrode and reacted. After the reaction is completed, the electrode is rinsed to obtain the novel MWCNTs-Au electrochemical biosensor based on RPA-CRISPR / Cas12a.

[0019] Preferably, in step (1), when preparing MWCNTs / SPCE, the dosage ratio of MWCNTs to pure water is 0.5 mg:1 mL, and the drop coating amount is 10 μL.

[0020] Preferably, in step (1), when preparing MWCNTs-Au / SPCE, the amount of the polymerization solution is 10 mL, the concentration of HAuCl4·4H2O in the polymerization solution is 2 mM, and the electropolymerization conditions are a voltage of -0.2 V and an electropolymerization time of 60 s.

[0021] Preferably, in step (1), when preparing hpDNA-MWCNTs-Au / SPCE, the concentration of hpDNA is 2 μM and the amount used is 8 μL;

[0022] The incubation condition is to incubate overnight at 4°C; the concentration of PBS is 10 mM, the pH is 7.2, and the dosage is 100 μL each time;

[0023] The hpDNA is activated before dropping, and the steps are: using tris(2-carboxyethyl)phosphine hydrochloride (TCEP) to activate the hpDNA sulfhydryl group in the dark, and then dissolving it in TE buffer after activation.

[0024] Preferably, in step (2), the amount of CRISPR / Cas12a, crRNA, 10×NE buffer 2.1, enzyme-free water and target nucleic acid of Staphylococcus aureus is 1 μL: 2 μL: 3 μL: 21 μL: 3 μL;

[0025] The concentration of the CRISPR / Cas12a is 1 μM; the concentration of the crRNA is 1 μM.

[0026] Preferably, in step (2), the sequence of the crRNA is UAAUUUCUAAGUGUAGAUGUUGAAGUUGCACUAUAUAC (SEQ ID NO.1);

[0027] The sequence of the Target DNA is GCATCACAAACAGATAATGGCGTAAATAGAAGTGGTTCTGAAGATCCAACAGTATATAGTGCAACTTCAACTAAAAAATTACATAAAGAACCTGCGACATTAATTAAAGCGATTGATGGTGATACGGTTAAATTAATGT (SEQ ID NO. 2).

[0028] Preferably, in step (2), the self-assembly is performed at 37° C. for 10 min;

[0029] The CRISPR-crRNA-Target DNA ternary complex was added in an amount of 30 μL, and the reaction conditions were: reacting at 37° C. for 30 minutes.

[0030] The present invention also provides application of the MWCNTs-Au electrochemical biosensor in detecting Staphylococcus aureus.

[0031] Preferably, the application is the detection of Staphylococcus aureus in dairy products.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] (1) In the present invention, multi-walled carbon nanotubes are used to modify the electrode. The multi-walled carbon nanotube material has a large specific surface area, strong conductivity, regular and rich voids and good biocompatibility. The introduction of gold nanoparticles further introduces a large number of active sites to improve conductivity. MWCNTs-Au can increase the specific surface area, and the rough surface of the electrode is more conducive to the fixation of hpDNA probes and increases signal strength, thereby improving sensitivity. Multi-walled carbon nanotubes and gold nanoparticles produce a synergistic effect, which not only enhances the transmission of electrical signals, but also ensures the active expression of biological molecules such as nucleic acids. This synergistic effect makes the entire sensing platform more sensitive to the recognition of target molecules. It solves the problem that nucleic acid molecules are usually not firmly fixed and easily inactivated, and can form a signal probe to amplify the electrochemical signal. In addition, the screen-printed carbon electrode SPCE used in the present invention is miniaturized and easy to carry, and the detection is efficient and fast. The material preparation process is simple and fast, energy-saving, does not require specific biological materials, and is easy to promote.

[0034] (2) In the present invention, after recognizing a specific DNA sequence, the CRISPR / Cas12a system can trigger the "non-specific" shearing activity of the CRISPR / Cas12a enzyme and cut the surrounding single-stranded DNA. Among them, the RPA amplification technology has the advantage of rapid amplification at a constant temperature, does not require expensive equipment, and is suitable for on-site detection. The selection of specific RPA amplification fragments ensures that only the DNA of Staphylococcus aureus is amplified, avoiding false positives caused by the DNA of non-target bacteria. And it can ensure effective amplification in the presence of lower concentrations of target DNA, thereby improving the sensitivity of detection. The complete match between crRNA and the target sequence in the formed CRISPR-crRNA-Target DNA ternary complex ensures the high specificity of the CRISPR / Cas12a system and maintains the stability and reliability of the detection.

[0035] (3) In the present invention, due to the miniaturization and portability of the electrochemical sensor, combined with the isothermal amplification of RPA and the efficient cutting of CRISPR / Cas12a, rapid on-site detection can be achieved, providing real-time results, which is suitable for on-site food safety detection and emergency response. The MWCNTs-Au material with strong conductivity and good biocompatibility greatly improves the time efficiency and anti-interference ability of trace Staphylococcus aureus determination. The electrochemical sensor is 1.04×10 1 to 1.04×10 8 It showed a wide linear response in the range of CFU / mL, with a detection limit as low as 3 CFU / mL, and was successfully used in the analysis of dairy products, providing a promising tool for the detection of Staphylococcus aureus and having certain practical value in food microbiological detection.

[0036] (4) The novel MWCNTs-Au electrochemical biosensor based on RPA-CRISPR / Cas12a prepared in the present invention effectively improves the sensitivity and stability in the detection process of Staphylococcus aureus, shortens the detection time, and obtains the electrochemical signal generated by CRISPR cutting hpDNA to separate the electrical signal analyte MB from the electrode within 30 minutes, thereby realizing accurate detection of the concentration of Staphylococcus aureus. In addition, the operation is simple and there are no special requirements for the detection personnel, so that rapid and trace detection of Staphylococcus aureus can be achieved. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 Characterization diagrams of MWCNTs materials and MWCNTs-Au composite materials; A is the SEM image of MWCNTs material; B is the SEM image of AuNPs material; C is the SEM image of MWCNTs-Au material; D is the XPS spectrum of MWCNTs-Au and the peak fitting of C1s (E) and Au 4f (F).

[0038] Figure 2 A in the figure shows the different modified electrodes in 10 mM [Fe(CN)6] 3- / 4- CV graphs in solution; B is the CV graphs of different modified electrodes in 10 mM [Fe(CN)6] 3- / 4- EIS diagram in solution; among them, a is bare SPCE, b is MWCNTs / SPCE, c is MWCNTs-Au / SPCE, and d is the assembled hpDNA / MWCNTs-Au / SPCE.

[0039] Figure 3 A is a schematic diagram of the effect of agarose gel electrophoresis (2%) on the extraction of the whole genome of Staphylococcus aureus; B is a schematic diagram of the effect of RPA amplification.

[0040] Figure 4 Schematic diagram of the electrochemical biosensor mechanism verification; A is the comparison of the electrochemical response of the CRISPR system before and after cleavage; B is the circular dichroism fragments of hpDNA before and after CRISPR cleavage; C is the use of PAGE to determine the CRISPR cutting conditions in the absence of crRNA or target DNA; D is the comparison of the fluorescence response of the CRISPR system before and after cleavage.

[0041] Figure 5 The performance optimization of electrochemical biosensors by different factors, where A is the concentration optimization of MWCNTs; B is the time optimization of gold-plated AuNPs; C is the concentration optimization of hpDNA; D is the amount of hpDNA added; E is the optimization of incubation time for CRISPR / Cas12a detection; F is V CRISPR / Cas12a :V crRNA Optimization of sensor detection.

[0042] Figure 6 Schematic diagram of electrochemical detection of Staphylococcus aureus; wherein A is a schematic diagram of electrochemical detection of pure culture of Staphylococcus aureus; and B is a schematic diagram of electrochemical detection of Staphylococcus aureus in dairy products.

[0043] Figure 7 Schematic diagram of the specificity of the electrochemical biosensor.

[0044] Figure 8 Schematic diagram of the repeatability of the electrochemical biosensor. DETAILED DESCRIPTION

[0045] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, but the protection scope of the present invention is not limited thereto. It will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are followed. The reagents or instruments used are not indicated by the manufacturer and are conventional products that can be purchased on the market.

[0046] In the following examples, the sequences involved are:

[0047] hpDNA: HS-SH C6-TGCTTGCCAAGCTGTATGCTTTTCTCTTTTGCATTGTAGTTTTCTT TTT-MB, synthesized by Sangon;

[0048] crRNA: UAAUUUCUACUAAGUGUAGAUGUUGAAGUUGCACUAUAUAC (SEQ ID NO.1), synthesized by Tsingke Biological;

[0049] Target DNA: GCATCACAAACAGATAATGGCGTAAATAGAAGTGGTTCTGAAG ATCCAACAGTATATAGTGCAACTTCAACTAAAAAATTACATAAAGAACCTGCGACATTAA TTAAAGCGATTGATGGTGATACGGTTAAATTAATGT (SEQ ID NO.2);

[0050] Specific gene nuc gene:

[0051] GTATGGCAATTGTTTCAATATTACTTATAGGGATGGCTATCAGTAATGTTTCGAAAGGGCAATACGCAAAGAGGTTTTTCTATTTCGCTACTAGTTGCTTAGTGTTAACTTTAGTTGTAGTTTCAAGTCTAAGTAGCTCAGCAAATGCATCACAAACAGATAATGGCGTAAATAGAAGTGGTTCTGAAGATCCAACAGTATATAGTGCAACTTCAACTAAAAAATTACATAAAGAACCTGCGACATTAATTAAAGCGATTGATGGTGATACGGTTAAATTAATGTACAAAGGTCAACCAATGACATTCAGACTATTATTGGTTGATACACCTGAAACAAAGCATCCTAAAAAAGGTGTAGAGAAATATGGTCCTGAAGCAAGTGCATTTACGAAAAAAATGGTAGAAAATGCAAAGAAAATTGAAGTCGAGTTTGACAAAGGTCAAAGAACTGATAAATATGGACGTGGCTTAGCGTATATTTATGCTGATGGAAAAATGGTAAACGAAGCTTTAGTTCGTCAAGGCTTGGCTAAAGTTGCTTATGTTTATAAACCTAACAATACACATGAACAACTTTTAAGAAAAAGTGAAGCACAAGCAAAAAAAGAGAAATTAAATATTTGGAGCGAAGACAACGCTGATTCAG (SEQ ID NO.3).

[0052] Example 1. Preparation of signal probe hpDNA-MWCNTs-Au / SPCE:

[0053] (1) Preparation of MWCNTs-Au / SPCE:

[0054] Weigh 0.5 mg of carboxylated multi-walled carbon nanotube powder, ultrasonically disperse it in 1 mL of pure water to obtain MWCNTs dispersion, and store it at room temperature and away from light. Then take 10 μL of evenly dispersed 0.5 mg / mL MWCNTs and drop it onto SPCE, and dry it at 50 °C to obtain MWCNTs / SPCE.

[0055] Take 1.67mL 2% HAuCl4 and dissolve it in 10mL pure water solution. Immerse the prepared MWCNTs / SPCE in 2mM HAuCl4 and use the current time curve (it) gold plating method. Gold is plated at -0.2V for 60s. After drying at room temperature, MWCNTs-Au / SPCE is obtained.

[0056] Figure 1 This is a characterization diagram of MWCNTs-Au materials. It can be seen from the figure that the nanomaterial MWCNTs is in a regular hollow bamboo shape ( Figure 1 A); The nanomaterial AuNPs presents a flower shape, which indicates that AuNPs are nanoflower gold nanoparticles ( Figure 1 B); Figure 1 The SEM image of C shows that AuNPs particles are uniformly dispersed on the surface of MWCNTs, which indicates that MWCNTs-Au is successfully prepared; XPS results ( Figure 1 D) Further proves the successful preparation of MWCNTs-Au.

[0057] (2) Activation of hpDNA:

[0058] 22.7 μL of TE buffer was placed in 2OD hpDNA solid powder, and the resulting mixture was recorded as hpDNA stock solution;

[0059] 10 mM tri(2-carboxyethyl)phosphine (TCEP), 500 mM NaCl and 5 mM MgCl2 were added to 5 mL of pure water. The resulting mixed solution was recorded as activation solution and set aside.

[0060] Take 2 μL of hpDNA stock solution and mix it with 8 μL of activation solution, activate hpDNA for 2 hours at room temperature to reduce disulfide bonds, and prepare activated 2 μM hpDNA. Both hpDNA stock solution and 2 μM hpDNA are stored at -20°C, and TCEP activation solution is prepared before use.

[0061] (3) Preparation of hpDNA / MWCNTs-Au / SPCE:

[0062] 8 μL of 2 μM hpDNA prepared in the above step (2) was added to the MWCNTs-Au / SPCE prepared in the step (1) and incubated at 4°C overnight to allow the hpDNA to fully bind to Au through the Au-S bond; after incubation, the electrode was thoroughly cleaned with 100 μL of 0.1 M PBS (pH 7.2) to remove the hpDNA that was not fully bound, and then 10 μL of 1 mM MCH was taken to seal the electrode surface for 15 minutes to prevent non-specific adsorption of hpDNA by impurities, and rinsed once with 100 μL of PBS to obtain a multi-walled carbon nanotube-nanogold-hairpin nucleotide probe modified screen-printed carbon electrode, namely hpDNA / MWCNTs-Au / SPCE.

[0063] like Figure 2 As shown in the CV curve of A, at a scan rate of 0.1 V / s, the [Fe(CN)6] 3- / 4- A pair of redox peaks. When MWCNTs (curve b) and MWCNTs-Au (curve c) were modified on the electrode surface respectively, the CV peak current increased significantly, indicating that MWCNTs had good conductivity, and when the composite material MWCNTs-Au was fixed on the electrode surface, the synergistic effect of the two accelerated electron transfer, so the maximum peak current was obtained, indicating that the composite material MWCNTs-Au had a higher charge transfer rate and laid the foundation for hpDNA to bind to the electrode through Au-S. Subsequently, hpDNA was further immobilized on the electrode surface (curve d), and the peak current decreased due to the poor conductivity of hpDNA. When hpDNA was modified to the electrode surface, the current peak decreased. This is because hpDNA carries a negatively charged PO4 3- The skeleton hinders the transfer of electrons, but due to the special structure of hpDNA, the reporting signal MB is closer to the electrode surface, and the conductivity of MB increases the electrical signal. It can slightly reduce the negatively charged hpDNA and [Fe(CN)6] 3- / 4- The electron repulsion between them makes the current peak value still close to that of MWCNTs-Au / SPCE. The CV results show that every step in the process of building the sensor is successful.

[0064] In addition, EIS was used to further verify the stepwise modification process of the electrode. Figure 2B shows that the Ret of the modified MWCNTs (curve b) is significantly reduced compared with the bare SPCE (curve a), and the minimum Ret value is obtained when the MWCNTs-Au (curve c) is modified. The EIS curve at this time is close to a straight line, indicating that MWCNTs and AuNPs have the ability to synergistically increase electron transfer. After the poorly conductive hpDNA is fixed, the semicircle diameter increases (curve d), which is due to the negatively charged hpDNA and [Fe(CN)6] 3- / 4 There is electrostatic repulsion between the resistors, which leads to an increase in resistance. The above results obtained from EIS are very consistent with those obtained from CV, both of which prove the successful construction of the sensor.

[0065] Example 2. Preparation of Target DNA:

[0066] (1) Whole genome extraction of Staphylococcus aureus:

[0067] The ratio of Staphylococcus aureus (ATCC 25923) stored in a glycerol tube to LB liquid medium was 1 mL:50 mL. The mixture was activated by shaking at 37°C for 15 h in the dark. After activation twice, it was diluted with physiological saline to obtain a pure culture dispersion of the bacterial liquid. 100 μL of the bacterial liquid was applied to each dilution gradient for plate counting. 1 ~10 8 CFU / mL of pure culture dispersion was extracted and amplified.

[0068] Each tube of 1 mL of the pure culture dispersion was centrifuged at 12000 rpm for 2 min, and then the DNA was extracted using the Tiangen Bacterial Genomic DNA Extraction Kit (centrifugal column type) to obtain 50 μL of Staphylococcus aureus whole genome solution per tube, which was recorded as the nucleic acid template.

[0069] Whether the DNA extraction of Staphylococcus aureus is successful is verified by running gel. First, PCR amplification is performed. The specific steps are as follows: after DNA extraction, 1 μL of DNA extract is used, 1.5 μL of upstream and downstream primers for PCR amplification are used, 12.5 μL of PCR amplification polymerase purchased from Takara and 8.5 μL of double distilled water, a total of 25 μL system, mixed evenly and placed in a PCR instrument. Among them, the upstream primer of PCR amplification is: 5'TTATTGACCTGAATCAGCGTTG 3' (SEQ ID NO.4); the downstream primer is: 5'ATGACAGAATACTTATTAAGTGCTGG 3' (SEQ ID NO.5). The parameters for amplification are set as annealing temperature of 55°C, 5s; extension temperature of 72°C, extension time of 3s; and 33 cycles. After obtaining the PCR amplification extraction product, run the gel by agarose gel electrophoresis (2%). The results are as follows Figure 3Lane A: 2-4: 10 1 ~10 4 The DNA extraction product of Staphylococcus aureus with a concentration of CFU / mL was compared with the marker in lane 1 and found that a band appeared at 600bp, and the bands appeared in a sequence from light to heavy, indicating that Staphylococcus aureus DNA of different concentrations can be well extracted.

[0070] (2) RPA amplification of nucleic acid templates:

[0071] The upstream and downstream primers for amplification selected the nuc gene (SEQ ID NO.3) specific gene of Staphylococcus aureus. 5 μL of nucleic acid template and synthetic primers were taken from each tube for RPA amplification using a DNA constant temperature rapid amplification kit. The amplified product was extracted using a DNA extraction reagent. After centrifugation at 12000 rpm, the supernatant was aspirated to obtain a high-concentration amplified product recorded as the target nucleic acid (Target DNA).

[0072] Figure 3 B Verify the RPA amplification effect. As can be seen from the figure, compared with the marker in lane 1, there are obvious bands at 139bp in lanes 2 to 6, which indicates that RPA amplification was successful. The dark band above the target band at a certain distance from the target band is generally caused by some proteins in the purification system still binding to the band, resulting in an increase in molecular weight, which will not affect the experimental effect, while the band below the target band may be caused by low concentration template.

[0073] Example 3. Preparation of MWCNTs-Au electrochemical biosensor based on RPA-CRISPR / Cas12a:

[0074] 1 μL CRISPR / Cas12a (1 μM), 2 μL crRNA (1 μM), 3 μL 10×NE buffer 2.1, 21 μL enzyme-free water, and 3 μL Target DNA obtained in Example 2 were mixed and self-assembled at 37°C for 10 minutes to form a CRISPR-crRNA-Target DNA ternary complex. The crRNA assembled on CRISPR / Cas12a has single-base recognition ability, and after combining with the above-mentioned Target DNA recognition, it will activate the cis and trans cutting ability of CRISPR / Cas12a. Among them, cis-cuts Target DNA and trans-cuts hpDNA.

[0075] Take 30 μL of the adsorption assembly mixture and drop it on the prepared hpDNA-MWCNTs-Au / SPCE. After reacting at 37°C for 30 minutes, rinse the electrode with 100 μL PBS (10 mM, pH 7.2). The CRISPR / Cas12a cleavage activity is proportional to the Target DNA concentration. Therefore, the concentration of Staphylococcus aureus can be determined by reducing the difference signal before and after the cleavage, thereby obtaining a new MWCNTs-Au electrochemical biosensor based on RPA-CRISPR / Cas12a.

[0076] In order to verify the ability of CRISPR / Cas12a system in recognition and trans-cutting, the target bacteria amplification products were detected on the modified electrode. Figure 4 shown.

[0077] from Figure 4 As can be seen in A, the current peak decreases after the introduction of the CRISPR / Cas12a system, which indicates that the RPA-CRISPR-based biosensor can effectively recognize and cut the hpDNA molecules modified on the electrode, release the signal from the electrode, and can be used for the detection of Staphylococcus aureus.

[0078] from Figure 4 As can be seen in B, the ternary complex formed by CRISPR / Cas12a, crRNA and the target bacteria amplification product was incubated with hpDNA at 37°C for 30 minutes. It was found that the peak at 280nm in the CD spectrum after CRISPR / Cas12a shearing was significantly lower than the peak before shearing, which indicates that hpDNA was sheared into small ssDNA by CRISPR / Cas12a, and the original long DNA chain was shortened. The results show that the RPA-CRISPR-based biosensor can be used to detect Staphylococcus aureus.

[0079] from Figure 4 As can be seen in C, PAGR was used to verify the CRISPR / Cas12a cleavage conditions. By comparing the marker in lane 1, it was found that the system could not be activated when no crRNA or target DNA was added, and the hpDNA band appeared as in lanes 3 and 4. When the ternary complex was present, the hpDNA cleavage band disappeared as in lane 2. Figure 4 As shown in D, the detection mechanism was verified by fluorescence method. The fluorescent and quenching groups were modified at both ends of ssDNA at the same time, and fluorescence was found to appear after CRISPR / Cas12a shearing at a wavelength of 520nm.

[0080] In summary, the CRISPR / Cas12a system has the ability to recognize and non-specifically cut target DNA, and illustrates the specificity of the primer sequence selected for RPA amplification.

[0081] Example 4: Optimization of electrochemical biosensor

[0082] In order to improve the performance of electrochemical sensors, the preparation process of the new MWCNTs-Au electrochemical biosensor based on RPA-CRISPR / Cas12a was optimized in this example.

[0083] (1) Optimization of MWCNTs addition amount:

[0084] In order to improve the electron transfer rate, this example first optimizes the amount of MWCNTs added to enhance the electrode performance and obtain the maximum response current. The optimization range is 0.25 mg / mL to 1.5 mg / mL. The optimization results are shown in Figure 5 As shown in A.

[0085] It can be seen from the figure that when the concentration of MWCNTs is 0.5 mg / mL, I MB It no longer increases but gradually decreases. This is because MWCNTs themselves have good conductivity, but when their concentration is too high, it will lead to disordered accumulation of nanotubes. This accumulation hinders the effective migration of electrons and causes poor transmission of electrical signals.

[0086] Therefore, 0.5 mg / mL was selected as the optimal concentration of MWCNTs.

[0087] (2) Optimization of gold plating time:

[0088] The gold plating time plays an important role in the fixation of the signal probe and the performance of the sensor, and the optimization range is 30s to 150s. The same amount of hpDNA was incubated with gold for different times to obtain the I hpDNA-MB The highest value determines the optimal gold plating time. The test results are as follows Figure 5 As shown in B.

[0089] As can be seen from the figure, the electrochemical signal gradually increases with the increase of gold plating time from 30 to 60 s, which indicates that gold nanoparticles can improve the electrical signal while fixing hpDNA on the electrode. The electrochemical signal reaches a peak at 60 s, indicating that the synergistic effect of MWCNTs-Au / hpDNA reaches the optimal state at this time. As the gold plating time further increases, the electrochemical signal gradually decreases, which indicates that the dense gold nanolayer will hinder electron transmission.

[0090] Therefore, a 60s plating time was chosen to construct the sensor.

[0091] (3) Optimization of hpDNA concentration:

[0092] The number of immobilized hpDNA probes is one of the key parameters affecting the sensitivity and stability of the entire detection. Figure 5As shown in Figure C, the electrochemical signal gradually increases with the increase of hpDNA concentration from 0.25 to 3 μM, indicating that the number of signal probes bound is continuously increasing. The signal reaches a maximum value when the concentration is 2 μM, and the signal decreases as the hpDNA concentration continues to increase, indicating that the 2 μM hpDNA immobilization capacity has reached saturation.

[0093] Therefore, 2 μM was selected as the optimal concentration of hpDNA.

[0094] (4) Optimization of hpDNA addition amount:

[0095] The amount of hpDNA added is an important parameter in forming the signal probe hpDNA / MWCNTs-Au / SPCE. Its addition directly affects the electrical signal. Too little will affect the sensor signal and sensitivity, while too much will reduce the sensing efficiency. Figure 5 D It can be seen that the electrochemical signal increases as the hpDNA addition amount increases from 4 μL to 12 μL; when the hpDNA addition amount is 8 μL, the electrochemical response reaches the maximum and weakens as the addition amount further increases, indicating that the solid loading amount on the electrode reaches saturation when the hpDNA addition amount is 8 μL.

[0096] Therefore, 8 μL of hpDNA was added to construct the sensor.

[0097] (5) Optimization of incubation time:

[0098] The incubation time of CRISPR / Cas12a on hpDNA is an important parameter affecting probe cleavage. Figure 5 E shows that the incubation time is optimized according to the maximum ΔI before and after CRISPR / Cas12a cuts hpDNA. It can be seen from the figure that ΔI increases with time when the incubation time is less than 30 min, reaches the maximum value at 30 min of incubation, and tends to stabilize when the incubation time is higher than 30 min, indicating that the cutting of hpDNA by CRISPR / Cas12a has almost reached saturation.

[0099] Therefore, 30 min was selected as the incubation time of the system.

[0100] (6)V CRISPR / Cas12a :V crRNA Optimization:

[0101] In the CRISPR / Cas12a system, the ratio of CRISPR / Cas12a to its paired crRNA is one of the key factors, which can significantly affect the recognition and cutting efficiency of the system. If the ratio of CRISPR / Cas12a to crRNA is too low, that is, the concentration of crRNA is not enough to saturate all CRISPR / Cas12a proteins, the CRISPR / Cas12a molecules that are not fully activated are insufficient to exert their maximum recognition and cutting potential.

[0102] from Figure 5 It can be seen from F that V CRISPR / Cas12a :V crRNA When the ΔI is 1:2, it reaches the maximum value, so in the CRISPR / Cas12a detection, 1μL CRISPR / Cas12a and 2μL crRNA are added.

[0103] In summary, in the preparation process of MWCNTs-Au electrochemical biosensor based on RPA-CRISPR / Cas12a system, the optimal reaction conditions were: MWCNTs concentration of 0.5 mg / mL, gold plating time of 60 s, hpDNA concentration of 2 μM, 8 μL, system incubation of 30 min, V CRISPR / Cas12a :V crRNA 1μL:2μL.

[0104] Example 5: Detection of Staphylococcus aureus

[0105] In this example, the detection ability of the novel MWCNTs-Au electrochemical biosensor based on RPA-CRISPR / Cas12a for Staphylococcus aureus was investigated, and the specific detection method is as follows.

[0106] (1) Drawing of standard curve:

[0107] Under the experimental conditions of Example 4, the sensor specifically recognized 1.04×10 1 to 1.04×10 8 Eight different concentrations of Staphylococcus aureus were obtained by recording the ΔI (the difference between the peak current of the DPV curve before and after CRISPR / Cas12a trans-cleavage) in 0.1 M PBS buffer (pH 7.2). The concentration of Staphylococcus aureus solution with known concentration after plate counting was 1.04×10 1 ~10 8 CFU / mL, ΔI was used to detect different concentrations of Staphylococcus aureus, a scatter plot was obtained, and a functional relationship was established between the logarithm (lg) value of the obtained Staphylococcus aureus concentration and the corresponding electrochemical signal change difference, namely the standard curve for Staphylococcus aureus detection.

[0108] Figure 6 A shows the ΔI of the sensor to the amplified products of different bacterial concentrations. The ΔI value is compared with C S.aureus The logarithm of the linear equation is used to construct the linear equation. According to the linear regression curve, the regression equation y = 0.6315lgx + 0.075 (R 2 =0.993). Where y and x represent ΔI and C respectively. S.aureus The difference in current response (ΔI) and the logarithm (lg) of the concentration of Staphylococcus aureus were 1.04×10 1 ~1.04×10 8 There was a good linear relationship between the CFU / mL and the detection limit (LOD) was 3 CFU / mL.

[0109] (2) The new MWCNTs-Au electrochemical biosensor based on RPA-CRISPR / Cas12a is used to detect the content of Staphylococcus aureus in dairy products.

[0110] In this example, the ability of the prepared MWCNTs-Au new electrochemical biosensor based on RPA-CRISPR / Cas12a to detect the content of Staphylococcus aureus in dairy products was also investigated. The dairy product was sterilized milk (purchased from Jimailong Supermarket in Zhenjiang City, Jiangsu Province). The specific detection method is shown below.

[0111] After sterilizing the milk samples using a high pressure steam sterilizer, 100 μL of a 10% saturated fat solution was added to each of the 14 centrifuge tubes containing 900 μL of milk samples. 2 ~10 8 A solution of Staphylococcus aureus in the range of CFU / mL. Seven tubes were used for DNA extraction using the rapid release reagent (5 min), and then amplified using the RPA kit (15 min) to obtain the target DNA. The remaining seven tubes were determined by the plate count method to determine the final bacterial concentration in the milk.

[0112] The detection method described in step (1) was used to repeat the measurement for each sample three times, and a linear regression curve was constructed by the difference in current response (ΔI) and the logarithm (lg) value of the Staphylococcus aureus concentration. The detection results are shown in Figure 6 As shown in Figure B. It can be seen from the figure that under complex food matrices, there is still a good linear relationship between ΔI and lgC S.aureus The regression equation is y = 0.56239lgx + 0.11906 (R 2 =0.993).

[0113] Example 6: Specificity and reliability evaluation of electrochemical biosensors

[0114] In this example, foodborne pathogens including Staphylococcus aureus with different genomes (CMCC 26003, ATCC 29213, ATCC 25923), Escherichia coli with different genomes (ATCC 26922, CMCC 44013, C 600), Listeria monocytogenes (ATCC19115), and Lactobacillus (XR1) were added to the MWCNTs-Au novel electrochemical biosensor based on RPA-CRISPR / Cas12a described in Example 3, and the detection results are shown in FIG. Figure 7 .

[0115] from Figure 7 It can be seen that, except for the different genomes of Staphylococcus aureus, the ΔI values ​​produced by other bacterial solutions are only 5% of the ΔI values ​​produced by Staphylococcus aureus, indicating that the electrochemical biosensor has high specificity for Staphylococcus aureus with different genomes.

[0116] In order to test the stability of the sensor, three parallel electrochemical biosensors were tested. The specific test method was as follows: the constructed electrochemical biosensor was used to measure the concentration of Staphylococcus aureus at 1.04×10 4 The target DNA was detected by differential pulse stripping voltammetry (DPV) with the following conditions: pulse amplitude 0.05V, pulse period 0.05s, pulse width 0.1s, potential range from -0.6V to 0.2V. The sensor stability was determined by calculating the current peak difference ΔI value of DPV before and after the addition of CRISPR-crRNA-Target DNA ternary complex to MWCNTs-Au / hpDNA / SPCE in three parallels. After testing, the RSD was 3.85%, which shows that the electrochemical biosensor prepared by the present invention has good stability.

[0117] Example 7: Reliability Assessment of Electrochemical Biosensors

[0118] In this example, the response signals of MWCNTs-Au / hpDNA / SPCE were tested by three independent experiments to evaluate the stability of six electrochemical biosensors. The specific tests were as follows:

[0119] The response signal of the incubated MWCNTs-Au / hpDNA / SPCE was subjected to DPV testing. The test conditions were: pulse amplitude 0.05V, pulse period 0.05s, pulse width 0.1s, and potential range from -0.6V to 0.2V. The six electrodes were repeated 3 times, and the DPV current peak value was observed to evaluate the reproducibility reliability. The test results are shown in Figure 8 shown.

[0120] from Figure 8It can be seen that there is no significant difference among the electrochemical signals of the six MWCNTs-Au / hpDNA / SPCE (P>0.05), and the relative standard deviation (RSD) is 3.69%. This result proves the stability of the sensor.

[0121] In summary, the electrochemical biosensor of the present invention can improve the time efficiency and anti-interference ability of trace Staphylococcus aureus determination. 1 to 1.04×10 8 It shows a wide linear response in the range of CFU / mL, and the detection limit is as low as 3 CFU / mL; it has good practicality in the detection of Staphylococcus aureus.

[0122] The embodiments are preferred implementations of the present invention, but the present invention is not limited to the above-mentioned implementations. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essential content of the present invention belong to the protection scope of the present invention.

Claims

1. A MWCNTs-Au electrochemical biosensor based on RPA-CRISPR, characterized in that: The electrochemical biosensor comprises a multi-walled carbon nanotube-nano-gold-hairpin nucleotide probe modified screen-printed carbon electrode and a CRISPR-crRNA-Target DNA ternary complex; the CRISPR-crRNA-Target DNA ternary complex is assembled on the surface of the multi-walled carbon nanotube-nano-gold-hairpin nucleotide probe modified screen-printed carbon electrode; In the multi-walled carbon nanotube-nanogold-hairpin nucleotide probe, the sensitizing material multi-walled carbon nanotube is assembled with the fixed support nanogold, and the hairpin nucleotide hpDNA is modified with thiol at the 5' end and methylene blue (MB) at the 3' end and fixed therein via Au-S bonds.

2. The MWCNTs-Au electrochemical biosensor according to claim 1, characterized in that: The sequence of the hpDNA is HS-SH C6-TGCTTGCCAAGCTGTATGCTTTTCTCTTTTGCATTGTAGTTTTCTTTTT-MB; The CRISPR-crRNA-Target DNA ternary complex is obtained by compounding CRISPR / Cas12a, crRNA and Target DNA, and the sequence of the crRNA is UAAUUUCUAAGUGUAGAUGUUGAAGUUGCACUAUAUAC (SEQ ID NO.1); The sequence of the Target DNA is GCATCACAAACAGATAATGGCGTAAATAGAAGTGGTTCTGAAGATCCAACAGTATATAGTGCAACTTCAACTAAAAAATTACATAAAGAACCTGCGACATTAATTAAAGCGATTGATGGTGATACGGTTAAATTAATGT (SEQ ID NO. 2).

3. The method for preparing the MWCNTs-Au electrochemical biosensor according to claim 1, characterized in that: The preparation method comprises: (1) Preparation of multi-walled carbon nanotube-nano-gold-hairpin nucleotide probe modified screen-printed carbon electrode: The MWCNTs material was ultrasonically dispersed in pure water and drop-coated on the surface of the screen-printed carbon electrode SPCE. The screen-printed carbon electrode modified with the multi-walled carbon nanotube material was dried and recorded as MWCNTs / SPCE. Then, a polymerization solution containing tetrachloroauric acid HAuCl4·4H2O was used to electropolymerize on the surface of MWCNTs / SPCE to obtain a nano-gold-multi-walled carbon nanotube material modified screen-printed carbon electrode, which was recorded as MWCNTs-Au / SPCE; Then, hpDNA was added dropwise onto the surface of MWCNTs-Au / SPCE, and after incubation, it was washed several times with PBS, and then mercaptoethanol (MCH) was added dropwise, washed, and dried to obtain a hairpin nucleotide-nanogold-multi-walled carbon nanotube modified screen-printed carbon electrode, which was denoted as hpDNA-MWCNTs-Au / SPCE; (2) Preparation of MWCNTs-Au electrochemical biosensor based on RPA-CRISPR: CRISPR / Cas12a, crRNA, 10×NE buffer 2.1, enzyme-free water and target nucleic acid (Target DNA) of Staphylococcus aureus were mixed and self-assembled to obtain a CRISPR-crRNA-Target DNA ternary complex; The CRISPR-crRNA-Target DNA ternary complex is dropped onto the surface of the hpDNA-MWCNTs-Au / SPCE electrode and reacted. After the reaction is completed, the electrode is rinsed to obtain the RPA-CRISPR-based MWCNTs-Au electrochemical biosensor.

4. The method for preparing the MWCNTs-Au electrochemical biosensor according to claim 3, characterized in that: In step (1), when preparing MWCNTs / SPCE, the dosage ratio of MWCNTs to pure water is 0.5 mg:1 mL, and the drop coating amount is 10 μL.

5. The method for preparing the MWCNTs-Au electrochemical biosensor according to claim 3, characterized in that: In step (1), when preparing MWCNTs-Au / SPCE, the amount of the polymerization solution used is 10 mL, the concentration of HAuCl4·4H2O in the polymerization solution is 2 mM, and the conditions for the electropolymerization are a voltage of -0.2 V and an electropolymerization time of 60 s.

6. The method for preparing the MWCNTs-Au electrochemical biosensor according to claim 3, characterized in that: In step (1), when preparing hpDNA-MWCNTs-Au / SPCE, the concentration of hpDNA is 2 μM and the amount used is 8 μL; The incubation condition is to incubate overnight at 4°C; the concentration of PBS is 10 mM, the pH is 7.2, and the dosage is 100 μL each time; The hpDNA is activated before dropping, and the steps are: using tris(2-carboxyethyl)phosphine hydrochloride (TCEP) to activate the hpDNA sulfhydryl group in the dark, and then dissolving it in TE buffer after activation.

7. The method for preparing the MWCNTs-Au electrochemical biosensor according to claim 3, characterized in that: In step (2), the amounts of CRISPR / Cas12a, crRNA, 10×NE buffer 2.1, enzyme-free water and target nucleic acid of Staphylococcus aureus are 1 μL: 2 μL: 3 μL: 21 μL: 3 μL; The concentration of the CRISPR / Cas12a is 1 μM; the concentration of the crRNA is 1 μM.

8. The method for preparing the MWCNTs-Au electrochemical biosensor according to claim 3, characterized in that: In step (2), the self-assembly is performed at 37° C. for 10 min; The CRISPR-crRNA-Target DNA ternary complex was added in an amount of 30 μL, and the reaction conditions were: reacting at 37° C. for 30 minutes.

9. Use of the MWCNTs-Au electrochemical biosensor according to claim 1 in detecting Staphylococcus aureus.

10. The use according to claim 9, characterized in that: The application is the detection of Staphylococcus aureus in dairy products.

Images