Application of circRERE-AAV in preparation of composition for treating colorectal cancer

Abstract

The invention discloses an application of circRERE-AAV in preparation of a composition for treating colorectal cancer. The nucleotide sequence of circREE in the circRERE-AAV is shown as SEQ ID NO.01. The invention further discloses a preparation method of the circRERE-AAV. The circREE disclosed by the invention is regulated and controlled by EP300 and is low in expression in colorectal cancer; the circREE can adsorb miRNA miR-6837-3p, and after expression of the circREE is reduced, more miR-6837-3p can be released to be combined with MAVS, so that degradation of the MAVS is promoted, and phosphorylation of TBK1, IRF3 and NF kappa B is inhibited; therefore, I-type interferon and proinflammatory cytokines are reduced, and tumor growth is promoted.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of circRERE-AAV in preparing a composition for treating colorectal cancer. Background Art

[0002] Circular RNA (circRNA) is a new type of non-coding RNAs that lacks 5' and 3' ends and has a closed circular structure. It has the characteristics of high stability, tissue-specific and cell-specific expression. Due to its tissue-specific and cell-type-specific expression, different circRNAs have been identified as targets for the treatment of various diseases, including cardiovascular disease, nervous system diseases, cancer, musculoskeletal diseases, etc. Compared with linear RNA, circRNA is more resistant to nuclease exonucleases and is considered to be the most promising candidate for RNA therapy. Many studies have shown that circRNA plays a key role in tumor immunoregulation and immunotherapy. hsa_circ_0020397 can induce the expression of TERT (Telomerase Reverse Transcriptase) and PD-L1 by binding to and inhibiting the activity of miR-138 in colorectal cancer, thereby promoting the immune escape of tumor cells. The circ-0000977 / miR-153 / HIF1α axis can regulate HIF1α-mediated immune escape of pancreatic cancer cells by inhibiting the killing activity of NK cells. circARSP91 can interact with the ULBP1 promoter region and recruit RNA polymerase II to enhance the expression of the ULBP1 gene, thereby assisting NK cells in recognizing and attacking target tumor cells. In addition to the circRNA-miRNA and circRNA-mRNA action networks, circRNA can also act as a potential tumor antigen. For example, circNDUFB2 has been shown to be recognized by RIG-I to activate the RIG-I-MAVS signaling cascade and recruit immune cells into the tumor microenvironment. In addition, through complementary sequences, circRNA can bind to some tumor-specific miRNAs and mRNAs to form a new type of tumor antigen, coexist with these RNAs in exosomes to enhance their stability, and be released once they reach specific immune cells to promote anti-tumor effects.

[0003] For advanced colorectal cancer, the use of fluorouracil drugs alone or in combination is the main chemotherapy regimen in clinical practice, but drug resistance severely limits its efficacy. Immunotherapy is an innovation in the field of tumor treatment and has gradually become a new trend in cancer treatment. The most popular immunotherapy at present is immune checkpoint inhibitors, which can fight tumors by relieving the suppression of tumor cells on the immune system and restarting the body's own immune system. However, in the field of colorectal cancer immunotherapy, many clinical studies have shown that immune checkpoint inhibitors are only effective for patients with colorectal cancer with defective mismatch repair function or high microsatellite instability (dMMR-MSI-H, referred to as MSI-H), and are ineffective for patients with intact mismatch repair function or low microsatellite instability or microsatellite stability (pMMR-MSI-L, referred to as MSL-L). However, the proportion of MSI-H patients is very small, and the incidence gradually decreases with the increase of tumor stage. Most colorectal cancers respond very poorly to immunotherapy, which we call "cold tumors", and patients cannot benefit from the treatment of immune checkpoint inhibitors. Summary of the invention

[0004] The purpose of the present invention is to overcome the defects of the prior art and provide the use of circRERE-AAV in the preparation of a composition for treating colorectal cancer.

[0005] Another object of the present invention is to provide a

[0006] The technical solution of the present invention is as follows:

[0007] The use of circRERE-AAV in preparing a composition for treating colorectal cancer is characterized in that the nucleotide sequence of circRERE in the circRERE-AAV is shown in SEQ ID NO.01.

[0008] In a preferred embodiment of the present invention, the effective component of the composition is only PD-1 monoclonal antibody.

[0009] In a preferred embodiment of the present invention, the effective component of the composition further includes PD-1 monoclonal antibody.

[0010] Further preferably, the effective components of the composition consist of the circRERE-AAV and PD-1 monoclonal antibody.

[0011] In a preferred embodiment of the present invention, the administration concentration of circRERE-AAV is 5×10 8 pfu.

[0012] Another technical solution of the present invention is as follows:

[0013] A composition for treating colorectal cancer, the effective component of which includes circRERE-AAV, and the nucleotide sequence of circRERE in the circRERE-AAV is shown in SEQ ID NO.01.

[0014] In a preferred embodiment of the present invention, the effective component is the circRERE-AAV.

[0015] In a preferred embodiment of the present invention, the effective components also include PD-1 monoclonal antibody.

[0016] Further preferably, the effective components consist of the circRERE-AAV and PD-1 monoclonal antibody.

[0017] In a preferred embodiment of the present invention, the administration concentration of circRERE-AAV is 5×10 8 pfu.

[0018] The beneficial effects of the present invention are:

[0019] 1. If Figure 1 As shown, circRERE in the present invention is regulated by EP300 and is lowly expressed in colorectal cancer; circRERE can adsorb miRNA miR-6837-3p. After the expression of circRERE is reduced, more miR-6837-3p can be released to bind to MAVS, promote MAVS degradation, and inhibit the phosphorylation of TBK1, IRF3 and NFκB; thereby leading to a decrease in type I interferon and proinflammatory cytokines, and promoting tumor growth.

[0020] 2. circRERE in the present invention can significantly affect the expression of type I interferon pathway and corresponding immune factors, affect the infiltration of CD8+T cells in the tumor immune microenvironment, significantly change the tumor microenvironment, and promote the transformation of "cold tumors" to "hot tumors".

[0021] 3. The combination of circRERE and PD-L1 in the present invention can significantly improve the therapeutic effect of colorectal cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is a schematic diagram of the present invention.

[0023] Figure 2 Schematic diagram of the AAV vector in the embodiment of the present invention.

[0024] Figure 3 This is one of the experimental result diagrams in Example 1 of the present invention.

[0025] Figure 4 This is the second diagram of the experimental results in Example 1 of the present invention. DETAILED DESCRIPTION

[0026] The technical solution of the present invention is further illustrated and described below through specific implementation modes in combination with the accompanying drawings.

[0027] The preparation method of the novel oncolytic virus circRERE-AAV in the following examples comprises: the nucleotide sequence of circRERE as shown in SEQ ID NO.01

[0028] (CATTTTTGAAACGTTGGGGTTGTTGGAGTGGTTGGATTTTCCCTGGAATTGAGTGAGAAATTCAGAAGACTGAAGCCCAGGCTTACTGTCTACCTTTCACGGAGGCCTAGCCGTGAGAGGACAGAAGAAGGCACGTGGCGAATCATGACAGCGGACAAAGACAAAGACAAAGACAAAGAGAAGGACCGGGACCGAGACCGGGACCGAGAGAGAGAGAAAAGAGACAAAGCAAGAGA GAGTGAGAATTCAAGGCCACGCCGGAGCTGTACCTTGGAAGGAGGAGCCAAAAATTATGCTGAGAGTGATCACAGTGAAGACGAGGACAATGACAACAATAGTGCCACCGCAGAGGAGTCCACGAAGAAGAATAAGAAGAAACCACCGAAAAAAAAGTCTCGTTATGAAAGGACAGATACCGGTGAGATAACATCCTACATCACTGAAGATGATGTGGTCTACAGACCAGGAG) cloned into e.g. Figure 2 Between the 5'circ frame and the 3'circ frame of the AAV vector shown (pADM-CMV-circRNA-mCMV-copGFP, purchased from WZ Biosciences Inc.).

[0029] Example 1

[0030] In this example, a subcutaneous colorectal cancer tumor model was constructed in immunodeficient or healthy mice and intratumoral injection was performed to verify the therapeutic effect of circRERE-AAV alone and in combination with PD-1 in solid tumors.

[0031] Figure 3The figure reflects the effect of circRERE-AAV alone on the HCT116 colorectal cancer model constructed in immunodeficient mice. HCT116 cell suspension was injected into the right groin of immunodeficient mice. Generally, tumors formed after 1-2 weeks. When the tumor size reached 100mm 3 A control group (NC AAV) and a circRERE-AAV group were set up; the drug was injected intratumorally once a week, with 5×10 8 pfu. The observation indicators include tumor volume changes and mouse body weight, which are measured twice a week. Tumors are taken after 2 weeks to detect tumor weight and related indicators (i.e., RT-qPCR detection). Figure 3 It can be seen that circRERE-AAV alone can effectively inhibit the growth of colorectal cancer-bearing mice after infecting them, and enhance the expression of immune-related factors such as IFNA1, ISG15, OASL, IL7, and ISG20.

[0032] Figure 4 The effect of circRERE-AAV combined with PD-1 monoclonal antibody on the MC38 colorectal cancer model constructed by immune-competent mice. MC38 cell suspension was injected into the right groin of immune-competent mice. Generally, tumors formed after 1-2 weeks. When the tumor size reached 100mm 3 A total of 104 patients were treated with circRERE-AAV and PD-1. The control group (ctrl AAV+vehicle), PD-1 monotherapy group (ctrl AAV+PD-1), circRERE-AAV monotherapy group (circRere AAV+vehicle), and circRERE-AAV and PD-1 combination group (circRere AAV+PD-1) were set up. circRERE-AAV was injected intratumorally once a week, 5×10 8 pfu; PD-1 monoclonal antibody was intraperitoneally injected, 200 μg / mouse, twice a week. Observation indicators included changes in tumor volume and mouse body weight, which were measured twice a week. Tumors were harvested 2 weeks later for tumor weight and related index detection (immunohistochemistry).

[0033] Can be obtained from Figure 4 It can be seen that in the immune-competent colorectal cancer mouse model, the tumor size of circRERE-AAV was significantly reduced compared with the solvent control group; compared with the other three groups, circRERE-AAV combined with PD-1 monoclonal antibody showed a significant synergistic effect. No significant weight loss was found in the mice, proving that there were no obvious side effects whether it was a single drug or a combination of drugs.

[0034] The above description is only a preferred embodiment of the present invention, and therefore cannot be used to limit the scope of the present invention. That is, equivalent changes and modifications made according to the patent scope of the present invention and the contents of the specification should still fall within the scope of the present invention.

Claims

1. Use of circRERE-AAV in preparing a composition for treating colorectal cancer, characterized in that: The nucleotide sequence of circRERE in the circRERE-AAV is shown in SEQ ID NO.

01.

2. The use according to claim 1, characterized in that: The effective component of the composition is only PD-1 monoclonal antibody.

3. The use according to claim 1, characterized in that: The effective component of the composition also includes PD-1 monoclonal antibody.

4. The use according to claim 3, characterized in that: The effective components of the composition consist of the circRERE-AAV and PD-1 monoclonal antibody.

5. The use according to any one of claims 1 to 4, characterized in that: The administration concentration of circRERE-AAV was 5×10 8 pfu.

6. A composition for treating colorectal cancer, characterized in that: Its effective components include circRERE-AAV, and the nucleotide sequence of circRERE in the circRERE-AAV is shown in SEQ ID NO.

01.

7. A composition for treating colorectal cancer according to claim 6, characterized in that: Its effective component is the circRERE-AAV.

8. A composition for treating colorectal cancer according to claim 6, characterized in that: Its active ingredients also include PD-1 monoclonal antibodies.

9. A composition for treating colorectal cancer according to claim 8, characterized in that: Its effective components consist of the circRERE-AAV and PD-1 monoclonal antibody.

10. A composition for treating colorectal cancer according to any one of claims 6 to 9, characterized in that: The administration concentration of circRERE-AAV was 5×10 8 pfu.

Images