SNP (Single Nucleotide Polymorphism) molecular marker related to pig daily gain character on No.17 chromosome and application of SNP molecular marker

Abstract

The invention discloses a novel SNP (Single Nucleotide Polymorphism) molecular marker related to a pig daily gain character and an application of the SNP molecular marker in breeding. The SNP molecular marker is Agt located at the 15401211bp position of the No.17 chromosome of a pig genome Ensembl Sscrofa11.1 version; g mutation. Through the application of the SNP molecular marker, the daily weight gain performance of large Duroc commercial pigs and Duroc boars thereof can be improved, so that the growth speed is increased, the on-the-market time is shortened, and the economic benefits are improved; and through the SNP molecular marker and the application thereof, the breeding period can be greatly shortened, the breeding cost is saved, and the market competitiveness is improved.

Description

Technical Field

[0001] The present invention relates to the field of pig molecular marker technology and animal breeding, and in particular to a SNP molecular marker on chromosome 17 related to the daily weight gain trait of pigs and its application. Background Art

[0002] In modern pig farming, improving growth rate is one of the core goals of breeding. As a core indicator for evaluating growth performance, average daily gain (ADG) directly affects the economic benefits of the pig farming industry. Duroc boars are widely used as terminal sires in commercial production due to their excellent growth performance and feed conversion efficiency. By improving the daily gain trait of Duroc boars, the fattening time of commercial pigs can be effectively shortened, production efficiency can be improved, and feeding costs can be reduced.

[0003] The application of genome-wide association studies (GWAS) has opened up new avenues for the genetic improvement of growth traits. With the help of high-throughput sequencing and whole-genome chips, this technology can comprehensively identify gene loci and genetic variations associated with target traits. It is worth noting that traditional GWAS studies are mostly focused on purebred populations in high-quality environments, while commercial hybrid pigs in actual production often face a more complex breeding environment, so research on hybrid pigs is more valuable for breeding. At the same time, since the current form of boar stations is basically adopted, artificial insemination is performed after collecting semen to improve the breeding efficiency, so the breeding efficiency of boars is very high. Therefore, in breeding farms, the breeding scale of boars is generally limited, and when breeding, more attention is paid to the reproductive performance of boars, and their growth performance is relatively ignored. Therefore, the breeding scale of purebred populations is limited, especially for Duroc boars as the paternal parent. It is difficult to obtain a large amount of scientific growth trait data due to its limited breeding scale, so there are certain difficulties in screening molecular markers related to growth traits of purebred Duroc boars as the paternal parent. However, the genotype of the father will directly affect the genotype of commercial pigs, which has a very large impact on molecular breeding. Studies have found that under the premise of a certain genetic association, the use of hybrid populations as reference populations has unique advantages. Therefore, effective molecular markers can be screened out through hybrid populations and then applied to purebred populations, especially purebred paternal populations (such as Duroc paternal populations), which can be more accurately genetically selected. Therefore, the screening and application of molecular markers for commercial pigs is not only conducive to the selection and breeding of commercial pigs, but is also more important for the selection and breeding of growth traits of purebred populations (such as Duroc paternal populations) with limited breeding scales.

[0004] With the advancement of molecular biology technology, integrating SNP markers identified by GWAS into marker-assisted selection (MAS) and genomic selection provides a new idea for improving breeding efficiency. This strategy can not only improve the accuracy of trait prediction and accelerate selection progress, but also improve the performance of commercial generations by improving purebred populations. This technological innovation provides a more efficient tool for modern pig breeding and is expected to bring significant economic benefits. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP molecular marker related to the daily weight gain trait of pigs on chromosome 17, to provide a basis for the daily weight gain breeding of Duroc commercial pigs and the breeding of the daily weight gain trait of its paternal Duroc boars, which is applied to the breeding of Duroc commercial pigs or Duroc boars, which can greatly shorten the breeding period and improve the breeding efficiency. At the same time, by screening out effective SNP molecular markers with reference to the growth data of commercial pigs, and then applying them to the paternal purebred pigs, it is possible to make up for the problem that the breeding scale of the paternal purebred pigs (such as Duroc boars) is limited and the growth trait data is lacking. Through the breeding of the paternal purebred pigs at the genetic level, the breeding process of commercial pigs can be further accelerated, and the purpose of improving the performance of commercial generations by improving the purebred population can be achieved.

[0006] According to the first aspect of the present invention, a SNP molecular marker on chromosome 17 related to the daily weight gain trait of pigs is provided, and the SNP molecular marker is an A>G mutation located at the 15401211bp position of chromosome 17 of the pig genome Ensembl Sscrofa11.1 version (hereinafter referred to as "yz_rs80965549SNP molecular marker"). Thus, through the SNP molecular marker, the daily weight gain trait of pigs can be selected and bred, and the daily weight gain performance of pigs can be improved, the growth rate can be increased, and the breeding period can be shortened, thereby improving their economic value and market competitiveness.

[0007] According to a second aspect of the present invention, the application of the yz_rs80965549 SNP molecular marker in improving the daily weight gain of pigs is provided. Thus, the daily weight gain performance of pigs can be improved and the market weight and economic value can be increased through this application.

[0008] In certain embodiments, the pig is a Duroc boar or a Duroc boar.

[0009] According to a third aspect of the present invention, there is provided an application of the yz_rs80965549SNP molecular marker in breeding a Duroc commercial pig strain with high daily weight gain, the application comprising the following steps: S1: detecting the genotype of the yz_rs80965549SNP molecular marker of the paternal Duroc boar; S2: selecting individuals with the GG genotype of the yz_rs80965549SNP molecular marker allele detected in step S1 as breeding boars for breeding with Changda binary hybrid sows; S3: detecting the genotype of the yz_rs80965549SNP molecular marker of the piglets born from the breeding in step S2, selecting the individuals with the GG or GA genotype detected, and then breeding, so as to breed a Duroc commercial pig strain with high daily weight gain. In this way, we can obtain the Duchangda commercial pig breed with high daily weight gain performance. The pigs of this breed not only have a high daily weight gain, but also a fast growth rate, which can shorten the market release date and increase the market release weight, thereby improving their economic value and competitiveness and improving production efficiency.

[0010] According to a fourth aspect of the present invention, there is provided an application of the yz_rs80965549SNP molecular marker in breeding a core group of Duroc boars with high daily weight gain, the application comprising the following steps: S1: detecting the genotype of the yz_rs80965549SNP molecular marker in reserve Duroc breeding pigs; S2: selecting individuals whose allele type of the yz_rs80965549SNP molecular marker detected in step S1 is the GG genotype as reserved breeding pigs, and breeding the reserved breeding pigs, wherein both the male and female pigs used for breeding are of the GG genotype; S3: all the boars born from the breeding in step S2 are of the GG dominant genotype, that is, they can be selected as the core group of Duroc boars, which have a higher daily weight gain performance. In this way, the problems of limited Duroc boar breeding scale and difficulty in obtaining growth data, which restrict the selection of growth performance, can be overcome. In addition, the SNP molecular markers screened through commercial pigs can be used as a reference in the selection of paternal Duroc pigs and the construction of core groups. The daily weight gain performance of all commercial pigs using the paternal semen can be improved, greatly improving the breeding efficiency of breeding farms and commercial pigs and increasing their economic value.

[0011] According to a fifth aspect of the present invention, there is provided an application of the yz_rs80965549SNP molecular marker for improving the daily weight gain trait of Duroc Changda commercial pigs, the application comprising the following steps: S1: detecting the genotype of the yz_rs80965549SNP molecular marker on the paternal Duroc boar; S2: selecting individuals whose allele genotype of the yz_rs80965549SNP molecular marker detected in step S1 is the GG genotype as retained breeding pigs, and mating the retained breeding pigs with Changda binary hybrid sows; S3: detecting the genotype of the yz_rs80965549SNP molecular marker on the piglets born from the mating in step S2, retaining and cultivating the detected GG or GA genotype individuals, eliminating the AA genotype, so as to increase the frequency of the dominant allele G from generation to generation, thereby increasing the daily weight gain of the Duroc Changda commercial pig population and improving the daily weight gain trait of the offspring Duroc Changda commercial pigs. In this way, the daily weight gain performance of Duroc Changda commercial pigs can be improved and the frequency of dominant genotypes can be increased, thereby improving the daily weight gain traits of offspring pigs and enhancing their economic value and market competitiveness.

[0012] According to a sixth aspect of the present invention, there is provided an application of the yz_rs80965549SNP molecular marker for improving the daily weight gain trait of Duroc boars, the application comprising the following steps: S1: detecting the genotype of the yz_rs80965549SNP molecular marker on reserve Duroc breeding pigs; S2: selecting individuals whose allele genotype of the yz_rs80965549SNP molecular marker detected in step S1 is the GG genotype as breeding pigs, and breeding the breeding pigs; S3: detecting the genotype of the yz_rs80965549SNP molecular marker on piglets born from the breeding in step S2, retaining the GG genotype individuals detected, and then breeding them, retaining individuals with the dominant genotype of GG or GA in the offspring pigs, eliminating the AA genotype, so as to increase the frequency of the dominant allele G from generation to generation, thereby increasing the daily weight gain of the pig group and improving the daily weight gain trait of the offspring pigs. In this way, the daily weight gain performance of Duroc boars can be improved. When it is used as a sire of commercial pigs for breeding, the daily weight gain performance of commercial pigs can be improved, thereby increasing the growth rate and economic value.

[0013] According to the seventh aspect of the present invention, there is provided a nucleotide sequence containing a SNP molecular marker associated with the daily weight gain trait of pigs, the sequence containing the nucleotide sequence shown in SEQ ID No: 1, and the 101st base M in the sequence represents a base mutation of A>G. Thus, by using the nucleotide sequence of the SNP molecular marker, breeding can be carried out efficiently.

[0014] According to the eighth aspect of the present invention, there is provided a use of a nucleotide sequence containing a SNP molecular marker associated with the daily weight gain trait of a pig in detecting / screening / identifying / evaluating the daily weight gain trait of a Duroc boar or a Duroc-Changda pig, the sequence containing the nucleotide sequence shown in SEQ ID No: 1, and the 101st base M in the sequence represents a base mutation of A>G. Thus, through this application, the breeding efficiency can be efficiently improved and the breeding period can be shortened.

[0015] According to the ninth aspect of the present invention, there is provided a use of a nucleotide sequence containing a SNP molecular marker associated with the daily weight gain trait of a pig in the preparation of a product for detecting / screening / identifying / evaluating the daily weight gain trait of a Duroc boar or a Duroc-Changda pig, the sequence containing a nucleotide sequence as shown in SEQ ID No: 1, and the 101st base M in the sequence represents a base mutation of A>G. Thus, the corresponding product can be prepared from the nucleotide sequence for the detection / screening / identification / evaluation of the daily weight gain trait of a Duroc boar or a Duroc-Changda pig, which is simple, safe and efficient.

[0016] Beneficial effects of the present invention:

[0017] 1. A new SNP molecular marker related to the daily weight gain trait of pigs and its application in breeding are disclosed. Through the application of the SNP molecular marker, the daily weight gain performance of Duroc commercial pigs and Duroc boars can be improved, thereby increasing the growth rate, shortening the stocking time, and increasing economic benefits; and through the SNP molecular marker and its application, the breeding period can be greatly shortened, the breeding cost can be saved, and the market competitiveness can be improved.

[0018] 2. The present invention screens out SNP molecular markers significantly correlated with the daily weight gain trait by collecting growth data of Duroc commercial pig groups, and can use this as a reference to apply it to the breeding of paternal Duroc boars. This overcomes the reality that the Duroc boar breeding population is limited and growth data is lacking. In addition, the existing mating modes all adopt the mode of artificial insemination in boar stations. On average, one boar can mate 300-400 sows. By improving the dominant genotype of the paternal purebred Duroc pig, the genotype of the commercial pig can be directly affected, and then its growth performance can be affected. Therefore, compared with the direct breeding of commercial pigs, the breeding of paternal purebred pigs is more cost-effective and more efficient. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1The Manhattan diagram of the FarmCPU model and the MLM model: the X-axis is the position of the SNP site on the chromosome, the Y-axis is the -log10 (P value) corresponding to the SNP site, the solid line is the significant P value threshold of 0.05 / 114501, and the red dot in the figure marked as "yz_rs80965549" is the screened molecular marker, and its significant P values ​​are 1.26E-08 (FarmCPU model) and 7.21E-11 (MLM model) respectively;

[0020] Figure 2 QQ diagram of FarmCPU model and MLM model. DETAILED DESCRIPTION

[0021] The invention will be further described in detail below with reference to the accompanying drawings and embodiments.

[0022] Example 1 Genome-wide association analysis of daily weight gain traits of Duchangda commercial pigs

[0023] 1. Test materials

[0024] The population used in this application is Duroc Changda commercial pigs from the breeding experimental field of Guangxi Yangxiang Group Co., Ltd. [Duroc Changda commercial pigs are a hybrid of Duroc boars (paternal) × Changda binary hybrid sows (maternal); and Changda binary hybrid sows are a hybrid of Landrace boars (paternal) × Yorkshire sows (maternal)]. Individual data records of the measurement station from 2022 to 2023 were collected for this study. After filtering the abnormal phenotypic data, a total of 4346 pigs were obtained for daily weight gain trait (30-120KG) observations for phenotype-genotype association analysis.

[0025] 2. Test methods

[0026] 2.1 Genotyping and quality control

[0027] Ear tissue samples of Duchangda commercial pigs were collected, total DNA was extracted, and genotyping of qualified DNA samples was performed using the pig 80K functional site gene chip [Shadow Gene, CHN, DNBSEQ-T7 (MGI), code P231103]. For all SNP markers located on 18 autosomes, quality control was performed using Plink software, and the standards were: removing individuals with SNP detection rate <99%, minimum allele frequency <0.05, Hardy-Weinberg equilibrium test P value less than 10-6, and individual detection rate <95%. For missing genotypes, Beagle software (version 5.1) was used for filling, and quality control was performed again after filling, and the quality control conditions were the same as before. After quality control, 4346 Duchangda commercial pigs and 114,501 SNP sites were finally used for subsequent whole-base group association analysis.

[0028] 2.2 Genome-wide association analysis

[0029] GWAS analysis was performed using the FarmCPU model (Liu X, Huang M, Fan B, et al. Iterative usage of fixed and random effect models for powerful and efficient genome-wide association studies [J]. PLoS genetics, 2016, 12 (2): e1005767) and the MLM model (Yu J, Pressoir G, Briggs WH, et al. A unified mixed-model method for association mapping that accounts for multiple levels of relatedness [J]. Nature genetics, 2006, 38 (2): 203-208.) in the MVP software package in the R statistical environment. The Bonferroni correction method was used to determine the significance thresholds of the whole genome and chromosomes, and the significance threshold at the whole genome level was 0.05 / 114501. The SNP markers detected by the two methods that were significantly associated with the daily weight gain trait were obtained respectively, and the SNP markers detected by both methods were taken as candidate SNPs.

[0030] 3. Screening of trait-associated markers

[0031] This application uses 4346 Duroc pigs as the subjects, and uses 114501 SNPs obtained by gene chip technology to conduct GWAS analysis on pig daily weight gain. The analysis obtained a SNP molecular marker site that is significantly related to pig daily weight gain at the 5% genome level corrected by Bonferroni (P<0.05 / 114501). Its position on the chromosome is the 15401211bp position (chr17:15401211) of chromosome 17 of the pig genome EnsemblSscrofa11.1 version. The molecular marker is recorded as yz_rs80965549. Figure 1 and Figure 2 As shown: Figure 1The Manhattan plot of the FarmCPU model and the MLM model, with the X-axis representing the position of the SNP site on the chromosome, the Y-axis representing the -log10 (P value) corresponding to the SNP site, the solid line representing the significant P value threshold of 0.05 / 114501, and the red dot in the figure marked as "yz_rs80965549" is the screened molecular marker, with significant P values ​​of 1.26E-08 (FarmCPU model) and 7.21E-11 (MLM model) respectively; Figure 2 QQ diagram of FarmCPU model and MLM model.

[0032] Example 2 Comparison of daily weight gain traits of commercial pigs with different genotypes using SNP markers

[0033] A mixed linear model (MLM) was used to analyze the effect of different genotypes of marker yz_rs80965549 (A>G) on daily weight gain. The analysis model is as follows:

[0034] y ijkl =μ+G i +Sex j +ID k +e ijkl

[0035] Among them, y ijkl is the individual daily weight gain phenotype value; μ is the mean; G i is the ith genotype effect; Sex j is the jth gender effect; ID k is the kth individual random effect; e ijkl is the random residual.

[0036] The statistical results of daily weight gain of pigs with different genotypes of yz_rs80965549 (chr17:15401211) are shown in Table 1. Among them, the daily weight gain of pigs with GG genotype is 37.17g higher than that of pigs with AA genotype; the daily weight gain of pigs with GA genotype is 20.72g higher than that of pigs with AA genotype; the difference between the groups reached an extremely significant level (P<0.001). The daily weight gain of pigs with GG genotype is 16.41g higher than that of pigs with GA genotype, and the difference is significant (P<0.05). Therefore, GG is the dominant genotype for increasing the daily weight gain of Durocopterus longipes commercial pigs, and G is the dominant allele for increasing the daily weight gain of Durocopterus longipes commercial pigs. When breeding, the dominant allele G is selected to be retained, and the A allele is eliminated.

[0037] Table 1 Differences in daily weight gain of commercial pigs with different genotypes at the yz_rs80965549 locus

[0038]

[0039] Note: Mean means mean; Sd means standard deviation. P-value < 0.05 means significant difference, P-value < 0.01 means highly significant difference, and p-value < 0.001 means extremely significant difference.

[0040] Example 3: Nucleotide sequence of SNP molecular marker

[0041] According to the marker yz_rs80965549 screened in the above Example 1, the EnsemblSscrofa11.1 version is referenced through the pig genome, and it is located at the 15401211bp position of chromosome 17, which is an A>G mutation. The upstream and downstream nucleotide sequences of the SNP molecular marker are shown in SEQ ID No: 1. In the nucleotide sequence shown in SEQ ID NO: 1, the M at the 101st base indicates that the allele is A or G. The sequence of SEQ ID No: 1 is as follows:

[0042] GGTTGGGGATGGTGGGGGAGGTAGTAGAAAAAAGCTTCCTGAAAAGGCAACATTTCAGCTGACACCTTCATGATGAGTAGGGAACAGCTAAGGAAAGAGT M(A / G) AAAGTAGGAGTGTTCTAGCAAAGGGCAGACTCGGTATGTCCAAAAGCTTGCTGTGCTAAGGAATTGGAGGAGCTTTAGGACATACACAACTTGTGCTTGT

[0043] Through the above nucleotide sequence containing the SNP molecular marker related to the daily weight gain trait of pigs, primers or probes can be designed to detect the genotype of the SNP molecular marker at the corresponding site, and then the daily weight gain trait of pigs can be further selected according to the detection results; or primers can be designed through the nucleotide sequence to make corresponding detection kits to be directly used for the detection of SNP molecular markers, and then the daily weight gain trait of pigs can be selected according to the detected genotype. Primers or probes designed with reference to the nucleotide sequence shown in SEQ ID No: 1 or directly made into corresponding detection kits can efficiently, quickly and conveniently detect / screen / identify / evaluate SNP molecular markers related to the daily weight gain trait of pigs, and further be used for the selection of daily weight gain traits of pigs.

[0044] Example 4: Application of yz_rs80965549 SNP molecular marker in Duroc boar breeding

[0045] By testing the genotype of the yz_rs80965549SNP molecular marker in reserve Duroc boars, and selecting individuals with the yz_rs80965549SNP molecular marker GG as breeding boars and eliminating the AA and GA types, the frequency of the dominant allele G can be gradually increased, thereby increasing the daily weight gain of the breeding population and increasing the growth rate.

[0046] Example 5: Application of yz_rs80965549 SNP marker in evaluating daily weight gain traits of Duroc boars

[0047] The genotype of the yz_rs80965549SNP molecular marker of the Duroc boar to be evaluated was identified. When the genotype was GG or GA, the daily weight gain of the boar to be evaluated was large; when the genotype was AA, the daily weight gain of the boar to be evaluated was small.

[0048] Example 6: Application of yz_rs80965549 SNP marker in evaluating daily weight gain traits of Duranta sutchuenensis commercial herd

[0049] The genotype of the yz_rs80965549SNP molecular marker in the Duroc commercial herd to be evaluated was identified. When the Duroc boar with the genotype of GG was used to breed dual-purpose sows, the Duroc commercial pigs of the offspring of the boar with this genotype had a large daily weight gain; when the genotype was AA, the Duroc commercial pigs of the offspring of the boar with this genotype had a small daily weight gain.

[0050] Example 7: Application of yz_rs80965549 SNP marker in breeding high daily weight gain commercial pig strain

[0051] The genotype of the yz_rs80965549SNP molecular marker is detected in the paternal Duroc boar; individuals with the GG genotype of the yz_rs80965549SNP molecular marker allele obtained by the detection are selected as breeding boars for breeding with Changda binary hybrid sows; the genotype of the yz_rs80965549SNP molecular marker is detected in the piglets born from the breeding, and the individuals with the GG or GA genotype obtained by the detection are selected and retained, and then the breeding is carried out to breed a Duroc Changda commercial pig strain with high daily weight gain. Example 8: Application of the yz_rs80965549SNP molecular marker in breeding a core group of Duroc boars with high daily weight gain

[0052] The genotype of the yz_rs80965549SNP molecular marker is detected in the reserve Duroc breeding pigs; the individuals with the GG genotype of the yz_rs80965549SNP molecular marker allele obtained by the detection are selected as the reserve breeding pigs, and the reserve breeding pigs are bred, and the male and female pigs used for breeding are all of GG genotype; all the boars born from the breeding are of GG dominant genotype, and can be selected as the core group of Duroc boars, which have higher daily weight gain performance.

[0053] Example 9: Application of yz_rs80965549 SNP molecular marker in improving daily weight gain traits of Duroc Changda commercial pigs

[0054] The genotype of the yz_rs80965549SNP molecular marker is detected for the paternal Duroc boar; individuals with the GG genotype of the yz_rs80965549SNP molecular marker detected in step S1 are selected as breeding pigs, and the breeding pigs are mated with Changda binary hybrid sows; the genotype of the yz_rs80965549SNP molecular marker is detected for the piglets born from the mating in step S2, and the individuals with the GG or GA genotype detected are retained and cultivated, and the AA genotype is eliminated, so as to increase the frequency of the dominant allele G from generation to generation, thereby increasing the daily weight gain of the Duroc Changda commercial pig group and improving the daily weight gain trait of the Duroc Changda commercial pig.

[0055] Example 10: Application of yz_rs80965549 SNP molecular marker in improving daily weight gain traits of Duroc boars

[0056] The genotype of the yz_rs80965549SNP molecular marker is detected in the reserve Duroc boar; the individuals with the GG genotype of the yz_rs80965549SNP molecular marker obtained by the detection are selected as the reserved breeding pigs, and the reserved breeding pigs are bred; the genotype of the yz_rs80965549SNP molecular marker is detected in the piglets born from the breeding, and the individuals with the GG genotype obtained by the detection are retained for breeding, and then bred, and the individuals with the dominant genotype of GG or GA in the offspring pigs are retained, and the AA genotype is eliminated, so as to increase the frequency of the dominant allele G from generation to generation, thereby increasing the daily weight gain of the pig group and improving the daily weight gain trait of the offspring pigs.

Claims

1. SNP molecular markers on chromosome 17 related to daily weight gain traits of pigs, including: The SNP molecular marker is an A>G mutation located at the 15401211bp position of chromosome 17 in the pig genome Ensembl Sscrofa11.1 version.

2. Use of the SNP molecular marker described in claim 1 in increasing daily weight gain of pigs.

3. The use according to claim 2, wherein: The pig is a Duroc commercial pig or a Duroc boar.

4. Application of the SNP molecular marker described in claim 1 in breeding high daily weight gain commercial pig strains, wherein: The application comprises the following steps: S1: Detecting the genotype of the SNP molecular marker as claimed in claim 1 on the paternal Duroc boar; S2: selecting the individuals with the GG genotype at the 15401211bp position of chromosome 17 detected in step S1 as breeding boars for breeding with grown-up two-way hybrid sows; S3: Detect the genotype of the SNP molecular marker as claimed in claim 1 for the piglets born from mating in step S2, select the GG or GA genotype individuals detected, and then cultivate them to cultivate the Duroc-Changda commercial pig strain with high daily weight gain.

5. Application of the SNP molecular marker described in claim 1 in breeding a core group of high daily weight gain Duroc boars, wherein: The application comprises the following steps: S1: Detecting the genotype of the SNP molecular marker as claimed in claim 1 on the reserve Duroc breeding pigs; S2: selecting the individuals with the GG genotype at the 15401211bp position of chromosome 17 detected in step S1 as the reserved breeding pigs, and breeding the reserved breeding pigs, wherein both the male and female pigs used for breeding are of the GG genotype; S3: All the boars born from the mating in step S2 are of GG dominant genotype and are selected as the core group of Duroc boars, which have higher daily weight gain performance.

6. Application of the SNP molecular marker described in claim 1 in improving the daily weight gain trait of Durococcus spp. commercial pigs, wherein: The application comprises the following steps: S1: Detecting the genotype of the SNP molecular marker as claimed in claim 1 on the paternal Duroc boar; S2: selecting the individuals with the GG genotype at the 15401211bp position of chromosome 17 detected in step S1 as breeding pigs, and mating the breeding pigs with grown-up dual-purpose sows; S3: Detect the genotype of the SNP molecular marker as described in claim 1 for the piglets born from mating in step S2, retain and cultivate the GG or GA genotype individuals detected, and eliminate the AA genotype to increase the frequency of the dominant allele G generation by generation, thereby increasing the daily weight gain of the Duchangda commercial pig population and improving the daily weight gain trait of Duchangda commercial pigs.

7. Application of the SNP molecular marker described in claim 1 in improving the daily weight gain trait of Duroc boars, wherein: The application comprises the following steps: S1: Detecting the genotype of the SNP molecular marker as claimed in claim 1 on the reserve Duroc breeding pigs; S2: selecting the individuals with the GG genotype at the 15401211bp position of chromosome 17 detected in step S1 as the reserved breeding pigs, and breeding the reserved breeding pigs; S3: The genotype of the SNP molecular marker as described in claim 1 is detected for the piglets born from mating in step S2, and the GG genotype individuals detected are retained for breeding, and then bred, and the individuals with the dominant genotype of GG or GA in the offspring pigs are retained, and the AA genotype is eliminated, so as to increase the frequency of the dominant allele G from generation to generation, thereby increasing the daily weight gain of the pig group and improving the daily weight gain trait of the offspring pigs.

8. A nucleotide sequence containing a SNP molecular marker associated with the daily weight gain trait of pigs, wherein: The sequence contains the nucleotide sequence shown in SEQ ID No: 1, and the 101st base M in the sequence represents an A>G base mutation.

9. Use of the nucleotide sequence containing the SNP molecular marker associated with the daily weight gain trait of pigs as described in claim 8 in detecting / screening / identifying / evaluating the daily weight gain trait of Duroc boars or Duroc-Changda pigs.

10. Use of the nucleotide sequence containing the SNP molecular marker associated with the daily weight gain trait of pigs as described in claim 8 in the preparation of a product for detecting / screening / identifying / evaluating the daily weight gain trait of Duroc boars or Duroc-Changda pigs.

Images