Hypoglycemic and lipid-controlling composition targeting ChREBP gene of Micropterus salmoides as well as preparation method and application of hypoglycemic and lipid-controlling composition

Abstract

The invention belongs to the field of aquaculture, and particularly relates to a blood-glucose-reducing and lipid-controlling composition targeting a ChREBP gene of micropterus salmoides as well as a preparation method and application of the blood-glucose-reducing and lipid-controlling composition. According to the invention, scientific compatibility is carried out by fully utilizing different biological structures of raw materials to play a synergistic effect, and meanwhile, the hypoglycemic and lipid-controlling composition targeting the ChREBP gene of the micropterus salmoides is provided by virtue of a micro encapsulation technology, and the composition comprises the following components in parts by weight: 1-25 parts of allium flavones; 1 to 20 parts of cineole; and 5 to 48 parts of benfotiamine. The composition can enhance the glycolipid metabolism capability of the largemouth bass body so as to achieve the effects of reducing blood glucose, controlling lipid and improving the growth performance of the largemouth bass body, and can be applied to the field of largemouth bass culture.

Description

Technical Field

[0001] The invention belongs to the field of aquaculture, and particularly relates to a blood sugar and lipid control composition targeting a largemouth bass ChREBP gene, and a preparation method and application thereof. Background Art

[0002] Carbohydrate raw materials are cheaper than lipid and protein raw materials, but fish have a low utilization rate of carbohydrates. High-sugar feed intake will cause long-term postprandial hyperglycemia and excessive accumulation of liver lipids in largemouth bass, which will lead to reduced growth rate of fish and even mass mortality, seriously affecting the economic income of farmers. Carbohydrate response element binding protein (ChREBP) is an important transcription factor that directly regulates liver glycolysis and fat synthesis. At present, the full cDNA sequence of this gene in largemouth bass has not been identified, and its role in the regulation of sugar metabolism has not been revealed. In addition, although some Western medicines have been developed for this gene in mammals to improve the body's sugar and lipid metabolism function, there are no applicable products developed around this gene in fish. At the same time, the use of Western medicines can easily lead to problems such as drug residues in farmed animals, which restricts their application.

[0003] Both Allium ursinum flavonoids and eucalyptol are extracts of medicinal plants, and they have different biological structures; benfotiamine is a derivative of vitamin B1 with higher biological efficacy. Studies on mice have shown that all three have the function of regulating the body's metabolism. However, there is a lack of research results on the metabolic functions of the three in aquatic animals, and there has been no report on a combination product that uses the different characteristics of the biological structures of the above three substances to scientifically match and exert synergistic effects to achieve the effects of lowering blood lipids and controlling blood sugar.

[0004] In addition, microencapsulation technology refers to the process of encapsulating biologically active substances (capsule core) into tiny capsules using natural or synthetic polymer materials (capsule materials). This technology can improve the stability of biologically active substances and enhance their bioavailability. However, this technology is rarely used in the processing of fishery feed additives. Summary of the invention

[0005] In order to solve the deficiencies and shortcomings of the above-mentioned prior art, the primary purpose of the present invention is to provide a blood sugar and lipid control composition targeting the ChREBP gene of largemouth bass. The composition targets the ChREBP gene of largemouth bass and can enhance the glucose and lipid metabolism capacity of largemouth bass, so as to achieve the effect of lowering blood sugar and lipid control and improving the growth performance of fish.

[0006] Another object of the present invention is to provide a method for preparing the above-mentioned blood sugar-lowering and lipid-controlling composition. The preparation method uses the ChREBP gene as the target, based on the pharmacological synergistic relationship between allium flavonoids, eucalyptol and benfotiamine, and combines microencapsulation technology to prepare the above-mentioned composition.

[0007] Another object of the present invention is to provide an application of the above-mentioned blood sugar-lowering and lipid-controlling composition.

[0008] The purpose of the present invention is achieved through the following technical solutions:

[0009] A blood sugar and lipid-lowering composition targeting the ChREBP gene of largemouth bass, comprising the following components by weight:

[0010] 1-25 parts of Allium flavonoids; 1-20 parts of eucalyptol; 5-48 parts of benfotiamine;

[0011] Preferably, the blood sugar lowering and lipid controlling composition comprises the following components in parts by weight:

[0012] 5-25 parts of Allium flavonoids; 5-20 parts of eucalyptol; 5-40 parts of benfotiamine;

[0013] More preferably, the blood sugar lowering and lipid control composition comprises the following components in parts by weight:

[0014] 12-25 parts of Allium ursinum flavonoids; 16-20 parts of eucalyptol; 5-22 parts of benfotiamine;

[0015] The preparation method of the blood sugar lowering and lipid controlling composition comprises the following steps:

[0016] The flavonoids of Allium ursinum, eucalyptol and benfotiamine are crushed, sieved and mixed evenly to obtain a hypoglycemic and lipid-regulating composition targeting the ChREBP gene of largemouth bass;

[0017] Preferably, the mesh size of the sieve is preferably 80 to 150 meshes;

[0018] Preferably, the temperature of the Allium flavonoids, eucalyptol and benfotiamine when crushed is less than 40°C;

[0019] Preferably, the preparation method of the blood sugar lowering and lipid controlling composition comprises the following steps:

[0020] Add sodium alginate and a dispersant to a methanol aqueous solution, and homogenize for 10 to 60 minutes under stirring conditions of 5000 to 15000 r / min; then add a methanol solution containing 10 to 15 wt.% of the above-mentioned blood sugar-lowering and lipid-controlling composition under stirring conditions of 1000 to 3500 r / min, and stir for 5 to 24 hours at 30 to 55° C. and 1000 to 3500 r / min; finally cool naturally and stand for 24 to 48 hours, filter, wash, and dry to obtain a blood sugar-lowering and lipid-controlling composition for fishery;

[0021] Preferably, the dispersant is a mixture of calcium lignin sulfonate and polyvinyl pyrrolidone K17 in a weight ratio of 2:1;

[0022] Preferably, the methanol-water solution is a mixed solution of methanol and water in a volume ratio of 1:3;

[0023] Preferably, the mass ratio of the sodium alginate to the dispersant is (100-550):(400-850);

[0024] Preferably, the volume ratio of the total mass of the sodium alginate and the dispersant to the methanol aqueous solution is (500-1400) g: (1-4.5) L;

[0025] Preferably, the volume ratio of the methanol aqueous solution to the methanol solution containing 10-15 wt.% of the glucose-lowering and lipid-controlling composition is (20-9):(1-2);

[0026] Application of the blood sugar lowering and lipid controlling composition in aquaculture;

[0027] The aquatic product is largemouth bass;

[0028] A largemouth bass feed, comprising the above-mentioned blood sugar-lowering and lipid-controlling composition;

[0029] The blood sugar and lipid control composition is added in the feed of largemouth bass in an amount of 0.5-1.5wt%;

[0030] Compared with the prior art, the present invention has the following advantages and effects:

[0031] (1) The present invention selects ChREBP gene as the target, uses Allium cyperus flavonoids, eucalyptol, and benfotiamine as raw materials, fully utilizes the different characteristics of their biological structures for scientific compatibility, and exerts synergistic effects to develop a composition for lowering blood sugar and controlling lipids in largemouth seabass. The composition has significant lipid-lowering and blood sugar-controlling effects, and can greatly improve the feed utilization rate and breeding economic benefits of largemouth seabass.

[0032] (2) The raw materials of the composition provided by the present invention are all components of medicinal plants, which can avoid food safety problems such as drug residues in aquatic products.

[0033] (3) The present invention also applies microencapsulation technology to the processing of the composition, which significantly improves the bioavailability of the composition to aquatic animals.

[0034] (4) As an efficient and environmentally friendly fish feed additive, the composition can greatly reduce feed costs and improve the economic benefits of aquaculture. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is an analysis chart of the effects of high-sugar diet on ChREBP gene expression in the liver of largemouth bass, where each data point represents 4 replicates, and lowercase letters with different superscripts indicate significant differences among different experimental groups.

[0036] Figure 2 This is the result analysis diagram of the effect of glucose load on ChREBP gene expression in the liver, where each data represents 4 replicates, different lowercase letters indicate significant differences in ChREBP gene expression levels in the same group (each glucose dose) but at different sampling time points, * indicates significant differences in different treatment groups at the same sampling point, ns P>0.05, *P<0.05, **P<0.01, ***P<0.001 in the two-factor analysis.

[0037] Figure 3 This is an analysis chart of the effects of ChREBP gene interference on ChREBP gene expression in hepatocytes, blood glucose level and lipid content, where A: ChREBP gene expression in hepatocytes, B: blood glucose level, C: lipid droplets in hepatocytes of the control group, D: lipid droplets in hepatocytes of the ChREBP gene expression interference group, each data represents 4 replicates, and lowercase letters with different superscripts indicate significant differences between different experimental groups. DETAILED DESCRIPTION

[0038] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0039] Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the present technical field.

[0040] The Allium ursinum flavonoids, eucalyptol, and benfotiamine used in the examples of the present invention were purchased from Guangzhou Biotechnology Co., Ltd.

[0041] The parts in the examples are parts by mass.

[0042] Example 1

[0043] (1) According to a step-by-step mixing method, 1 part of Allium flavonoids, 1 part of eucalyptol, and 48 parts of benfotiamine, which were respectively crushed at 40° C. and passed through an 80-mesh sieve, were fully mixed to ensure that the mixture was uniform and stable, to prepare 50 parts of a blood sugar-lowering and lipid-controlling composition;

[0044] (2) Add 100g of sodium alginate and 400g of dispersant (a mixture of calcium lignin sulfonate and polyvinyl pyrrolidone K17 in a weight ratio of 2:1) to 1L of methanol aqueous solution (a mixed solution of methanol and distilled water in a volume ratio of 1:3), and homogenize for 10 minutes under stirring conditions of 5000r / min; then, add 100mL of methanol solution containing 10wt% of the blood sugar and lipid-controlling composition obtained in step (1) under stirring conditions of 1000r / min, and stir at 30°C and 1000r / min for 5 hours; finally, naturally cool to room temperature and stand for 24 hours, filter with a Buchner funnel, wash and dry, and obtain the blood sugar and lipid-controlling composition 1 for fishery.

[0045] Example 2

[0046] (1) According to the step-by-step mixing method, 5 parts of Allium flavonoids, 5 parts of eucalyptol, and 40 parts of benfotiamine, which were respectively crushed at 40° C. and passed through an 80-mesh sieve, were fully mixed. During this process, the mixture must be uniform and stable to obtain 50 parts of a hypoglycemic and lipid-controlling composition.

[0047] (2) Add 150g of sodium alginate and 470g of dispersant (a mixture of calcium lignin sulfonate and polyvinyl pyrrolidone K17 in a weight ratio of 2:1) to 1.5L of methanol aqueous solution (a mixed solution of methanol and distilled water in a volume ratio of 1:3), and homogenize for 15 minutes under stirring conditions of 8000r / min; then, add 120mL of methanol solution containing 12wt% of the blood sugar and lipid-controlling composition obtained in step (1) under stirring conditions of 1200r / min, and stir at 35°C and 1200r / min for 5 hours; finally, cool naturally to room temperature and stand for 24 hours, filter with a Buchner funnel, wash and dry, and obtain the blood sugar and lipid-controlling composition 2 for fishery.

[0048] Example 3

[0049] (1) According to the step-by-step mixing method, 8 parts of Allium flavonoids, 15 parts of eucalyptol, and 27 parts of benfotiamine, which were crushed at 38° C. and passed through a 100-mesh sieve, were fully mixed. During this process, the mixture must be uniform and stable to obtain 50 parts of a hypoglycemic and lipid-controlling composition.

[0050] (2) Add 250g of sodium alginate and 480g of dispersant (a mixture of calcium lignin sulfonate and polyvinyl pyrrolidone K17 in a weight ratio of 2:1) to 2L of methanol aqueous solution (a mixed solution of methanol and distilled water in a volume ratio of 1:3), and homogenize at 8000r / min for 20min; then, add 120mL of a methanol solution containing 12wt% of the blood sugar and lipid-controlling composition obtained in step (1) at 1500r / min, and stir at 40°C and 1500r / min for 5h; finally, cool naturally to room temperature and stand for 24h, filter with a Buchner funnel, wash and dry to obtain the blood sugar and lipid-controlling composition 3 for fishery.

[0051] Example 4

[0052] (1) According to the step-by-step mixing method, 10 parts of Allium flavonoids, 10 parts of eucalyptol, and 30 parts of benfotiamine, which were crushed at 38° C. and passed through a 100-mesh sieve, were fully mixed. During this process, the mixture must be uniform and stable to obtain 50 parts of a hypoglycemic and lipid-controlling composition.

[0053] (2) Add 300 g of sodium alginate and 500 g of dispersant (a mixture of calcium lignin sulfonate and polyvinyl pyrrolidone K17 in a weight ratio of 2:1) to 2 L of methanol aqueous solution (a mixed solution of methanol and distilled water in a volume ratio of 1:3), and homogenize for 20 min under stirring conditions of 10,000 r / min; then, add 150 mL of a methanol solution containing 12 wt% of the blood sugar and lipid-controlling composition obtained in step (1) under stirring conditions of 1,500 r / min, and stir at 40°C and 1,500 r / min for 8 h; finally, naturally cool to room temperature and stand for 24 h, filter with a Buchner funnel, wash and dry, and obtain a blood sugar and lipid-controlling composition 4 for fishing.

[0054] Example 5

[0055] (1) According to the step-by-step mixing method, 12 parts of Allium flavonoids, 15 parts of eucalyptol, and 23 parts of benfotiamine, which were crushed at 35° C. and passed through a 100-mesh sieve, were fully mixed. During this process, the mixture must be uniform and stable to prepare 50 parts of a blood sugar-lowering and lipid-controlling composition.

[0056] (2) Add 350g of sodium alginate and 500g of dispersant (a mixture of calcium lignin sulfonate and polyvinyl pyrrolidone K17 in a weight ratio of 2:1) to 2.5L of methanol aqueous solution (a mixed solution of methanol and distilled water in a volume ratio of 1:3), and homogenize for 25min under stirring conditions of 10000r / min; then, add 200mL of a methanol solution containing 12wt% of the blood sugar and lipid-controlling composition obtained in step (1) under stirring conditions of 2000r / min, and stir at 40°C and 2000r / min for 10h; finally, naturally cool to room temperature and stand for 24h, filter with a Buchner funnel, wash and dry to obtain a blood sugar and lipid-controlling composition 5 for fishing.

[0057] Example 6

[0058] (1) According to the step-by-step mixing method, 12 parts of Allium flavonoids, 16 parts of eucalyptol, and 22 parts of benfotiamine, which were crushed at 35° C. and passed through a 120-mesh sieve, were fully mixed. During this process, the mixture must be uniform and stable to obtain 50 parts of a hypoglycemic and lipid-controlling composition.

[0059] (2) Add 450g of sodium alginate and 550g of dispersant (a mixture of calcium lignin sulfonate and polyvinyl pyrrolidone K17 in a weight ratio of 2:1) to 2.5L of methanol aqueous solution (a mixed solution of methanol and distilled water in a volume ratio of 1:3), and homogenize for 25min under stirring conditions of 12000r / min; then add 250mL of methanol solution containing 15wt% of the blood sugar and lipid-controlling composition obtained in step (1) under stirring conditions of 2000r / min, and stir at 45°C and 2000r / min for 10h; finally, naturally cool to room temperature and stand for 24h, filter with a Buchner funnel, wash and dry to obtain the blood sugar and lipid-controlling composition 6 for fishery.

[0060] Example 7

[0061] (1) According to the step-by-step mixing method, 15 parts of Allium flavonoids, 18 parts of eucalyptol, and 17 parts of benfotiamine, which were crushed at 35° C. and passed through a 120-mesh sieve, were fully mixed. During this process, the mixture must be uniform and stable to prepare 50 parts of a hypoglycemic and lipid-controlling composition.

[0062] (2) Add 400 g of sodium alginate and 550 g of dispersant (a mixture of calcium lignin sulfonate and polyvinyl pyrrolidone K17 in a weight ratio of 2:1) to 3 L of methanol aqueous solution (a mixed solution of methanol and distilled water in a volume ratio of 1:3), and homogenize for 30 min at 12000 r / min; then add 300 mL of methanol solution containing 15 wt% of the blood sugar and lipid-controlling composition obtained in step (1) at 2500 r / min, and stir at 50°C and 2500 r / min for 12 h; finally, cool naturally to room temperature and stand for 28 h, filter with a Buchner funnel, wash and dry to obtain the blood sugar and lipid-controlling composition 7 for fishery.

[0063] Example 8

[0064] (1) According to the step-by-step mixing method, 15 parts of Allium flavonoids, 20 parts of eucalyptol, and 15 parts of benfotiamine, which were respectively crushed at 35° C. and passed through a 150-mesh sieve, were fully mixed. During this process, the mixture must be uniform and stable to obtain 50 parts of a hypoglycemic and lipid-controlling composition.

[0065] (2) Add 480g of sodium alginate and 650g of dispersant (a mixture of calcium lignin sulfonate and polyvinyl pyrrolidone K17 in a weight ratio of 2:1) to 3.5L of methanol aqueous solution (a mixed solution of methanol and distilled water in a volume ratio of 1:3), and homogenize for 35min under stirring conditions of 15000r / min; then add 350mL of methanol solution containing 15wt% of the blood sugar and lipid-controlling composition obtained in step (1) under stirring conditions of 2500r / min, and stir at 50°C and 2500r / min for 15h; finally, naturally cool to room temperature and stand for 30h, filter with a Buchner funnel, wash and dry to obtain the blood sugar and lipid-controlling composition 8 for fishery.

[0066] Example 9

[0067] (1) According to the step-by-step mixing method, 20 parts of Allium flavonoids, 15 parts of eucalyptol, and 15 parts of benfotiamine, which were respectively crushed at 30° C. and passed through a 150-mesh sieve, were fully mixed. During this process, the mixture must be uniform and stable to obtain 50 parts of a hypoglycemic and lipid-controlling composition.

[0068] (2) Add 500g of sodium alginate and 750g of dispersant (a mixture of calcium lignin sulfonate and polyvinyl pyrrolidone K17 in a weight ratio of 2:1) to 4L of methanol aqueous solution (a mixed solution of methanol and distilled water in a volume ratio of 1:3), and homogenize for 40min under stirring conditions of 15000r / min; then, add 400mL of methanol solution containing 15wt% of the blood sugar and lipid-controlling composition obtained in step (1) under stirring conditions of 3000r / min, and stir at 50°C and 3000r / min for 20h; finally, naturally cool to room temperature and stand for 36h, filter with a Buchner funnel, wash and dry to obtain the blood sugar and lipid-controlling composition 9 for fishing.

[0069] Example 10

[0070] (1) According to the step-by-step mixing method, 25 parts of Allium flavonoids, 20 parts of eucalyptol, and 5 parts of benfotiamine, which were respectively crushed at 30° C. and passed through a 150-mesh sieve, were fully mixed. During this process, the mixture must be uniform and stable to obtain 50 parts of a hypoglycemic and lipid-controlling composition.

[0071] (2) Add 550 g of sodium alginate and 850 g of dispersant (a mixture of calcium lignin sulfonate and polyvinyl pyrrolidone K17 in a weight ratio of 2:1) to 4.5 L of methanol aqueous solution (a mixed solution of methanol and distilled water in a volume ratio of 1:3), and homogenize for 60 min at 15,000 r / min; then add 500 mL of a methanol solution of the blood sugar and lipid-controlling composition obtained in step (1) with a content of 15 wt% at 3,500 r / min, and stir at 55°C and 3,500 r / min for 24 h; finally, naturally cool to room temperature and stand for 48 h, filter with a Buchner funnel, wash and dry to obtain a blood sugar and lipid-controlling composition 10 for fishing.

[0072] Example 11 Full-length cDNA cloning and functional identification of ChREBP gene in largemouth bass

[0073] 1. Full-length cloning of ChREBP cDNA from largemouth bass

[0074] (1) The Trizol method (TaKaRa, Takara Biotech, Dalian) was used to extract RNA from the liver of largemouth black bass. According to the instructions of the RNAiso Plus commercial kit, the structural integrity, concentration and purity of the extracted tissue RNA were tested. Subsequently, the first strand of cDNA was synthesized using total RNA as a template and Oligo(dT)16 as a reverse transcription primer, referring to the instructions of the 5′RACE System for Rapid Amplification of cDNA Ends, Version 2.0 kit (Invitrogen).

[0075] (2) The conserved region sequences of fish ChREBP genes published on the NCBI website were screened, and degenerate primers (Table 1) were designed and synthesized using PrimerPremier5 to amplify the conserved fragments. TM The RACEcDNA Amplification kit (Clontech) was used to perform two rounds of degenerate primer PCR using primer ChREBP-F1, largemouth bass cDNA as template, and the determined amplification conditions (pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 2 min, 34 cycles; and final extension at 72°C for 10 min). The first round of amplification reaction system was ddH 2 O 31.5μL, 10×PCR buffer 5.0μL, 25mmol / L MgCl 2 3.0μL, 10mmol / L dNTP mix 1.0μL, ChREBP-F1 2.0μL, Abridged Anchor Primer (10μmol / L) 2.0μL, dC-tailed cDNA 5.0μL and Taq DNA polymerase (5units / μL) 0.5μL; the second round amplification reaction system is the first round amplification product 5.0μL, ddH 2 O 33.5μL, 10×PCR buffer 5.0μL, 25mmol / L MgCl 23.0μL, 10mmol / LdNTP mix 1.0μL, ChREBP-R1 1.0μL, AUAP or UAP (10μM) 1.0μL and Taq DNA polymerase (5units / μL) 0.5μL.

[0076] Table 1 Primer sequences required for the experiment

[0077]

[0078] Note: ChREBP, carbohydrate response element binding protein; EF1α. elongation factor 1α.

[0079] (3) The PCR product obtained in step (2) was purified, transformed, and the positive clones were identified and sequenced, and the core fragment was verified on the NCBI website. Finally, the forward and reverse sequences of the ChREBP gene were assembled using DNAStar Package 5.01 software, and the complete cDNA sequence of the largemouth bass ChREBP gene was obtained. The cDNA of this gene contains 3435 bases.

[0080] 1 ttgttgtccagagcagtgctggtgaggagagactgttgtctctcagctgacagatgaggag

[0081] 61 cctcactgcactcagcgagcggcacttgtttgaggacacattggaatatccggggggagg

[0082] 121 aggagggggagtcagttgaggcgaaagttcactgtttggcggacagtcaataacttaatg

[0083] 181 aaaacgcaccATGGCGTGTGAAGGGAGAGTTTGTTCAGCCGGACAGAGCCAGCTCCATGT

[0084] 241 CTCCTCAGACTCTGACTCGGAGGCGGAGGGGGGAACTGCTCGGGTGGCCGGAATCGGACC

[0085] 301 GTCCGCCGTCTCCTTCCCCTGCACCCAGGTCATCCACAGCGGTCACTTCATGGTGTCGTC

[0086] 361 GCCCCACAGCGACTCTGCGCCGCGCAGGAGGAAAAGCGGCGAGTCTCTGAGATATGACTT

[0087] 421 TGACACGGTGAACAGGACTTGGTGCCAGACCTACCGGTACGGCCCTCTCAGCTCCGGGAG

[0088] 481 CCTGAGCATCGACCCCACTCTGAACCGCCTGTTTGACTGCATGTCCCTGGCCTACAGTGG

[0089] 541 TAAGATAGTCTCTCCCAAGTGGAAGTCTTTTAAGGGTCTGCGGTTGCTGTGGAGAGATAA

[0090] 601 GATCCGTCTGAACAATGCGATCTGGAGAGCTTGGTTCATTCAGTATGTGGAGAAGAGGAA

[0091] 661 GAACCCAGTGTGTGGGTTTGTCACACCGCTGGAGGGCTCTGAAGCCGATGCTCATCGAAA

[0092] 721 TCCTGAGGCAATTGTATTAGAGGGCAGCTACTGGAAGCGAAGGATTGAGGTGGTGATTAA

[0093] 781 GGAATATCACAAGTGGAGGATTTACTATAAGAAGAGGCTTCAGAGCAAGAAACATGACAT

[0094] 841 TCTATCAATGCTGCAAGAGGGTCAGATCTGCCAGGCCAAGCTGGAGAAATGGTCCAATCA

[0095] 901 GATGTACCAGGAGCCCGAGGCTGCTCCCGTGGAAGCCCACATGTTTGACCTGGACTGCCT

[0096] 961 TCTGTCCGACATCTCCGACACACTGTTCACCATGACACAAAAGCCGTGTCCATGGGCCAG

[0097] 1021 TGACCGACACGACACTTACACAAGCAATGCTGACATAATCCAGCCAGACCTGACTCCACT

[0098] 1081 GCAGCCCAACCTGGATGATTTCATGGACATACCAGATATCTTTATGAGCTACCGGGGCCA

[0099] 1141 GCCCACTGAGCAGACTGCTTTTGCTGACTGTGGCTATTATGACAGCTCAACCAGCACAGC

[0100] 1201 GTTTGCTCCACTTCCCTCTCCTGTGGTAACAACTCCTCAGCTACTTATCAACACCCAGCT

[0101] 1261 GGCTCAGCCCAATCTGTCATCTGATAATTTGCCTCAGCCCTCCTCATCAAATATCCGGCC

[0102] 1321 AGACCACTCCAGGCCAGACCAGGATTGCGGTGAATACCACACATCTAGCATCCTCTCAGG

[0103] 1381 CACCATGCAATATGGACAGTCATACCCTGATCCACCTGTTTCTATAGCATATACCACCGG

[0104] 1441 CATCGAGCAGCCGGCCTCTTCAGATGTTCCTTTTTTGTACCCACTGCCATGTCACAAGTT

[0105] 1501 TGGCTACTACACAACAACCAGTGTGACCCCAACTGTCATTACTCACACCGCCTCCACCGT

[0106] 1561 GGGGGCCCATGGCTCTGTGCGCCAGGCTCATGGCTACCCTCACACAGGGGACTCATACCC

[0107] 1621 CCAGACTCCCTGCCACTCTCTCAGCTACCCGGCTGGCGTGTCTGACCCGGTCCACGCTAC

[0108] 1681 GCTGCCCTCTGTCACTGCGTCCCACTGCTTCTCAGTCCCGGAGCAGGTGGCTGCTGCTGG

[0109] 1741 GGTCAGAGGGAAGCACAAGCAAAAGACAGGAGGAGTTTGGACAGTAGGTCCCCCCGTGGC

[0110] 1801 TCCGTCTGGCCCCCCATCCACTACACCTACACCCACCAGTTGCCTGGCTAAGCTACTCTC

[0111] 1861 CTCCAGCACCCGTGAGCGTGACCATCCGTTAGGATTTGATAGTACTCTAGTGACAGCCAA

[0112] 1921 AGGTCAGAGATCATCATCTCCCAGCTCTTCGTCACGCAGCAGCACGCATATCGGAGGAGC

[0113] 1981 TTCCTCGCAGCTGCAGCATGGAGCTGGTTGGCCTGCAGGGATCCCAGCGCTGACTCCTCT

[0114] 2041 GCACAGCCAGAGCGCCACCCTGGGTCACAGTGGACCCCACGCCAGCACCTCCAGAGGCTC

[0115] 2101 GGCGGTATCTGCCCTGCTCACCCACGGCTCCACGCACAGCGGAACAACCCTCCTCATTCC

[0116] 2161 CAAGACTGAGAAACTATCTCCTGTCCAGCTCTACGGCACGGACAGGAGCAGCTTAGCAGT

[0117] 2221 TAATTTTCCAGGACATCCAGGCAAAACGTCACCACCAAACTTTTTAGATAAAGCCTCCAA

[0118] 2281 CCCCGAGTCCTCACACTCAGGTTTCTCAGGACACGGAAAGATAGAATCAAGTAAGCAAAC

[0119] 2341 AGAAACCAGGAGGATAACTCACATCTCGGCTGAGCAGAAGAGGCGTTTCAACATCAAACT

[0120] 2401 GGGATTTGACACTTTACATAATCTTGTGACAACGCTCAGCTCTCAGCCAAGCATAAAGAT

[0121] 2461 CAGCAAAGCCACCACACTGCAGAAGACCGCTGAGTACATCAGTAAGATGCAGCAGGAGAG

[0122] 2521 AGGTCAGCTGCACGAGGAGGCTCAGAGACTCAGGGAGGAGATCCAGCTCCTGAACTCTGC

[0123] 2581 CATCAATGCGTGCCAGCAGCAGCTTCCAGCCACTGGTGTGCCCATTACACGGCAGCGCTT

[0124] 2641 TGACCACATGAGGCAGAAGTTCAGAGAGTATGTCCAGGCCCAGACACTGCAAAACTGGAA

[0125] 2701 GTTTTGGATCTTCAGCATCATCATCGAGCCGCTGTTTGAGTCCTATAATGGAATGGTGTC

[0126] 2761 CACTGCCAGTGTGGAGGACCTGTGTCGATCCACTCTGTCCTGGCTGGACCAACACTGTTC

[0127] 2821 CCTGCCTGCCCTAAGACCCATGGTTCTGAGTTCACTCCGTCTCCTGAGTACCACCACAGC

[0128] 2881 CATCCTGACAGACCCCAGCCTGCTGCCGGAGCAGGCCACCCTCGCTGTCACCCAGGGCGA

[0129] 2941 CCCCGCTGCTGTCCTGGACCACTCCTTACAGCCCACCACTCGCGACGATATACACCCCAT

[0130] 3001 GTGActgcgaggaacagactcaatagaaacttaactggaatccaccacaatgtacaagtc

[0131] 3061 agaggagagccagtgcaatgatttttaaagactcaacactcagctccaggaatttttgta

[0132] 3121 ataacgcacaatgacattccaataaaacccacaagctgcaaaaagataatagtccattac

[0133] 3181 aaccagagccatatgtcatctatgctgaaattctgatcacggtgtgacacttgtaattat

[0134] 3241 ttcagagccccagaatcattttcttttgtgaagcagaagttcagatgagtggaaggagat

[0135] 3301 gtcagtcactgtgatcttgaatgaattgcttcattttctgtttaaataatttggtaacat

[0136] 3361 cagttgacaacttcatttattctccattcacatctcaggttttcttttctgtgcataata

[0137] 3421 tattaccttcaatta

[0138] 2. High - sugar nutrition experiment

[0139] (1) High-sugar nutrition experiment: 160 healthy juvenile fish [average weight (50.11±0.64) g] were randomly selected for a 12-week breeding experiment. The experiment was divided into two groups, with 4 replicates in each group. During the period, the fish were fed with a basic feed (with a mass fraction of 10% sugar level) and a high-sugar feed (with a mass fraction of 20% sugar level), twice a day (08:00 and 17:00). The feed formula ingredients of the basic group were 40wt% fish meal, 26wt% soybean meal, 5wt% fish oil, 5wt% soybean oil, 10wt% corn starch, 10wt% wheat bran, 2wt% dicalcium phosphate, and 2wt% premix; the feed formula ingredients of the high-sugar group were 40wt% fish meal, 26wt% soybean meal, 5wt% fish oil, 5wt% soybean oil, 20wt% corn starch, 2wt% dicalcium phosphate, and 2wt% premix (i.e., the basic group feed formula in Table 2). After the breeding, all fish were starved for 24h. Six fish were randomly selected from each treatment and anesthetized with 100 mg / L MS-222. The liver tissues were quickly frozen with liquid nitrogen and stored at -80°C.

[0140] (2)qRT-PCR: Reference RNA was extracted from liver tissue according to the instructions of Prime Plus RNA Purification Kit. The instructions for the RTreageat Kit reverse transcription kit require reverse transcription into cDNA as a template, and use EF1α as an internal reference gene to perform fluorescent quantitative PCR reaction on the ChREBP gene. Among them, 10μL reaction system contains 1μL of cDNA diluent, PremixEx TaqTMII 5 μL, upstream and downstream primers (Table 1) 0.3 μL each and ddHO 2 O 3.4 μL. EF1α was selected to normalize the Ct value of the target gene, and the 2-△△Ct method was used to calculate the relative expression of the gene.

[0141] The results showed that after 12 weeks of breeding, the expression of ChREBP in the liver of fish in the high-sugar group (HC) was significantly increased ( Figure 1 ).

[0142] 3. Glucose Load Test

[0143] (1) Glucose loading experiment: Healthy young fish (average weight (59.87±1.02) g) were randomly divided into 2 groups and injected with 1.67 mL / kg body weight of saline and 1.67 g / kg body weight of glucose solution, respectively. The injected fish in each group were randomly placed into 6 circulating culture tanks (water volume of 200 L), with 4 fish in each tank. Subsequently, liver tissues were collected at 0, 1, 2, 4, 8 and 12 h, respectively, and quickly frozen with liquid nitrogen and placed at -80°C.

[0144] (2) qRT-PCR: The specific method is the same as step 2.

[0145] The results showed that after glucose loading, sampling time, injection dose and their interaction significantly affected the expression of ChREBP in the liver ( Figure 2 ). After the glucose loading experiment, the expression of ChREBP increased significantly, with the maximum value appearing at 1h. Subsequently, their expression levels were significantly downregulated and returned to the baseline value at 12h. The expression of ChREBP in the saline group increased over time but was not significant. In terms of injection dose, the expression of ChREBP in the liver of the fish in the glucose loading group was significantly higher than that in the control group.

[0146] (4) In vitro interference with ChREBP expression

[0147] (1) Fish primary hepatocytes (isolated from the liver of largemouth bass according to conventional methods) were cultured in DMEM / F12 medium supplemented with 10% fetal bovine serum, 100 IU / mL streptomycin, and 100 μg / mL penicillin at 28°C with 5% CO 2 The cells were cultured for 48 h under the conditions of 5% saturated saline and 1% saturated saline. The cells were lysed with 0.25 wt.% sterile trypsin and subcultured once. The cells were then divided into two groups, named siRNA-ChREBP group and siRNA-NC group. The siRNA-ChREBP group was transfected with si-ChREBP (small interfering RNA, siRNA, Table 1) and the siRNA-NC group was transfected with negative control (GenePharma). Lipofectamine RRNAiMAX transfection reagent (Invitrogen) was used for the delivery of siRNA duplexes. The cells were co-incubated with siRNA for 48 h.

[0148] (2) After the incubation, the cells were collected and qRT-PCR was performed according to the method in step 2. The glucose and lipid content levels were analyzed at the same time (the analysis method was based on the glucose determination kit and lipid content determination kit produced by Nanjing Jiancheng).

[0149] The results showed that the ChREBP expression, blood glucose level and lipid content in the siRNA-ChREBP group were significantly decreased ( Figure 3 ).

[0150] Application Example 1

[0151] (1) Largemouth bass juvenile (about 10 g) breeding experiment: 720 juveniles of uniform size (initial weight: 11.04 ± 0.05 g) were randomly placed in 24 cages (specifications: 2.0 m × 1.0 m × 1.0 m), 30 fish in each cage, and the cages were divided into 6 groups, 4 replicates in each group, and the juveniles were cultured for 12 weeks according to the feed formula shown in Table 1. During this period, the feeding and growth of the juveniles were observed. Among them, the ingredients of the basic feed were 40wt% fish meal, 26wt% soybean meal, 5wt% fish oil, 5wt% soybean oil, 20wt% corn starch, 2wt% monocalcium phosphate, and 2wt% premix. The feed composition of each group is as follows:

[0152] ①Basic group: only fed with basic feed;

[0153] ②Basic + Allium flavonoids group: fed with basic feed supplemented with 1wt% Allium flavonoids;

[0154] ③Basic + eucalyptol group: fed with basic feed supplemented with 1wt% eucalyptol;

[0155] ④Basic + benfotiamine group: fed with basic feed supplemented with 1wt% benfotiamine;

[0156] ⑤ Basic + composition 1 group: fed with basic feed supplemented with 1 wt% of the blood sugar and lipid-lowering composition of Example 1;

[0157] ⑥Basic+composition 2 group: fed with basic feed supplemented with 1 wt% of the blood sugar and lipid-lowering composition of Example 2.

[0158] (2) After the breeding, the weight gain rate (%), specific growth rate, ChREBP expression, blood glucose content (mmol / L), and liver lipid content were analyzed; the ChREBP expression analysis method was referred to Example 11, and the blood glucose content and liver lipid content analysis methods were referred to the kits produced by Nanjing Jiancheng. The weight gain rate and specific growth rate were calculated as follows:

[0159] Weight gain rate = (final weight - initial weight) / initial weight × 100%; specific growth rate = (lnWt-lnW0) / t × 100%

[0160] Note: W0 and Wt are initial body weight and body weight on day t of the experiment (g), respectively. t is the experiment time (d).

[0161] Table 3 shows the effects of different treatment groups' feed on the growth, physiological and biochemical indicators of largemouth bass. As shown in Table 3, the basic + combination group 2 significantly increased the weight gain rate and specific growth rate of largemouth bass, but the ChREBP gene expression, plasma glucose level, and liver lipid content were significantly reduced. This shows that the basic + combination group 2 is better in promoting fish growth, lowering lipids and controlling blood sugar.

[0162] Table 2 Feed formula for different treatment groups

[0163]

[0164] Premix: Each kg of premix contains the following minerals (g / kg) and vitamins (IU or mg / kg):

[0165] CuSO 4 ·5H 2 O 2.0g; FeSO 4 7H 2 O 25g; ZnSO 4 7H 2 O 22g; MnSO 4 ·4H 2 O 7g; Na 2 SeO 3 0.04g; KI 0.026g; CoCl 2 6H 2 O 0.1g; VA 900,000IU; VD 200,000IU; VE 4500mg; VK 3 220mg; VB 1 320mg; VB 2 1090mg; niacin 2800mg; VB 5 2000mg;VB 6 500mg;VB 12 1.6mg; VC 5000mg; pantothenic acid 1000mg; folic acid 165mg; choline 60000mg; inositol 15 000mg.

[0166] Table 3 Effects of different treatment groups of feed on growth and physiological and biochemical parameters of largemouth bass

[0167]

[0168] Note: The same lowercase letters in the same row indicate no significant difference

[0169] Application Example 2

[0170] (1) Largemouth bass juvenile (about 23g) breeding experiment: 600 juveniles of uniform size (initial weight: 25.45±0.17g) were randomly placed in 20 cages (specifications: 2.0m×1.0m×1.0m), with 30 fish in each cage. The cages were divided into 5 groups, with 4 replicates in each group. The juveniles were cultured for 12 weeks according to the feed formula shown in Table 1, and the feeding and growth of the juveniles were observed during the period. The basic feed composition was 40wt% fish meal, 26wt% soybean meal, 5wt% fish oil, 5wt% soybean oil, 20wt% corn starch, 2wt% monocalcium phosphate, and 2wt% premix. The feed composition of each group is as follows:

[0171] ① Basic + Composition 2 Group: fed with basic feed supplemented with 1 wt% of the blood sugar and lipid-lowering composition of Example 2;

[0172] ②Basic+composition 3 group: fed with basic feed supplemented with 1 wt% of the blood sugar and lipid-lowering composition of Example 3;

[0173] ③ Basic + composition 4 group: fed with basic feed supplemented with 1 wt% of the blood sugar and lipid-lowering composition of Example 4;

[0174] ④ Basic + composition 5 group: fed with basic feed supplemented with 1wt% of the blood sugar and lipid-lowering composition of Example 5;

[0175] ⑤ Basic + Composition 6 Group: The basic feed was supplemented with 1 wt% of the blood sugar and lipid control composition of Example 6.

[0176] (2) After the breeding is completed, refer to Application Example 1 for subsequent indicator analysis.

[0177] Table 4 shows the effects of different treatment groups' feed on the growth, physiological and biochemical indicators of largemouth bass. As shown in Table 4, the basic + combination group 6 significantly increased the weight gain rate and specific growth rate of largemouth bass, but the ChREBP gene expression, plasma glucose level, and liver lipid content were significantly reduced. This shows that the basic + combination group 6 is better in promoting fish growth, lowering lipids and controlling blood sugar.

[0178] Table 4 Effects of different treatment groups of feed on growth and physiological and biochemical parameters of largemouth bass

[0179]

[0180] Note: The same lowercase letters in the same row indicate no significant difference

[0181] Application Example 3

[0182] (1) Largemouth bass juvenile (about 58g) breeding experiment: 600 juveniles of uniform size (initial weight: 60.29±0.31g) were randomly placed in 20 cages (specifications: 2.0m×1.0m×1.0m), with 30 fish in each cage. The cages were divided into 5 groups, with 4 replicates in each group. The juveniles were cultured for 12 weeks according to the feed formula shown in Table 1, and the feeding and growth of the juveniles were observed during the period. The basic feed composition was 40wt% fish meal, 26wt% soybean meal, 5wt% fish oil, 5wt% soybean oil, 20wt% corn starch, 2wt% monocalcium phosphate, and 2wt% premix. The feed composition of each group is as follows:

[0183] ① Basic + Composition 6 Group: fed with basic feed supplemented with 1 wt% of the blood sugar and lipid-lowering composition of Example 6;

[0184] ②Basic+composition 7 group: fed with basic feed supplemented with 1 wt% of the blood sugar and lipid-lowering composition of Example 7;

[0185] ③ Basic + composition 8 group: fed with basic feed supplemented with 1 wt% of the blood sugar and lipid-lowering composition of Example 8;

[0186] ④ Basic + Composition 9 group: fed with basic feed supplemented with 1 wt% of the blood sugar and lipid-lowering composition of Example 9;

[0187] ⑤ Basic + Composition 10 Group: The basic feed was supplemented with 1 wt% of the blood sugar and lipid control composition of Example 10.

[0188] (2) After the breeding is completed, refer to Application Example 1 for subsequent indicator analysis.

[0189] Table 5 shows the effects of different treatment groups' feed on the growth, physiological and biochemical indicators of largemouth bass. As shown in Table 5, the basic + combination 10 group significantly increased the weight gain rate and specific growth rate of largemouth bass, but the ChREBP gene expression, plasma glucose level, and liver lipid content were significantly reduced. This shows that the basic + combination 10 group is better in promoting fish growth, lowering lipids and controlling blood sugar.

[0190] Table 5 Effects of different treatment groups' diets on growth and physiological and biochemical parameters of largemouth bass

[0191]

[0192] Note: The same lowercase letters in the same row indicate no significant difference

[0193] The present invention combines the growth and physicochemical index results of relevant breeding experiments to confirm that the blood sugar and lipid-controlling composition can reduce blood sugar and liver lipid content in fish by downregulating ChREBP expression, thereby improving the growth performance of fish.

[0194] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A blood sugar and lipid-lowering composition targeting the ChREBP gene of largemouth bass, characterized in that The composition comprises the following components by weight: 1-25 parts of Allium ursinum flavonoids; 1-20 parts of eucalyptol; and 5-48 parts of benfotiamine.

2. The blood sugar and lipid-lowering composition according to claim 1, characterized in that The composition comprises the following components by weight: 5-25 parts of Allium ursinum flavonoids; 5-20 parts of eucalyptol; 5-40 parts of benfotiamine.

3. The blood sugar and lipid-lowering composition according to claim 2, characterized in that The composition comprises the following components by weight: 12-25 parts of Allium ursinum flavonoids; 16-20 parts of eucalyptol; and 5-22 parts of benfotiamine.

4. The method for preparing the blood sugar lowering and lipid controlling composition according to any one of claims 1 to 3, characterized in that The following steps are included: The flavonoids of Allium ursinum, eucalyptol and benfotiamine were crushed separately, sieved and mixed evenly to obtain a hypoglycemic and lipid-controlling composition targeting the ChREBP gene of largemouth bass.

5. The method for preparing the blood sugar lowering and lipid controlling composition according to claim 4, characterized in that It also includes the following steps: Add sodium alginate and dispersant to methanol aqueous solution, homogenize for 10 to 60 minutes under stirring conditions of 5000 to 15000 r / min; then add methanol solution containing 10 to 15 wt.% of the blood sugar and lipid-controlling composition under stirring conditions of 1000 to 3500 r / min, and stir at 30 to 55°C and 1000 to 3500 r / min for 5 to 24 hours; finally, cool naturally and let stand for 24 to 48 hours, filter, wash and dry to obtain the blood sugar and lipid-controlling composition for fishery.

6. The method for preparing the blood sugar lowering and lipid controlling composition according to claim 5, characterized in that: The dispersant is a mixture of calcium lignin sulfonate and polyvinyl pyrrolidone K17 in a weight ratio of 2:

1.

7. The method for preparing the blood sugar lowering and lipid controlling composition according to claim 5, characterized in that: The mass ratio of the sodium alginate to the dispersant is (100-550):(400-850); The volume ratio of the total mass of the sodium alginate and the dispersant to the methanol aqueous solution is (500-1400) g: (1-4.5) L; The volume ratio of the methanol aqueous solution to the methanol solution containing 10-15wt.% of the blood sugar and lipid-lowering composition is (20-9):(1-2).

8. Use of the blood sugar lowering and lipid controlling composition according to any one of claims 1 to 3 in aquaculture.

9. A largemouth bass feed, characterized in that Comprising the blood sugar and lipid control composition according to any one of claims 1 to 3.

10. The largemouth bass feed according to claim 9, characterized in that: The added amount of the blood sugar lowering and lipid controlling composition in the largemouth bass feed is 0.5-1.5wt%.

Images