Modified corynebacterium microorganism and application thereof in lysine fermentation production

Abstract

The invention relates to the technical field of bioengineering, in particular to a modified corynebacterium microorganism and application thereof in lysine fermentation production. The acetyl coenzyme A synthetase and / or the inactivated NCg11988 gene or the homologous gene thereof are / is heterologously expressed in the corynebacterium, so that synthesis and accumulation of lysine are remarkably promoted, the lysine production capacity of the corynebacterium is effectively improved, and the lysine yield and / or conversion rate of the corynebacterium are / is remarkably improved. The transformation can be used for construction of lysine production strains, the lysine production capacity of the strains is effectively improved, and the method has important significance for improving the production efficiency of lysine and reducing the production cost.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a modified Corynebacterium microorganism and application thereof in lysine fermentation production. Background Art

[0002] L-lysine is an essential amino acid with a molecular formula of C6H 14 N2O2 is a white or nearly white crystalline powder. It turns dark at 210°C and decomposes at 224.5°C. It is easily soluble in water, slightly soluble in alcohol, and insoluble in ether. L-lysine is widely used in animal feed, medicine, and food industries. It is used as an animal feed additive. L-lysine can promote the body's absorption of other amino acids, thereby improving feed quality. The market demand for L-lysine is large, so it is of great significance to improve the production efficiency of L-lysine.

[0003] At present, the most commonly used method for producing L-lysine is microbial fermentation, which has the advantages of low raw material cost, mild reaction conditions, and easy large-scale production. Corynebacterium glutamicum is currently the main L-lysine production bacterium.

[0004] The synthesis of lysine in Corynebacterium glutamicum is obtained through multi-step enzyme-catalyzed reactions using aspartate as a precursor, while oxaloacetate is the synthetic precursor of aspartate. Acetyl-CoA and oxaloacetate combine to form citrate, which enters the TCA cycle to provide energy for the cell. Acetyl-CoA synthetase (acs) is a key enzyme in Escherichia coli that can catalyze the conversion of acetate into acetyl-CoA, which is an important intermediate at the junction of anabolic and catabolic pathways. Acetyl-CoA synthetase catalyzes a two-step reaction, including catalyzing the combination of acetate with ATP to form an acetylated adenosine (AcAMP) intermediate, and transferring the acetyl group from AcAMP to the thiol group of CoA to form acetyl-CoA. Summary of the invention

[0005] The invention provides a modified Corynebacterium microorganism and application thereof in lysine fermentation production.

[0006] In a first aspect, the present invention provides any of the following uses of acetyl-CoA synthetase or a gene encoding it or a biological material containing the gene encoding it:

[0007] (1) Application in constructing a microorganism for producing lysine or its derivatives;

[0008] (2) Application in the production of lysine or its derivatives by microbial fermentation;

[0009] (3) Application in increasing the yield of lysine or its derivatives produced by microorganisms.

[0010] In the present invention, the acetyl-CoA synthetase is derived from a microorganism containing acetyl-CoA synthetase, including but not limited to Escherichia coli, Bacillus subtilis and the like.

[0011] Preferably, the acetyl-CoA synthetase is an acetyl-CoA synthetase derived from Escherichia coli.

[0012] Preferably, the microorganism is a bacterium of the genus Corynebacterium, more preferably Corynebacterium glutamicum.

[0013] The present invention finds that expressing heterologous acetyl-CoA synthetase in Corynebacterium bacteria can promote the synthesis and accumulation of lysine by Corynebacterium, and significantly improve the yield and conversion rate of lysine produced by the bacteria.

[0014] Further preferably, the amino acid sequence of the acetyl-CoA synthetase is as shown in SEQ ID NO.1.

[0015] According to the amino acid sequence and codon rules of the above-mentioned acetyl-CoA synthetase, those skilled in the art can obtain the nucleotide sequence of the coding gene (acs) of the acetyl-CoA synthetase. Due to the degeneracy of codons, the nucleotide sequence of the coding gene of acetyl-CoA synthetase is not unique, and all nucleotide sequences that can encode the above-mentioned acetyl-CoA synthetase are within the protection scope of the present invention.

[0016] For different microorganisms, those skilled in the art can perform codon optimization for the acetyl-CoA synthetase to be expressed so that the enzyme can be better expressed in the host microorganism. Codon optimization can be achieved by conventional technical means in the art.

[0017] In some embodiments of the present invention, for Corynebacterium bacteria (especially Corynebacterium glutamicum), the acetyl-CoA synthetase is expressed by introducing the coding gene shown in SEQ ID NO. 2. The coding gene shown in SEQ ID NO. 2 is a sequence after codon optimization according to the codon preference of Corynebacterium glutamicum.

[0018] In the above applications, the biological material includes an expression cassette, a vector or a host cell.

[0019] Wherein, the expression cassette is a recombinant nucleic acid molecule obtained by operably linking the coding gene with transcription and / or translation regulatory elements.

[0020] The vector includes but is not limited to a plasmid vector, a viral vector, and a transposon.

[0021] The host cell is any cell capable of carrying the coding gene or expressing the acetyl-CoA synthetase, including microbial cells, preferably bacteria of the genus Corynebacterium (eg Corynebacterium glutamicum), Enterobacteriaceae (eg Escherichia coli) or bacteria of the genus Bacillus (eg Bacillus subtilis).

[0022] The above application is achieved by expressing the acetyl-CoA synthetase in a bacterium belonging to the genus Corynebacterium.

[0023] The above-mentioned expression of acetyl-CoA synthetase can be achieved by conventional techniques in the art.

[0024] Preferably, the expression of acetyl-CoA synthetase can be achieved by the following (1) and / or (2):

[0025] (1) Increase the copy number of the gene encoding acetyl-CoA synthetase on the chromosome;

[0026] (2) Introducing a plasmid containing a gene encoding acetyl-CoA synthetase.

[0027] In some embodiments of the present invention, the expression of acetyl-CoA synthetase is achieved by inserting a gene encoding acetyl-CoA synthetase into the chromosome of a bacterium of the genus Corynebacterium.

[0028] The present invention also found that on the basis of expressing acetyl-CoA synthetase, inactivating the endogenous NCg11988 gene or its homologous gene of Corynebacterium can further significantly improve the yield and conversion rate of lysine. Moreover, expressing acetyl-CoA synthetase can synergize with inactivating the NCg11988 gene or its homologous gene, and the effect of improving the lysine production capacity by modifying both at the same time is significantly better than modifying both separately.

[0029] Preferably, the use further comprises: inactivating the NCg11988 gene or its homologous gene in the Corynebacterium bacteria.

[0030] The NCg11988 gene is a gene encoding a hypothetical protein in Corynebacterium glutamicum (its amino acid sequence is shown in SEQ ID NO.3, and its nucleotide sequence is shown in SEQ ID NO.4). Its function is still unknown. The present invention finds that inactivating the NCg11988 gene has a significant effect on improving the lysine production capacity of the strain. Based on the sequence of the NCg11988 gene and its encoded protein, those skilled in the art can determine the homologous genes of the gene in other Corynebacterium bacteria through homologous sequence retrieval.

[0031] The above-mentioned inactivation can be achieved by conventional techniques in the art, such as replacing, deleting or inserting one or more bases in the gene so that the gene loses its function.

[0032] In some embodiments of the present invention, inactivation of the gene is achieved by deleting its coding frame.

[0033] In a second aspect, the present invention provides a modified Corynebacterium microorganism, wherein the modified Corynebacterium microorganism expresses acetyl-CoA synthetase, and / or the NCg11988 gene or a homologous gene thereof in the modified Corynebacterium microorganism is inactivated.

[0034] The present invention proves through experiments that in coryneform bacteria, expressing acetyl-CoA synthetase or inactivating NCg11988 gene or its homologous gene can promote the synthesis and accumulation of lysine, and significantly improve the lysine production capacity of the strain; performing these two modifications at the same time can further enhance the lysine production capacity of the strain and achieve higher lysine yield and conversion rate.

[0035] Preferably, the acetyl-CoA synthetase mentioned above is an acetyl-CoA synthetase derived from Escherichia coli.

[0036] Further preferably, the amino acid sequence of the acetyl-CoA synthetase is as shown in SEQ ID NO.1.

[0037] The above-mentioned expression of acetyl-CoA synthetase can be achieved by the following (1) and / or (2):

[0038] (1) increasing the copy number of the gene encoding acetyl-CoA synthetase on the chromosome of Corynebacterium bacteria;

[0039] (2) A plasmid having a gene encoding acetyl-CoA synthetase is introduced into a bacterium of the genus Corynebacterium.

[0040] The above-mentioned inactivation can be achieved by conventional techniques in the art, such as replacing, deleting or inserting one or more bases in the gene so that the gene loses its function.

[0041] In some embodiments of the present invention, inactivation of the gene is achieved by deleting its coding frame.

[0042] Preferably, the modified Corynebacterium microorganism has enhanced lysine-producing ability compared to the microorganism before modification.

[0043] The above-mentioned lysine productivity can be manifested as an increase in the yield and / or conversion rate of lysine.

[0044] Preferably, the Corynebacterium microorganism is Corynebacterium glutamicum.

[0045] The starting strain of the modified Corynebacterium microorganism (the microorganism before modification) can be any strain capable of synthesizing and accumulating lysine, including but not limited to wild-type Corynebacterium or modified lysine-producing bacteria.

[0046] In some embodiments of the present invention, the starting strain is wild-type Corynebacterium glutamicum ATCC13032 (model bacteria). Corynebacterium glutamicum ATCC13032 can be purchased from public channels. The genome sequence of the related strain has been disclosed, and relevant information can be queried at the NCBI website.

[0047] In some embodiments of the present invention, the starting strain is Corynebacterium glutamicum CGMCC No.11942, which is a lysine-producing bacterium and was deposited in the General Microbiological Center of China Culture Collection Committee on December 25, 2015, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. The classification name is: Corynebacterium glutamicum, which has been disclosed in patent CN105734004B.

[0048] In some embodiments of the present invention, the starting strain is Corynebacterium glutamicum CGMCC No.13407, which is a lysine-producing bacterium and was deposited in the General Microbiological Center of China Culture Collection Committee on November 30, 2016, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and is classified and named as Corynebacterium glutamicum. The strain has been disclosed in patent application CN106635944A.

[0049] The present invention is respectively with Corynebacterium glutamicum (wild-type strain, lysine production bacteria through genetic engineering) of different genetic background as starting strain and carried out above-mentioned transformation and obtain the fermentation experiment of transformation strain.After verification, after heterologous expression of acetyl-CoA synthetase and / or inactivation NCg11988 gene or its homologous gene in these starting strains, the lysine production and / or transformation efficiency of strain all significantly improve.It can be seen that the lifting effect of above-mentioned transformation for the lysine production capacity of strain does not depend on other genetic transformation contained by above-mentioned strain, and these genetic transformations are only for making strain have certain lysine production capacity.Therefore, the lifting effect of above-mentioned transformation for the lysine production capacity of Corynebacterium glutamicum has universality for the starting strain that can synthesize and accumulate lysine.Thus, it can be appreciated by those skilled in the art that above-mentioned transformation is introduced into the raising of lysine production and / or transformation efficiency in any Corynebacterium glutamicum.

[0050] In a third aspect, the present invention provides a method for constructing the modified Corynebacterium microorganism described above, the method comprising: modifying the Corynebacterium microorganism so that it expresses acetyl-CoA synthetase, and / or, the method comprising: modifying the Corynebacterium microorganism so that the NCg11988 gene or its homologous gene is inactivated.

[0051] Preferably, the expression of acetyl-CoA synthetase is achieved by introducing the gene shown in SEQ ID NO.2 into a microorganism of the genus Corynebacterium. The coding gene shown in SEQ ID NO.2 is a sequence after codon optimization according to the codon preference of Corynebacterium glutamicum, which enables the acetyl-CoA synthetase from Escherichia coli to be better expressed in Corynebacterium.

[0052] In a fourth aspect, the present invention provides the use of the modified Corynebacterium microorganism described above in the fermentation production of lysine or its derivatives, the use comprising the following steps:

[0053] (1) culturing the modified Corynebacterium microorganism to obtain a culture of the microorganism;

[0054] (2) Collecting the produced lysine or its derivatives from the culture obtained in step (1).

[0055] In a fifth aspect, the present invention provides a method for producing lysine or its derivatives by fermentation, the method comprising the following steps:

[0056] (1) culturing the modified Corynebacterium microorganism to obtain a culture of the microorganism;

[0057] (2) Collecting the produced lysine or its derivatives from the culture obtained in step (1).

[0058] The beneficial effects of the present invention include at least: the present invention significantly promotes the synthesis and accumulation of lysine by heterologously expressing acetyl-CoA synthetase and / or inactivating NCg11988 gene or its homologous gene in Corynebacterium, effectively improves the lysine production capacity of Corynebacterium, and significantly improves the lysine yield and / or conversion rate of Corynebacterium. The above transformation can be used for the construction of lysine production strains, effectively improves the lysine production capacity of strains, and is of great significance for improving the production efficiency of lysine and reducing production costs. DETAILED DESCRIPTION

[0059] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0060] The names and sequences of the primers involved in the following examples are shown in Table 1.

[0061] Table 1 Primer sequences

[0062] Name Sequence 5'→3' acs-1f catgctgcttactggtggcga acs-1r agatacagaccaagcggccaat acs-2f ggaaactctgagcacaagactaaaaac acs-2r ttattcacaccctgggggtgattc △NCg11988-1f ggttcgagaaggcactgctg △NCg11988-1r cgttttccgccgttggagtta △NCg11988-2f aactccaacggcggaaaacggagaaacacaatggagaaagt △NCg11988-2r aatggtcagcgtgacttctgcg

[0063] If no specific techniques or conditions are specified in the following examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0064] Example 1 Expression of Escherichia coli acs in Corynebacterium glutamicum ATCC 13032

[0065] Using the genome of Corynebacterium glutamicum ATCC 13032 as a template and the primer pair ACS-1F / ACS-1R, PCR amplification was performed to obtain the upstream homology arm fragment 13032-ACS-UP; using the genome of Corynebacterium glutamicum ATCC 13032 as a template and the primer pair ACS-2F / ACS-2R, PCR amplification was performed to obtain the downstream homology arm fragment 13032-ACS-DN.

[0066] The mutant promoter Ppyc*1 (SEQ ID NO.5) and the codon-optimized E. coli acs gene (encoding E. coli acetyl-CoA synthetase) were synthesized by Jinweizhi Biotechnology Co., Ltd. (China). The four-fragment mixture of 13032-acs-up, 13032-acs-dn, Ppyc*1, and acs was used as a template and PCR amplified with the primer pair acs-1f / acs-2r to obtain the fragment 13032-up-acs-dn. 13032-up-acs-dn was double-digested with BamHI and NheI, and the vector pK18mobsacB (GenBank: FJ437239.1; available from public channels) was double-digested with the same enzymes. The two digestion products were connected with T4DNA Ligase and transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pK18mobsacB-acs.

[0067] Prepare competent cells of ATCC 13032 according to the C. glutamicum Handbook (Charpter 23). The recombinant plasmid pK18mobsacB-acs was transformed into the competent cells by electroporation, and the transformants were screened on BHI selection medium containing 15 mg / L kanamycin. The screened transformants were cultured overnight in ordinary BHI liquid medium at 33°C and shaken at 220 rpm on a rotary shaker. During the culture process, the transformants underwent a second recombination, and the vector sequence was removed from the genome by gene exchange. The culture was diluted in a continuous gradient (10 -2 Serial dilution up to 10 -4 ), the dilution was spread on a common BHI solid medium containing 10% sucrose and cultured at 33°C for 48 hours. The colonies that grew did not carry the inserted vector sequence in their genome. By PCR amplification of the target sequence and nucleotide sequencing analysis, a strain with the E. coli acs gene integrated on the chromosome (expression driven by the mutant promoter Ppyc*1) was obtained and named 13032-acs.

[0068] Example 2 Inactivation of NCg11988 in Corynebacterium glutamicum ATCC 13032

[0069] Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, PCR amplification was performed with the primer pair △NCg11988-1f / △NCg11988-1r to obtain the upstream homology arm fragment 13032-△NCg11988-up; using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed with the primer pair △NCg11988-2f / NCg11988-2r to obtain the downstream homology arm fragment 13032-NCg11988-dn. The mixture of the two fragments 13032-△NCg11988-up and 13032-NCg11988-dn was used as a template, and the primer pair △NCg11988-1f / △NCg11988-2r was used for PCR amplification to obtain the fragment 13032-up-NCg11988-dn. The 13032-up-NCg11988-dn was double-digested with BamHI and NheI, and the vector pK18mobsacB (GenBank: FJ437239.1; available from public channels) was double-digested with the same enzymes. The two digestion products were connected with T4 DNA Ligase and transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pK18mobsacB-△NCg11988.

[0070] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-△NCg11988 was transferred into ATCC13032 to obtain a recombinant strain with inactivated NCg11988, which was named 13032-△NCg11988.

[0071] Example 3 Inactivation of NCg11988 in Corynebacterium glutamicum ATCC 13032 and simultaneous expression of Escherichia coli acs

[0072] The upstream homology arm fragment 13032-△NCg11988-up, the downstream homology arm fragment 13032-NCg11988-dn, Ppyc*1, and the mixture of acs were used as templates, and the primer pair △NCg11988-1f / △NCg11988-2r was used for PCR amplification to obtain the fragment 13032-up-NCg11988::acs-dn. 13032-up-NCg11988::acs-dn was double-digested with BamHI and NheI, and the vector pK18mobsacB was double-digested with the same enzymes. The two digestion products were connected with T4 DNA Ligase and transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pK18mobsacB-NCg11988::acs.

[0073] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-NCg11988::acs was transferred into ATCC13032 to obtain a recombinant strain in which NCg11988 was inactivated and E. coli acs was expressed. The strain was named 13032-NCg11988::acs.

[0074] Example 4 Fermentation performance test of recombinant strains

[0075] The culture medium used in the lysine fermentation experiment is as follows:

[0076] Seed activation medium: BHI 37g / L, 18g / L agar powder.

[0077] Seed culture medium: sucrose 20 g / L, yeast powder 5 g / L, peptone 10 g / L, urea 5 g / L, magnesium sulfate heptahydrate 0.4 g / L, adjust pH to 7.0.

[0078] Fermentation medium: glucose 60g / L, ammonium sulfate 25g / L, potassium dihydrogen phosphate 2.0g / L, magnesium sulfate heptahydrate 1.0g / L, soybean meal hydrolyzate 10g / L, calcium carbonate 30g / L, adjust pH to 7.0.

[0079] The lysine fermentation method is as follows:

[0080] 1. Seed activation: Take the strain to be verified from the cryopreserved tube, streak it on the seed activation medium, and culture it at 33℃ for 24h;

[0081] 2. Seed culture: Pick the activated seeds 1 from the plate and transfer them to a 500mL Erlenmeyer flask containing 30mL of seed culture medium. Shake and culture at 33℃ and 220r / min for 6h to obtain seed solution.

[0082] 3. Fermentation culture: inoculate 2 mL of seed liquid into a 500 mL Erlenmeyer flask containing 20 mL of fermentation medium, culture at 33°C and 220 rpm for 14-15 h, and make three replicates for each strain.

[0083] 4.OD 562 Determination: Take 100 μL of fermentation liquid and dilute it to an appropriate multiple. Use a spectrophotometer to detect the OD at a wavelength of 562. Do three replicates for each strain and calculate the average value. 562 As shown in Table 2.

[0084] 5. Determination of lysine concentration: 2 mL of fermentation broth was centrifuged (12000 rpm, 2 min), and the supernatant was collected. The L-lysine content in the fermentation broth of the recombinant bacteria and the control bacteria was detected by HPLC. Three parallels were made for each strain, and the average value was calculated. The detected lysine concentrations are shown in Table 2.

[0085] Table 2 Lysine production, sugar-acid conversion rate and growth detection of recombinant strains

[0086]

[0087]

[0088] The above results show that the lysine production and conversion rate of the recombinant strain expressing Escherichia coli acs alone and the inactivated hypothetical protein NCg11988 alone are significantly improved compared with the starting strain ATCC 13032, while the lysine production and conversion rate of the recombinant strain expressing Escherichia coli acs and the inactivated NCg11988 at the same time are further significantly improved compared with the above-mentioned individually modified recombinant strains.

[0089] The above examples prove that the expression of acetyl-CoA synthetase acs and inactivated NCg11988 from Escherichia coli promotes lysine production, and the combined expression of acetyl-CoA synthetase acs and inactivated NCg11988 has a better transformation effect. The above transformation effect was further verified in lysine-producing bacteria, specifically, using two lysine-producing bacteria CGMCC No.13407 and CGMCC No.11942. CGMCC No.13407 and CGMCC No.11942 were obtained by genetic modification of the model bacteria ATCC13032, and their lysine synthesis-related genes were strengthened.

[0090] Example 5 Expression of E. coli acs in CGMCC No.13407

[0091] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-acs was transferred into CGMCC No.13407 to obtain a recombinant strain expressing the Escherichia coli acs gene, and the strain was named 13407-acs.

[0092] Example 6 Inactivation of NCg11988 in CGMCC No.13407

[0093] Referring to the method of Example 2, the constructed recombinant plasmid pK18mobsacB-NCg11988 was transferred into CGMCC No.13407 to obtain a recombinant strain with inactivated NCg11988, which was named 13407-ΔNCg11988.

[0094] Example 7 Inactivation of NCg11988 and simultaneous expression of E. coli acs in CGMCC No.13407

[0095] Referring to the method of Example 3, the constructed recombinant plasmid pK18mobsacB-NCg11988::acs was transferred into CGMCC No.13407 to obtain a recombinant strain with inactivated NCg11988 and expressed acs, and the strain was named 13407-NCg11988::acs.

[0096] Example 8 Expression of E. coli acs in CGMCC No.11942

[0097] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-acs was transferred into CGMCC No.11942 to obtain a recombinant strain expressing the Escherichia coli acs gene, and the strain was named 11942-acs.

[0098] Example 9 Inactivation of NCg11988 in CGMCC No.11942

[0099] Referring to the method of Example 2, the constructed recombinant plasmid pK18mobsacB-NCg11988 was transferred into CGMCC No.11942 to obtain a recombinant strain with inactivated NCg11988, which was named 11942-ΔNCg11988.

[0100] Example 10 Inactivation of NCg11988 and simultaneous expression of E. coli acs in CGMCC No.11942

[0101] Referring to the method of Example 3, the constructed recombinant plasmid pK18mobsacB-NCg11988::acs was transferred into CGMCC No.11942 to obtain a recombinant strain with NCg11988 inactivated and acs expressed, and the strain was named 11942-NCg11988::acs.

[0102] Example 11 Fermentation performance test of recombinant strains

[0103] CGMCC No. 13407, CGMCC No. 11942 and their modified recombinant bacteria 13407-acs, 13407-ΔNCg11988, 13407-NCg11988::acs, 11942-acs, 11942-ΔNCg11988, 11942-NCg11988::acs were fermented and verified by referring to the method of Example 4. The results of the lysine fermentation experiment are shown in Table 3.

[0104] Table 3 Lysine production, sugar-acid conversion rate and growth detection of recombinant strains

[0105]

[0106]

[0107] The above results show that in the same batch of tests, two lysine-producing bacteria, recombinant bacteria expressing acs, recombinant bacteria with inactivated hypothetical protein gene NCg11988, and recombinant bacteria with inactivated hypothetical protein gene NCg11988 and expressing acs, the lysine production and sugar-acid conversion rate of all recombinant bacteria were significantly improved, among which the recombinant bacteria with inactivated hypothetical protein gene NCg11988 and expressing acs had the highest lysine production and conversion rate, which were significantly better than the effect of improving lysine production capacity by inactivating the hypothetical protein gene NCg11988 alone or expressing acs alone.

[0108] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Any of the following uses of acetyl-CoA synthetase or its encoding gene or a biological material containing the encoding gene: (1) Application in constructing a microorganism for producing lysine or its derivatives; (2) Application in the production of lysine or its derivatives by microbial fermentation; (3) Application in increasing the yield of lysine or its derivatives produced by microorganisms.

2. The use according to claim 1, characterized in that: The acetyl-CoA synthetase is an acetyl-CoA synthetase derived from Escherichia coli; and / or, the microorganism is a bacterium of the genus Corynebacterium; Preferably, the amino acid sequence of the acetyl-CoA synthetase is as shown in SEQ ID NO.

1.

3. The use according to claim 1 or 2, characterized in that: The application is achieved by expressing acetyl-CoA synthetase in bacteria belonging to the genus Corynebacterium.

4. The use according to claim 3, characterized in that: The application also includes: inactivating the NCg11988 gene or its homologous gene in Corynebacterium bacteria.

5. A modified Corynebacterium microorganism, characterized in that The modified Corynebacterium microorganism expresses acetyl-CoA synthetase, and / or the NCg11988 gene or a homologous gene thereof in the modified Corynebacterium microorganism is inactivated.

6. The modified Corynebacterium microorganism according to claim 5, characterized in that The acetyl-CoA synthetase is an acetyl-CoA synthetase derived from Escherichia coli; Preferably, the amino acid sequence of the acetyl-CoA synthetase is as shown in SEQ ID NO.

1.

7. The modified Corynebacterium microorganism according to claim 5 or 6, characterized in that The modified Corynebacterium microorganism has enhanced lysine-producing ability compared to the microorganism before modification.

8. The method for constructing a modified Corynebacterium microorganism according to any one of claims 5 to 7, characterized in that: The method comprises: modifying a microorganism of the genus Corynebacterium so that it expresses acetyl-CoA synthetase, and / or the method comprises: modifying a microorganism of the genus Corynebacterium so that the NCg11988 gene or a homologous gene thereof is inactivated.

9. The method according to claim 8, characterized in that The expression of acetyl-CoA synthetase is achieved by introducing the gene shown in SEQ ID NO. 2 into a microorganism of the genus Corynebacterium.

10. Use of the modified Corynebacterium microorganism according to any one of claims 5 to 7 in fermentation production of lysine or its derivatives, the use comprising the following steps: (1) culturing the modified Corynebacterium microorganism according to any one of claims 5 to 7 to obtain a culture of the microorganism; (2) Collecting the produced lysine or its derivatives from the culture obtained in step (1).

Images