Application of anthraquinone methyl hydroxylase 4804 inactivating agent and engineering strain for high yield of emodin or emodin derivative

Abstract

The invention relates to an application of an anthraquinone methyl hydroxylase 4804 inactivating agent in construction of an aspergillus terreus engineering strain for high yield of emodin or a derivative thereof. The invention further relates to aspergillus terreus engineering bacteria for high yield of emodin or the emodin derivatives and a construction method of the aspergillus terreus engineering bacteria. The anthraquinone methyl hydroxylase 4804 gene is knocked out, so that a hydroxylation pathway of the emodin is blocked in aspergillus terreus cells, the yield of the emodin and the emodin-3-methyl ether in the aspergillus terreus cells is increased, the production cost of the emodin and the emodin-3-methyl ether is reduced, and the yield of the emodin and the emodin-3-methyl ether is increased. And a foundation is provided for the microorganism synthesis industrialization of the emodin and the emodin-3-methyl ether.

Description

Technical Field

[0001] The present invention belongs to the field of microbial metabolic engineering, and more particularly, relates to the application of an anthraquinone methyl hydroxylase 4804 disabling agent in constructing an Aspergillus terreus engineered strain with high production of rhubarb or its methyl ether derivatives, as well as an Aspergillus terreus engineered strain with high production of rhubarb or its methyl ether derivatives and a construction method thereof. Background Art

[0002] Emodin is an important active ingredient in traditional Chinese medicines such as rhubarb, aloe and knotweed. It has multiple biological activities and pharmacological effects such as antibacterial, anti-inflammatory, anti-tumor and antioxidant, and has become a hot topic in research and application. As a derivative of emodin, emodin-3-methyl ether (CAS registration number: 521-61-9) ( Figure 1 ) also shows a wide range of pharmacological and agricultural application prospects. Medical research shows that rhubarb-3-methyl ether can effectively inhibit Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa and other pathogens. In addition, the compound has been found to have the potential to prevent and treat depression-related diseases. By inhibiting the activity of 6-phosphate glucose dehydrogenase, rhubarb-3-methyl ether can inhibit the proliferation and spread of cancer cells. In the agricultural field, rhubarb-3-methyl ether has been developed into a biological pesticide for the prevention and control of diseases in green agriculture and organic vegetables due to its low toxicity and environmental protection. The compound has a broad spectrum of insecticidal activity and can effectively inhibit the development and reproduction of a variety of pests, especially in the prevention and control of powdery mildew, downy mildew, gray mold and anthrax. In addition, rhubarb-3-methyl ether, as a veterinary drug, can reduce the mortality rate of native chickens and improve the egg-laying performance and quality of chickens.

[0003] However, the content of rhamnosin and its methyl ether derivatives in plants is extremely low, and plants are restricted by the growth environment, making it difficult to achieve stable mass production, which seriously limits the promotion of the two, especially rhamnosin-3-methyl ether, as fungicides. Therefore, reconstructing the microbial cell factory of rhamnosin-3-methyl ether based on the concept of synthetic biology is of great significance for breaking through the shackles of production capacity and quality and expanding market share.

[0004] In the previous research of our team, we have constructed an engineered strain capable of producing rhamnin and rhamnin-3-methyl ether. However, we found through analysis that the byproducts of fermentation products of these engineered bacteria, namely, methyl-hydroxylated anthraquinone derivatives (ω-hydroxyrhamnin and omega-3-methyl alcohol), were high in content, indicating that the existence of this hydroxylation metabolic branch seriously affected the production of rhamnin and rhamnin-3-methyl ether. Therefore, further genetic manipulation is needed to block the hydroxylation branch of rhamnin. Summary of the invention

[0005] In order to solve the above problems, the present invention provides the use of anthraquinone methyl hydroxylase 4804 disabling agent in constructing an Aspergillus terreus engineered strain with high production of rhamnosin or its methyl ether derivatives.

[0006] In a specific embodiment, the anthraquinone methyl hydroxylase 4804 disabling agent is a nucleic acid structure that can be used to knock out the anthraquinone methyl hydroxylase 4804 gene in Aspergillus terreus, or a nucleic acid structure that can cause the anthraquinone methyl hydroxylase 4804 gene in Aspergillus terreus to mutate and lose the function of hydroxylating rhamnosin.

[0007] Such a nucleic acid structure may be DNA and / or RNA, as long as it can disable anthraquinone methyl hydroxylase 4804, that is, it can be used to perform one or more of the following steps:

[0008] 1) Deletion of the entire anthraquinone methyl hydroxylase 4804 gene from the genome;

[0009] 2) Deleting part of the anthraquinone methyl hydroxylase 4804 gene from the genome, so that the expression product loses the function of catalyzing the hydroxylation of rhamnolide;

[0010] 3) mutating the anthraquinone methyl hydroxylase 4804 gene in the genome so that the expression product loses the function of catalyzing the hydroxylation of rhamnolide;

[0011] 4) deleting the promoter of the anthraquinone methyl hydroxylase 4804 gene from the genome or mutating the promoter of the anthraquinone methyl hydroxylase 4804 gene, so that the anthraquinone methyl hydroxylase 4804 gene cannot initiate transcription;

[0012] 5) The transcript of anthraquinone methyl hydroxylase 4804 gene cannot be translated.

[0013] In a specific embodiment, the amino acid sequence of the anthraquinone methyl hydroxylase 4804 is as shown in SEQ ID NO:1.

[0014] The present invention also provides a method for constructing an engineered Aspergillus terreus strain that can produce high-yield rhamnosin or its methyl ether derivatives, using an Aspergillus terreus strain that can produce rhamnosin or its methyl ether derivatives as a starting strain, and comprising the step of making anthraquinone methyl hydroxylase 4804 in the starting strain lose its function.

[0015] In a specific embodiment, anthraquinone methyl hydroxylase 4804 is rendered inactive by one or more of the following steps:

[0016] 1) Deletion of the entire anthraquinone methyl hydroxylase 4804 gene from the genome;

[0017] 2) Deleting part of the anthraquinone methyl hydroxylase 4804 gene from the genome, so that the expression product loses the function of catalyzing the hydroxylation of rhamnolide;

[0018] 3) mutating the anthraquinone methyl hydroxylase 4804 gene in the genome so that the expression product loses the function of catalyzing the hydroxylation of rhamnolide;

[0019] 4) deleting the promoter of the anthraquinone methyl hydroxylase 4804 gene from the genome or mutating the promoter of the anthraquinone methyl hydroxylase 4804 gene, so that the anthraquinone methyl hydroxylase 4804 gene cannot initiate transcription;

[0020] 5) The transcript of anthraquinone methyl hydroxylase 4804 gene cannot be translated.

[0021] Among them, 1-4 can be achieved through homologous double exchange or gene editing, and 5 can be achieved through mi RNA or RNA interference.

[0022] In a specific embodiment, the starting strain is an engineered strain of Aspergillus terreus obtained by one or more of the following steps:

[0023] 1) Overexpression of the transcriptional regulator ATEG_08453;

[0024] 2) disabling the rhamnosin-1-hydroxy O-methyltransferase gene gedA;

[0025] 3) Overexpression of rhamnosin 3-hydroxy-O-methyltransferase.

[0026] In a specific embodiment, the amino acid sequence of the anthraquinone methyl hydroxylase 4804 is as shown in SEQ ID NO:1.

[0027] The present invention also provides an engineering bacterium of Aspergillus terreus for high production of rhubarb or its methyl ether derivatives, which is constructed by the above method.

[0028] The present invention also provides the use of the Aspergillus terreus engineering bacteria in producing rhamnosin or its methyl ether derivative.

[0029] The present invention also provides an anthraquinone methyl hydroxylase, the amino acid sequence of which is shown in SEQ ID NO:1.

[0030] The invention blocks the hydroxylation pathway of rheum in Aspergillus terreus cells by knocking out the anthraquinone methyl hydroxylase 4804 gene, thereby increasing the yield of rheum or rheum-3-methyl ether in the Aspergillus terreus cells, reducing the production costs of rheum and rheum-3-methyl ether, and providing a basis for the industrialization of microbial synthesis of rheum and rheum-3-methyl ether. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 It is the structural formula of rheumatoid artemisia and rheumatoid artemisia-3-methyl ether.

[0032] Figure 2ATCC20542- OE Schematic diagram of the construction of 08453-ΔgedA-ΔpyrGAn transformant and PCR verification diagram.

[0033] Figure 3 ATCC20542- OE PCR validation chart of 08453-ΔgedA-Δ4804.

[0034] Figure 4 ATCC20542- OE PCR verification chart of 08453-ΔgedA-Δ10601.

[0035] Figure 5 This is the HPLC analysis chart of the fermentation product of the second-generation rhubarb engineered bacteria.

[0036] Figure 6 ATCC20542- OE PCR verification diagram of transformants of 08453-PfOMT-ΔpyrGAn.

[0037] Figure 7 ATCC20542- OE PCR verification diagram of transformants of 08453-PfOMT-Δ4804.

[0038] Figure 8 This is the HPLC analysis chart of the fermentation product of the second-generation rhamnosin-3-methyl ether engineered bacteria. DETAILED DESCRIPTION

[0039] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0040] 1. Construction of the second-generation rhubarb-producing bacteria

[0041] In the early stage, our team overexpressed the transcriptional regulatory factor ATEG_08453 (the encoded amino acid sequence is shown in SEQ ID NO:3) in Aspergillus terreus and knocked out the O-methyltransferase gene gedA (the encoded amino acid sequence is shown in SEQ ID NO:4), and obtained the first-generation engineered bacteria ATCC20542-1 that can produce rhamnosin and rhamnosin-3-methyl ether. OE 08453-ΔgedA (Chinese patents 2019106498526 and 2019106501497).

[0042] Through the first generation of rhubarb engineering bacteria ATCC20542- OETranscriptome analysis of 08453-ΔgedA revealed that gene 4804 (the nucleic acid sequence is shown in SEQ ID NO: 2, and the encoded amino acid sequence is shown in SEQ ID NO: 1) or gene 10601 may be responsible for catalyzing the hydroxylation of the 6-methyl group of rhamnolide.

[0043] In the first-generation rhamnosine engineered strain, knocking out the above-mentioned genes may block the accumulation of the by-product ω-hydroxyrhamnosine and further increase the production of rhamnosine.

[0044] To verify the above hypothesis, we constructed the second-generation rhubarb engineering strain ATCC20542- OE 08453-ΔgedA-Δ4804 and ATCC20542- OE 08453-ΔgedA-Δ10601, the method is as follows:

[0045] 1) Construction of uridine auxotrophic strain

[0046] Aspergillus terreus ATCC20542- OE The genomic DNA of 08453 was used as a template, and the upstream and downstream homology arms (~1.2 kb) of pyrGAn were amplified by PCR using primers UpyrGAn-F / UpyrGAn-R and DpyrGAn-F / DpyrGAn-R, respectively. The upstream and downstream homology arms were fused by fusion PCR, and the fusion product was used as a template for nested PCR amplification to obtain the targeting element for knocking out the pyrGAn gene. The primer sequences are as follows:

[0047] UpyrGAn-F:tccagaggctctgagtttgc;

[0048] UpyrGAn-R: gagatggtgattgagctagt ttacactctgggaggatcca;

[0049] DpyrGAn-F: tggatcctcccagagtgtaa actagctcaatcaccatctc;

[0050] DpyrGAn-R:ggcagagctgactggagaga;

[0051] CpyrGAn-F:gatggcagtcgacatcggat;

[0052] CpyrGAn-R:gtcaacgtcagtctatcgag;

[0053] Uan-F:ctccgaacaccccacaatagagcatg;

[0054] Dan-R:aggactggcagagctgactggaga.

[0055] Preparation of first generation engineered strain ATCC20542- OE The protoplast suspension of 08453-ΔgedA was transformed with the targeting element for knocking out the pyrGAn gene. The transformants were selected to extract genomic DNA and PCR was performed with primers Uan-F / Dan-R. OE The genome of strain 08453 was used as a control. OE Using the genomic DNA of 08453 as a template, a band of about 4.2 kb should be amplified, and using the genomic DNA of the successfully knocked-out pyrGAn transformant as a template, a band of about 2.7 kb should be amplified.

[0056] The results are as follows Figure 2 As shown, the candidate transformants in lanes 1-4 are positive transformants for knocking out the pyrGAn gene and are recorded as ATCC20542- OE 08453-ΔgedA-ΔpyrGAn.

[0057] 2) ATCC20542- OE Construction of 08453-ΔgedA-Δ4804

[0058] ATCC20542- OE The genome of 08453-ΔgedA was used as a template, and the upstream and downstream homology arms of 4804 (~1.0 kb) were amplified by PCR with primers U4804-F / U4804-R2 and D4804-F2 / D4804-R2, respectively. The pyrGAn gene was amplified with primers pyrGAn-F / pyrGAn-R, and the upstream homology arm, pyrGAn and downstream homology arm were fused by fusion PCR. The fusion product was used as a template and PCR amplification was performed with nested primers C4804-F / C4804-R2 to obtain the targeting element U4804-pyrGAn-D4804 with 4804 gene knocked out and pyrGAn complemented.

[0059] The primer sequences used in the above experiments are as follows:

[0060] U4804-F:cacacatggggttcgatgtttcg;

[0061] U4804-R2: acttcgtatagcatacattatacgaagttatggctggcagttcaatctgggg ac;

[0062] D4804-F2:ttcgtataatgtatgctatacgaagttatggcgtagttgttagtattggata tg;

[0063] D4804-R2:tactggaagaaatacctggccggc;

[0064] pyrGAn-F:tcgtataatgtatgctatacgaagttatcagcagggaatacgagctc;

[0065] pyrGAn-R:acgccataacttcgtatagcatacattatacgaagttatgcatcaaatcgtc gtaccg;

[0066] C4804-F:gaattaaggctgcaccggcg;

[0067] C4804-R2:agacacgcccaagaagcaaac;

[0068] pyrG-i nF:ttggtcagcagtaccagacgc;

[0069] pyrG-i nR:tcgactggtggaccctgattc.

[0070] Preparation of ATCC20542- OE The protoplast suspension of 08453-ΔgedA-ΔpyrGAn was transferred into the targeting element U4804-pyrGAn-D4804, and transformants were selected for upstream and downstream anchor PCR verification using primers U4804-F / pyrG-i nR and pyrG-i nF / D4804-R2, respectively. OE The genome of strain 08453-ΔgedA was used as a control. OE Using the genomic DNA of 08453-ΔgedA as a template, no bands can be amplified. Using the genomic DNA of the candidate positive transformant as a template, upstream and downstream bands of 1.3 kb and 1.5 kb in size should be amplified.

[0071] The results are as follows Figure 3 As shown, the candidate transformants in lanes 1-8 are positive transformants in which the 4804 gene is knocked out and the pyrGAn gene is complemented, and are recorded as ATCC20542- OE 08453-ΔgedA-Δ4804.

[0072] 3) ATCC20542- OE Construction of 08453-ΔgedA-Δ10601

[0073] ATCC20542- OE The genome of 08453-ΔgedA was used as a template, and the upstream and downstream homologous arms (~1.2kb) of the 10601 gene were amplified with primers U10601-F / U10601-R and D10601-F / D10601-R, respectively. The pyrGAn gene was amplified with primers pyrG-F / pyrG-R, and the upstream homologous arm, pyrGAn and the downstream homologous arm were fused by fusion PCR. The fusion product was used as a template and PCR amplification was performed with nested primers C10601-F / C10601-R to obtain the targeting element U10601-pyrGAn-D10601 with the 10601 gene knocked out and pyrGAn complemented.

[0074] The primer sequences used in the above experiments are as follows:

[0075] U10601-F:acgtgaactttgagaatctgctgg;

[0076] U10601-R:cattggagctcgtattccctgctgttcaagccaaagggttcaactggc;

[0077] D10601-F:caatgcggtacgacgatttgatgcgttgacctaacgatcttactgcttatg;

[0078] D10601-R:ttattgtacgttgcgagctgctc;

[0079] pyrG-F:cagcagggaatacgagctccaatg;

[0080] pyrG-R:gcatcaaatcgtcgtaccgcattg;

[0081] C10601-F:acagccagaaatcttccgcg;

[0082] C10601-R:tggcatgccattaatgcgtgc.

[0083] Preparation of ATCC20542- OEThe protoplast suspension of 08453-ΔgedA-ΔpyrGAn was transferred into the targeting element U10601-pyrGAn-D10601, and transformants were selected and verified by PCR using primers U10601-F / D10601-R. OE The genome of strain 08453-ΔgedA was used as a control. OE Using the genomic DNA of 08453-ΔgedA as a template, a band of 4.3 kb should be amplified, and using the genomic DNA of the candidate positive transformant as a template, a band of 3.9 kb should be amplified. Figure 4 As shown, the candidate transformants in lanes 1, 2, 4, 5, 7, 8, and 9 are positive transformants in which the 10601 gene is knocked out and the pyrGAn gene is complemented, and are recorded as ATCC20542- OE 08453-ΔgedA-Δ10601.

[0084] 2. Fermentation analysis of the second generation rhubarb engineering strain

[0085] The constructed engineered strains ATCC20542- OE 08453-ΔgedA-Δ4804, ATCC20542- OE 08453-ΔgedA-Δ10601 and control strain ATCC20542- OE 10 spores of 08453-ΔgedA 7 Each strain was shaken and cultured at 28°C and 220 rpm for 7 days to obtain the fermentation broth of each strain. 1 ml of the fermentation broth was extracted with methanol: dichloromethane (vol / vol=1:1), and then the extract was blown dry with nitrogen, re-dissolved in methanol, and used for the next step of analysis.

[0086] The extracted compounds were analyzed on an Agile 1260 HPLC on an Agile Element Eclepse Plus C18 column (5 μm, 4.6 mm×250 mm). The analysis method was as follows: mobile phase A (100% H2O+0.05% TFA), mobile phase B (100% ACN+0.05% TFA), gradient elution (0-1 min 50% A, 1-20 min 50%-0% A, 20-24 min 0% A, 24-25 min 0%-50% A, 25-30 min 50% A), flow rate 1 ml / min, detection wavelength 440 nm.

[0087] The results are as follows Figure 5 As shown, the engineered strain ATCC20542-OE The fermentation products of 08453-ΔgedA-Δ10601 still accumulated ω-hydroxy-rhodamine, and the yield of rhodamine was not significantly different from that of the first-generation engineered bacteria, indicating that the 10601 gene was not responsible for the hydroxylation of rhodamine; while the engineered strain ATCC20542- OE There was no accumulation of ω-hydroxy-rhodamine in the fermentation product of 08453-ΔgedA-Δ4804, and the production of rhodamine was 1.25 g / L, which was significantly higher than that of the first-generation rhodamine engineering strain without knocking out 4804 (0.51 g / L). This indicated that the 4804 gene was responsible for the hydroxylation of rhodamine, and knocking out the gene blocked the conversion of rhodamine to ω-hydroxy-rhodamine, thereby greatly increasing the production of rhodamine.

[0088] 3. Construction of the second generation rhamnosin 3-methyl ether engineering strain

[0089] According to the above experimental results, we further knocked out the endogenous rhamnosin hydroxylase 4804 gene of Aspergillus terreus on the basis of the first-generation rhamnosin-3-methyl ether engineering strain to verify whether this operation can block the accumulation of byproducts ω-hydroxyrhamnosin and fascinol, and increase the production of rhamnosin-3-methyl ether. The first-generation rhamnosin-3-methyl ether engineering strain was constructed by our team in previous studies. By introducing rhamnosin 3-hydroxy-O-methyltransferase into Aspergillus terreus, the host can produce rhamnosin-3-methyl ether. On this basis, the transcriptional regulatory factor ATEG_08453 is overexpressed to increase the production of rhamnosin-3-methyl ether, and the first-generation rhamnosin-3-methyl ether engineering strain is obtained (Chinese patent applications: 202110706608.6, 202110705353.1, 202110707239.2 and 202110705889.3).

[0090] 1) Construction of uridine auxotrophic strain

[0091] We used the engineered strain ATCC20542- OE 08453-PfOMT (overexpression of transcriptional regulatory factor ATEG_08453 and rhamnosus 3-hydroxy-O-methyltransferase from Pseudomonas carinii (amino acid sequence as shown in SEQ ID NO: 5) in Aspergillus terreus) was used as an example to verify whether the knockout of the rhamnosus hydroxylase 4804 gene could increase the production of rhamnosus 3-methyl ether.

[0092] ATCC20542- OE 08453-PfOMT was used as the starting strain. The uridine auxotrophic strain was constructed according to the method described above. The transformants were selected to extract genomic DNA and PCR verification was performed. The results are shown in Figure 6As shown, the candidate transformant in lane 1 is a positive transformant for knocking out the pyrGAn gene and is recorded as ATCC20542- OE 08453-PfOMT-ΔpyrGAn.

[0093] 2) Construction of the second generation rhamnosin-3-methyl ether engineering strain

[0094] ATCC20542- OE The genome of 08453-PfOMT was used as a template to amplify the upstream and downstream homologous arms of 4804 (~1.3kb) by PCR with primers U4804-F / U4804-R and D4804-F / D4804-R, respectively, and the pyrGAn gene was amplified with primers pyrG-F / pyrG-R. The upstream homologous arm, pyrGAn and downstream homologous arm were fused by fusion PCR, and the fusion product was used as a template to perform PCR amplification with nested primers C4804-F / C4804-R to obtain the targeting element U4804-pyrG-D4804 that knocked out the 4804 gene and complemented the pyrGAn.

[0095] Preparation of ATCC20542- OE The protoplasmic suspension of 08453-PfOMT-ΔpyrGAn was transferred into the targeting element U4804-pyrG-D4804. The transformants were selected to extract genomic DNA and PCR was performed with primers U4804-F / D4804-R. OE The genome of ATCC20542- OE Using the genomic DNA of 08453-PfOMT as a template, a band of 3.3 kb should be amplified, and using the genomic DNA of the candidate positive transformant as a template, a band of 4 kb should be amplified.

[0096] The results are as follows Figure 7 As shown, the transformants in lanes 1, 3, 4, 6, 8, 10, and 11 are positive transformants for knocking out the 4804 gene and are recorded as ATCC20542- OE 08453-PfOMT-Δ4804.

[0097] 4. Fermentation analysis of the second generation rhamnosin-3-methyl ether engineering strain

[0098] The engineered strain ATCC20542- was inoculated into the Aspergillus terreus SMP medium. OE 08453-PfOMT-Δ4804 and control strain ATCC20542- OE 08453-PfOMT spores 10 each 7Each strain was shaken and cultured at 28°C and 220 rpm for 4 days to obtain the fermentation broth of each strain. 1 ml of the fermentation broth was extracted with methanol: dichloromethane (vol / vol=1:1), and then the extract was blown dry with nitrogen gas, re-dissolved in methanol, and used for the next step of analysis.

[0099] The extracted compounds were analyzed using an Agile 1260 HPLC on an Agile Eclipse Plus C18 column (5 μm, 4.6 mm×250 mm). The analytical method is as described above.

[0100] The results are as follows Figure 8 As shown, the engineered strain ATCC20542- OE No ω-hydroxy-rhodamine accumulated in the fermentation product of 08453-PfOMT-Δ4804. At this time, the yield of rhodamine-3-methyl ether was 1.28 g / L, which was significantly higher than that of the first generation rhodamine-3-methyl ether engineered strain (0.52 g / L) without knocking out anthraquinone methyl hydroxylase 4804.

[0101] It should be noted that the fermentation analysis experiment using the first-generation engineered strain previously constructed by our team and the second-generation engineered strain obtained by knocking out 4804 on this basis proved that knocking out anthraquinone methyl hydroxylase 4804 can block the hydroxylation of rhein, thereby increasing the yield of rhein and rhein-3-methyl ether, which is purely for illustrative purposes. In Aspergillus terreus, an engineered strain for producing rhein / rhein-3-methyl ether can be obtained through any other metabolic engineering pathway, and on this basis, 4804 can be knocked out to obtain a higher yield of rhein / rhein-3-methyl ether.

[0102] In addition to proving that knocking out 4804 can block the hydroxylation of rhein, thereby increasing the production of rhein and rhein-3-methyl ether, the above experiments can also prove that 4804 is a functional anthraquinone methyl hydroxylase gene, and the protein it encodes has the function of hydroxylating rhein to produce ω-hydroxyrhein.

[0103] In addition, in the specific embodiment of the present invention, the method of homologous double exchange deletion 4804 is used to disable the anthraquinone methyl hydroxylase 4804 in the engineered strain to illustrate that the inability of this gene can increase the yield of rhubarb and its methyl ether derivatives. However, those skilled in the art should understand that in addition to this method, any other genetic manipulation means can be used to disable the anthraquinone methyl hydroxylase 4804 in the engineered strain using any one or more existing or future genetic manipulation means such as homologous double exchange, CRISPR and other gene editing systems, mi RNA, interfering RNA, etc., as long as any one of the following situations is achieved:

[0104] 1) Deletion of the entire anthraquinone methyl hydroxylase 4804 gene from the genome;

[0105] 2) Deleting part of the anthraquinone methyl hydroxylase 4804 gene from the genome, so that the expression product loses the function of catalyzing the hydroxylation of rhamnolide;

[0106] 3) mutating the anthraquinone methyl hydroxylase 4804 gene in the genome so that the expression product loses the function of catalyzing the hydroxylation of rhamnolide;

[0107] 4) deleting the promoter of the anthraquinone methyl hydroxylase 4804 gene from the genome or mutating the promoter of the anthraquinone methyl hydroxylase 4804 gene, so that the anthraquinone methyl hydroxylase 4804 gene cannot initiate transcription;

[0108] 5) The transcript of anthraquinone methyl hydroxylase 4804 gene cannot be effectively translated.

[0109] We have also verified it through corresponding methods and obtained similar effects. In order not to make the description of the present invention redundant, the above experimental content is not included in the description. Therefore, all existing or future methods for disabling anthraquinone methyl hydroxylase 4804 in the art should be included in the protection scope of the present invention.

[0110] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. Application of anthraquinone methyl hydroxylase 4804 disabling agent in constructing an engineered strain of Aspergillus terreus that produces high levels of rhamnosin or its methyl ether derivatives.

2. The use according to claim 1, characterized in that: The anthraquinone methyl hydroxylase 4804 disabling agent is a nucleic acid structure that can be used to knock out the anthraquinone methyl hydroxylase 4804 gene in Aspergillus terreus, or a nucleic acid structure that can cause the anthraquinone methyl hydroxylase 4804 gene in Aspergillus terreus to mutate and lose the function of hydroxylating rhamnosin.

3. The use according to claim 1 or 3, characterized in that: The amino acid sequence of the anthraquinone methyl hydroxylase 4804 is shown in SEQ ID NO:

1.

4. A method for constructing an engineered strain of Aspergillus terreus that produces high-yield rhamnosin or its methyl ether derivatives, using an Aspergillus terreus strain that produces rhamnosin or its methyl ether derivatives as a starting strain, characterized in that: The method comprises the step of making the anthraquinone methyl hydroxylase 4804 in the starting strain lose its function.

5. The method according to claim 4, characterized in that Anthraquinone methyl hydroxylase 4804 is rendered inactive by one or more of the following steps: 1) Deletion of the entire anthraquinone methyl hydroxylase 4804 gene from the genome; 2) Deleting part of the anthraquinone methyl hydroxylase 4804 gene from the genome, so that the expression product loses the function of catalyzing the hydroxylation of rhamnolide; 3) mutating the anthraquinone methyl hydroxylase 4804 gene in the genome so that the expression product loses the function of catalyzing the hydroxylation of rhamnolide; 4) deleting the promoter of the anthraquinone methyl hydroxylase 4804 gene from the genome or mutating the promoter of the anthraquinone methyl hydroxylase 4804 gene, so that the anthraquinone methyl hydroxylase 4804 gene cannot initiate transcription; 5) The transcript of anthraquinone methyl hydroxylase 4804 gene cannot be effectively translated.

6. The method according to claim 2, characterized in that The starting strain is an engineered strain obtained by Aspergillus terreus through one or more of the following steps: 1) Overexpression of the transcriptional regulator ATEG_08453; 2) disabling the rhamnosin-1-hydroxy O-methyltransferase gene gedA; 3) Overexpression of rhamnosin-3-hydroxy-O-methyltransferase.

7. The method according to any one of claims 4 to 6, characterized in that: The amino acid sequence of the anthraquinone methyl hydroxylase 4804 is shown in SEQ ID NO:

1.

8. An engineered strain of Aspergillus terreus that can produce high yield of rhubarb or its methyl ether derivative, characterized in that: It is constructed by the method according to any one of claims 4 to 7.

9. Use of the engineered Aspergillus terreus according to claim 8 in the production of rheum-emodin or its derivatives.

10. An anthraquinone methyl hydroxylase, characterized in that The amino acid sequence is shown in SEQ ID NO:1.

Images