Method for improving expression quantity of nicotiana benthamiana foreign protein

Abstract

The invention relates to the technical field of biology, in particular to a method for increasing the expression quantity of nicotiana benthamiana foreign protein. The method comprises the following steps: designing protease SBT1.9-1 and protease SBT1.9-2 instantaneous silencing fragments, constructing a TRV2: SBT1.9 vector by using a homologous recombination technology, and injecting the TRV2: SBT1.9 vector to two-week-old Bensi tobacco leaf to construct a plant by using agrobacterium, so that after the protease SBT1.9-1 and the protease SBT1.9-2 are instantaneously silenced, the expression quantity of an exogenous target protein is obviously increased, and the expression quantity of the exogenous target protein is obviously increased; the purpose of improving the nicotiana benthamiana bioreactor is achieved, and the method has great application value in production.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for increasing the expression amount of exogenous proteins in Nicotiana benthamiana. Background Art

[0002] Plant bioreactor refers to a method of using plant cells or tissues to produce vaccines, medical proteins, industrial and agricultural enzymes, biodegradable plastics, special carbohydrates, esters and other secondary metabolites with medical value or important functional effects.

[0003] At present, the technology of efficient expression of exogenous genes in some plants such as potatoes and corn is not very mature in China, and the technology of extracting and purifying expression products from plants needs to be improved. Nicotiana benthamiana is a commonly used plant bioreactor, mainly used for transient expression of exogenous proteins, with advantages such as high conversion efficiency and the ability to carry target genes with larger target fragments. Nicotiana benthamiana is also widely used in vaccine production, drug development and other fields. However, the biomass of Nicotiana benthamiana is also small and grows slowly, which limits the possibility of Nicotiana benthamiana as a biological reverser. Chinese patent CN115478076B discloses a method and application for improving the transient expression of exogenous proteins in cultivated tobacco Yun 87, which solves the shortcomings of Yun 87 tobacco being difficult to inject bacterial solution and low protein expression through preliminary treatment; Chinese patent CN116530385A discloses a method and application for improving the synthesis efficiency of exogenous products in Nicotiana benthamiana, by cultivating Nicotiana benthamiana seedlings in a lighting environment with a red light and far infrared ratio, improving the uniformity of chassis tobacco and the synthesis efficiency of heterologous products and the stability of output.

[0004] Proteases are ubiquitous in all organisms. Plant genomes encode hundreds of proteases, which are widely involved in the growth and development of plants, as well as in the response of plants to environmental or growth stimuli. Exogenous proteins, as foreign substances, are often targeted by plant proteases, resulting in partial or complete hydrolysis of the exogenous proteins, thereby reducing the expression of the exogenous proteins. At present, there is no method of using genetic engineering to knock out (knock down) the gene encoding protease in Nicotiana benthamiana, thereby increasing the expression of exogenous proteins in Nicotiana benthamiana.

[0005] Summary of the invention

[0006] The technical problem to be solved by the present invention is that exogenous proteins, as foreign substances, are often targeted by plant proteases, resulting in partial or complete hydrolysis of the exogenous proteins, thereby reducing the expression of the exogenous proteins. Currently, there is no method for knocking out (knocking down) the gene encoding the protease in Nicotiana benthamiana by genetic engineering means to increase the expression of exogenous proteins in Nicotiana benthamiana.

[0007] To solve the above problems, the present invention provides a method for increasing the expression amount of exogenous proteins in Nicotiana benthamiana. By designing transient silencing fragments of protease SBT1.9-1 and protease SBT1.9-2, a TRV2::SBT1.9 vector is constructed using homologous recombination technology, and the TRV2::SBT1.9 vector is injected into 2-week-old Nicotiana benthamiana leaves using Agrobacterium to construct plants. It is found that after transient silencing of protease SBT1.9-1 and protease SBT1.9-2, the expression amount of the exogenous target protein is significantly increased, thereby achieving the purpose of improving the Nicotiana benthamiana bioreactor, and having great application value in production.

[0008] To achieve the above objectives, the present invention is specifically implemented through the following technical scheme: a method for increasing the expression level of exogenous proteins in Nicotiana benthamiana, designing transient silencing fragments of protease SBT1.9-1 and protease SBT1.9-2, the sequences of which are shown in SEQ ID NO.1, constructing a TRV2::SBT1.9 vector using homologous recombination technology, and injecting the TRV2::SBT1.9 vector into 2-week-old Nicotiana benthamiana leaves using Agrobacterium to obtain plants with high expression of exogenous proteins.

[0009] SEQ ID NO.1:

[0010] AACCCATCATTGGACTTAAACTATCCATCCTTCATTGGCTTTTTCAATGGTAACAGCAGCGAGTCGGATCCTAAAAGGATTCAAGAATTTAAAAGAACAGTGACAAACTTACAAGATGGTACATCAATATATACAGCAAACTTCACTCC AATGGGTAAATTTAAAGTTAGTGTTGTACCTGAAAAGTTGGTTTTCAAAGAGAAGTATGAAAAGCTGAGCTACAAGCTTAGAATAGAAGGTCCAATAGTTATGGATGATAATGTGGTTTATGGTTCTTTGAGCTGGGTAGAAACTGGAG

[0011] Further, the primers used to construct the vector are as follows: SBT1.9 F:

[0012] AAGGTTACCGAATTCCAACCCATCATTGGA;SBT1.9 R:

[0013] GAGACGCGTGAGCTCCTCCAGTTTCTACCC.

[0014] A TRV2::SBT1.9 vector is constructed using homologous recombination technology.

[0015] Furthermore, the amino acid sequence of the knocked-out protease SBT1.9 of the present invention is shown in SEQ ID NO.2.

[0016] SEQ ID NO.2:

[0017] *

[0018] Furthermore, the nucleic acid sequence encoding the protease SBT1.9-1 in Nicotiana benthamiana is shown in SEQ ID NO.3.

[0019] SEQ ID NO.3:

[0020]

[0021] Furthermore, the nucleic acid sequence encoding the protease SBT1.9-2 in Nicotiana benthamiana is shown in SEQ ID NO.4.

[0022] SEQ ID NO.4:

[0023]

[0024] The present invention has the following beneficial effects:

[0025] The present invention is the first to discover that the SBT1.9 protease in Nicotiana benthamiana affects the expression of exogenous target proteins to a certain extent, and designs transient silencing fragments of protease SBT1.9-1 and protease SBT1.9-2, confirming that after transient silencing, the expression level of the exogenous target protein is significantly increased, achieving the purpose of improving the Nicotiana benthamiana bioreactor, and having great application value in production. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Green fluorescent protein images of TRV2::SBT1.9 and TRV2::GUS;

[0027] Figure 2 is the relative expression level of the targeted genes of TRV2::SBT1.9 and TRV2::GUS;

[0028] Figure 3 The graph shows the protein expression levels of TRV2::SBT1.9 and TRV2::GUS. DETAILED DESCRIPTION

[0029] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention is clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] Embodiment 1:

[0031] A method for increasing the expression of exogenous proteins in Nicotiana benthamiana, a transient silencing fragment of SBT1.9 is designed by VIGS TOOL, and a TRV2::SBT1.9 vector is constructed by homologous recombination technology. At the same time, a TRV2::GUS vector is constructed as a control. TRV2::SBT1.9 and TRV1 are co-injected into 2-week-old Nicotiana benthamiana leaves using Agrobacterium as a test treatment (T), and TRV2::GUS and TRV1 are co-injected as a control (CK). After 15 days, TRBO::GFP Agrobacterium is injected into T and CK respectively, and the leaves are photographed and sampled after 3 days.

[0032] Designing silence segments:

[0033] Design and transient silencing fragments: Based on the sequence of the target gene, fragments that can simultaneously silence SBT1.9-1 and SBT1.9-2 were designed using VIGS TOOL.

[0034] Through the VIGS TOOL ( https: / / vigs.solgenomics.net / ), the database selected was Nicotiana benthisiana v1.0.1, the N-MER size was set to 21, the fragment length was set to 300, and the misalignment was set to 0.

[0035] After entering the gene sequence of SBT1.9-1 into the sequence box and running the analysis, the target gene parameter was set to 2, and a 300bp sequence was obtained. Then the two target gene sequences were aligned with the sequences of SBT1.9-1 and SBT1.9-2 to confirm that the 300bp sequence designed by the website can target SBT1.9-1 and SBT1.9-2.

[0036] The 300bp fragment obtained is: AACCCATCATTGGACTTAAACTATCCATCCTTCATTGGCTTTTTC AATGGTAACAGCAGCGAGTCGGATCCTAAAAGGATTTAAAAGAACAGTGACAAACTTACAAGATGGTACATCAATATATACAGCAAACTTCACTCCAATGGGTAAATTTAAAGTTAGTGTTGTACCTGAAAAGTTGGTTTTCAAAGAGAAGTATGAAAAGCTGAGCTACAAGCTTAGAATAGAAGGTCCAATAGTTATGGATGATAATGTGGTTTATGGTTCTTTGAGCTGGGTAGAAACTGGAG

[0037] Preparation of DNA fragments required for vector construction:

[0038] The transient silencing fragments required for vector construction were obtained by PCR, and the restriction sites required for cloning at both ends were introduced by PCR primers. The primers used were as follows: SBT1.9 F: AAGGTTACCGAATTCCAACCCATCATTGGA; SBT1.9 R: GAGACGCGTGAGCTCCTCCAGTTTCTACCC.

[0039] The amplification of the transient silencing fragment of SBT1.9 was performed by PCR using the cDNA of Nicotiana benthamiana as a template and primers SBT1.9 F / SBT1.9R. PCR was performed using SupRealQ Ultra Hunter SYBR qPCR Master Mix (Q713-02, Nanjing Novozymes) reagent according to the instructions.

[0040] The TRV2 vector was double-digested using restriction sites EcoR1 and Sac1, and the transient silencing fragment was ligated to the TRV2 vector to construct the vector TRV2::SBT1.9.

[0041] After the vector TRV2::SBT1.9 was transformed into competent E. coli (E. coli DH5α), single clones were selected for colony PCR, and positive single clones were selected for testing. After comparison, colonies with correct sequences were selected to extract plasmids.

[0042] After the correct plasmid is transformed into Agrobacterium competent cells (GV3101), single clones are selected for colony PCR, and positive single clones are selected for testing. After comparison, colonies with correct sequences are selected for shaking.

[0043] Agrobacterium TRV2::SBT1.9 and Agrobacterium TRV1 were co-injected into 2-week-old Nicotiana benthamiana leaves at a ratio of 1:1. TRV2::GUS was used as the control, and TRBO::GFP Agrobacterium was injected 15 days later. The leaves were photographed 3 days later and samples were taken for further testing.

[0044] Detection of GFP green fluorescent protein expression:

[0045] RNA extraction: RNA extraction kit (CW0581M) was used to extract sample RNA according to the instructions of the kit.

[0046] cDNA preparation, using a reverse transcription kit (Novozyme, R333-01) to complete genome cleaning and reverse transcription of RNA, the method is operated according to the instructions in the kit

[0047] The samples were tested by qRT-qPCR, and the expression of genes was detected using a fluorescence quantitative kit (Novozyme, Q711-02). And compared with the control TRV2::GUS. Quantitative primers: Actin (F: CGGAATCCACGAGACTACAT AC; R: GGGAAGCCAAGATAGAGC); SBT1.9-1 (F: CGAATGCCAAGATGACAAGGA; R: TAAAGACAGCCCCAGCAACT); SBT1.9-2 (F: GGTCCTCTGCTTATTCCTGTTC; R: ACATTAGTCACCGTCCTCTGG). Methods: According to the instructions in the kit.

[0048] Prepare 10 ml of protein extraction solution: 500 μl of 1 M Tris HCl (pH: 8.0), 500 μl of 2.5 M Nacl (pH: 8.0), 200 μl of EDTA (pH: 8.0), 1 ml of glycerol, 200 μl of 100 mM PMSF, and 7.6 ml of ddH2O.

[0049] Extract the total protein of the sample, add the same volume of 10 protein extract solution after grinding the sample, place it on ice for 30 minutes, and shake the centrifuge tube up and down every 5 minutes. Set the centrifuge speed to 12000 rpm, temperature 4℃, time 10 minutes. After the protein sample is centrifuged, aspirate the supernatant. Add 5×SDS PAGE protein loading buffer (solarbioP1040) to the supernatant in proportion, and place it in a 95℃ metal bath for 10 minutes. Place the sample at -20℃ for later use.

[0050] A 12.5% ​​PAGE gel was prepared using a PAGE gel rapid preparation kit (Yazyme PG113) according to the instructions in the kit.

[0051] Use the prepared PAGE gel, and dot the samples in 12 into the PAGE gel wells in order. Pour Running Buffer (Yazyme PS120) into the electrophoresis pool, set the voltage to 180V, and set the time to 60min. Stain with Coomassie Brilliant Blue dye, decolorize with water, and observe the bands. Adjust to a consistent amount of protein loading.

[0052] According to the electrophoresis steps, the expression level of GFP green fluorescent protein was detected by Wesernt Blot technology.

[0053] result:

[0054] like Figure 1 As shown, the brightness of GFP green fluorescent protein on TRV2::SBT1.9 is higher than that of GFP green fluorescent protein on TRV2::GUS, which proves that the expression level of exogenous protein GFP green fluorescent protein can be increased after transient silencing of SBT1.9.

[0055] like Figure 2 As shown, compared with TRV2::GUS, the two genes targeted in TRV2::SBT1.9 were significantly down-regulated. It was demonstrated that the transient silencing vector TRV2::SBT1.9 can reduce the expression levels of the two targeted genes, protease SBT1.9-1 and protease SBT1.9-2.

[0056] like Figure 3As shown, the expression level of GFP protein in TRV2::SBT1.9 was significantly higher than that in TRV2::GUS, which proved that the expression level of exogenous protein GFP can be increased by transiently silencing the two genes encoding SBT1.9 protease.

[0057] In summary, SBT1.9 protease in N. benthamiana affects the expression of exogenous target protein to a certain extent. After transient silencing, the expression level of exogenous target protein increased significantly, achieving the purpose of further improving the N. benthamiana bioreactor.

[0058] Finally, it should be noted that although the above embodiments describe the specific implementation of the present invention, they are not intended to limit the present invention; those skilled in the art should understand that these are only examples, and the scope of protection of the present invention is defined by the appended claims. All modifications or equivalent substitutions should be included in the scope of protection of the present invention. The raw materials in the above embodiments, unless otherwise specified, are commercially available.

Claims

1. A method for increasing the expression of exogenous proteins in Nicotiana benthamiana, characterized in that: Protease SBT1.9-1 and protease SBT1.9-2 transient silencing fragments were designed, and their sequences were shown in SEQ ID NO.

1. TRV2::SBT1.9 vectors were constructed using homologous recombination technology, and the TRV2::SBT1.9 vectors were injected into 2-week-old Nicotiana benthamiana leaves using Agrobacterium to obtain plants with high expression of exogenous proteins.

2. The method according to claim 1, characterized in that: The primers used to construct the vector are as follows: SBT1.9 F: AAGGTTACCGAATTCCAACCCATCATTGGA;SBT1.9 R: GAGACGCGTGAGCTCCTCCAGTTTCTACCC.

3. The method according to claim 1, characterized in that: The amino acid sequence of the knocked-out protease SBT1.9 is shown in SEQ ID NO.

2.

4. The method according to claim 1, characterized in that: The nucleic acid sequence encoding protease SBT1.9-1 is shown in SEQ ID NO.

3.

5. The method according to claim 1, characterized in that: The nucleic acid sequence encoding protease SBT1.9-2 is shown in SEQ ID NO.

4.

6. A TRV2::SBT1.9 vector as claimed in claim 1.

7. Use of the vector according to claim 6 in preparing Nicotiana benthamiana with high exogenous protein expression.

Images