Construction method and application of Trem2 gene overexpressed and knocked-out BV2 cell line

Abstract

The invention discloses a construction method and application of a Trem2 gene overexpressed and knocked-out BV2 cell line, firstly, the Trem2 gene overexpressed BV2 cell line is constructed based on a transposon system, and the specific method comprises the following steps: (1) constructing a vector; (2) cell transfection; (3) stably transfected cell strain amplification; and (4) verifying a stably transfected cell strain, and finally successfully constructing the Trem2 gene overexpressed BV2 cell line. Secondly, constructing a Trem2 gene knockout BV2 cell line based on a CRISPR / Cas9 gene editing technology, wherein the specific method comprises the following steps: (1) designing a target spot and constructing a carrier; (2) cell transfection; (3) monoclonal screening; and (4) verifying the knockout cell line, and finally successfully constructing the Trem2 gene knockout BV2 cell line. The established Trem2 gene overexpressed and knocked-out BV2 cell line provides a favorable tool for treating central nervous system diseases by targeting Trem2.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to a method and application of constructing a BV2 cell line for overexpressing the Trem2 gene by using a transposon system and knocking out the Trem2 gene based on CRISPR / Cas9 gene editing technology. Background Art

[0002] With the completion of the human genome sequence, marking the completion of the Human Genome Project, biomedicine has also entered the post-genomic era, that is, the era of functional genomics. In-depth research on gene function has laid a solid foundation for revealing the occurrence and development mechanism of about 27,000 coding genes in the human genome in diseases, the mechanism of drug action, and the diagnosis and treatment strategies of diseases. At present, the elucidation and confirmation of gene function is mainly carried out through multi-level and multi-faceted research at the molecular, cellular and individual levels through the two strategies of gain of function and loss of function. Its commonly used research methods include gene chips, gene transduction, gene knockout, genome editing and RNA interference.

[0003] Triggering receptors expressed on myeloid cells (TREMs) are a family of cell surface receptors widely expressed in myeloid cells, mainly in granulocytes, monocytes and tissue macrophages, as well as macrophage and dendritic cell lines, and are closely related to inflammation, neurodegenerative diseases, bone remodeling, metabolic syndrome, atherosclerosis and cancer. As one of its main members, Trem2 is mainly expressed in microglia in the central nervous system. It not only participates in the regulation of neuroinflammation and lipid metabolism, but also participates in the regulation of dynamic changes in synapses through a variety of molecular mechanisms. In recent years, the Trem2 gene has been found to be a common risk gene for a variety of neurodegenerative diseases, significantly increasing the risk of Alzheimer's disease, Parkinson's disease, frontotemporal dementia, amyotrophic lateral sclerosis and Nasu-Hakola disease, and has become a pathologically induced immune signal hub and has attracted much attention.

[0004] Based on the function of Trem2 as a pathological signal hub and its key regulatory role in tissue damage under pathological conditions, many intervention measures use Trem2 signals as potential therapeutic targets. Targeting Trem2 has shown good therapeutic prospects in diseases such as Alzheimer's disease (vanLengerichB, et al. Nature neuroscience, 2023), malignant glioma (SunR, et al. Science advances, 2023), lung cancer (ParkMD, et al. Nature immunology, 2023) and atherosclerosis (PattersonMT, et al. Nature cardiovascular research, 2023). Therefore, the BV2 cell line overexpressing and knocking out the Trem2 gene constructed by the present invention can further clarify the mechanism of action of the Trem2 gene in microglia, and provide a favorable tool for targeting Trem2 to treat central nervous system diseases. There is currently no relevant report in this regard. Summary of the invention

[0005] The object of the present invention is to provide a method for constructing a BV2 cell line with overexpression and knockout of the Trem2 gene. The BV2 cell line with overexpression and knockout of the Trem2 gene constructed by the method can be used as a tool for studying the function of the Trem2 gene in microglia and as a research tool for treating central nervous system diseases with Trem2 as a target.

[0006] In order to achieve the above-mentioned purpose, the first aspect of the present invention is to provide a method for constructing a BV2 cell line based on a transposon system to overexpress the Trem2 gene (NCBI Gene: 83433), the specific process of which is: constructing a Trem2 gene overexpression vector and performing a large amount of cell transfection-grade low-endotoxin nucleic acid extraction, then electroporating the constructed vector into the BV2 cell line, and obtaining a stable cell line overexpressing the Trem2 gene, i.e., a BV2 cell line overexpressing the Trem2 gene, through resistance screening.

[0007] Furthermore, the Trem2 gene overexpression vector is pPB[Exp]-Puro-EF1A>mTrem2[NM_031254.3](ns) / FLAG:T2A:EGFP, and the cell transfection method adopts electroporation operation.

[0008] Furthermore, the specific steps for constructing the BV2 cell line overexpressing the Trem2 gene are as follows:

[0009] (1) Constructing a Trem2 gene overexpression vector and extracting a large amount of low-endotoxin nucleic acid at the cell transfection level;

[0010] (2) Take BV2 cells in good condition and in logarithmic phase growth, digest them, centrifuge and discard the supernatant to obtain BV2 cell pellets; resuspend the BV2 cells with electroporation buffer and add the plasmid of Trem2 gene overexpression vector to mix thoroughly; electroporate the above mixture using Neon transfection system, and electroporate the EGFP control group under the same parameters; culture the electroporated BV2 cells for 48 hours, and select them with puromycin; replace with fresh culture medium after screening, and continue culturing for 24 to 48 hours to restore the cell state;

[0011] (3) Using a culture medium containing puromycin to continue to expand the culture of the Trem2 gene overexpression stable cell line;

[0012] (4) The total RNA of the Trem2 gene overexpressing stable cell line was extracted for qPCR detection to analyze the expression changes of the Trem2 gene at the mRNA level; then the total protein of the Trem2 gene overexpressing stable cell line was extracted for Western blot detection to analyze the expression changes of the TREM2 protein at the protein level.

[0013] The second aspect of the present invention is to provide a method for constructing a BV2 cell line for knocking out the Trem2 gene based on CRISPR / Cas9 gene editing technology, the specific process of which is: designing and synthesizing a sgRNA sequence targeting the Trem2 gene, incubating the synthesized sgRNA and Cas9 protein to form an RNP complex, using a Neon transfection system for electroporation, then screening monoclonal growing cells, and obtaining a BV2 cell line with Trem2 gene knockout after identification, wherein the sgRNA sequence targeting the Trem2 gene includes sgRNA1 and sgRNA2:

[0014] sgRNA1: ACACCCTGGCTACAGCGTCAGGG;

[0015] sgRNA2: CAGCCAATGGCAGTAGAACGGGG.

[0016] Furthermore, the specific steps for constructing the Trem2 gene knockout BV2 cell line are as follows:

[0017] (1) Using Trem2-202 as the transcript, we designed one target site each upstream and downstream of exon1 and exon5, and synthesized sgRNA and Cas9 protein targeting the Trem2 gene;

[0018] (2) Take BV2 cells in good condition and in logarithmic phase growth, digest them, centrifuge and discard the supernatant to obtain BV2 cell pellets; incubate sgRNA and Cas9 protein to combine into RNP complex, and resuspend BV2 cells as suspension; use Neon transfection system to electroporate the above mixture, and electroporate EGFP control group under the same parameters; place the electroporated BV2 cells in a CO2 incubator for culture;

[0019] (3) digesting and counting the electroporated BV2 cells, inoculating single clones, and screening the BV2 cell lines with Trem2 gene knockout that have grown monoclonally;

[0020] (4) DNA of the Trem2 gene knockout BV2 cell line was extracted for PCR detection to analyze the target site and knockout band of sgRNA; then the DNA of the cell line with successful initial knockout was sequenced to analyze the knockout sequence; finally, the total protein of the Trem2 gene knockout BV2 cell line was extracted for Western blot detection to analyze the expression changes of TREM2 protein at the protein level.

[0021] The invention relates to the use of the Trem2 gene overexpressing BV2 cell line or / and the Trem2 gene knocking-out BV2 cell line in the preparation of a tool for studying the function of the Trem2 gene in microglia or a tool for treating central nervous system diseases using Trem2 as a target.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) The present invention utilizes a transposon system to construct a stable cell line. The transposon system is a Virus-Free system that can replace lentiviral infection to construct a stable cell line without increasing the safety level, and has the characteristics of low cost, high efficiency, and stable gene expression. (2) The present invention utilizes CRISPR / Cas9 gene editing technology to construct a knockout cell line. CRISPR / Cas9 gene editing technology is currently the most widely used gene editing technology, which has the characteristics of simple preparation, low cost, and high efficiency. (3) qPCR and Western blot results showed that the Trem2 gene was overexpressed, and PCR, sequencing, and Western blot results showed that the TREM2 protein was almost not expressed. The BV2 cell line with overexpression of the Trem2 gene and the BV2 cell line with knockout of the Trem2 gene were successfully constructed. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The results show the identification of the BV2 cell line overexpressing the Trem2 gene. Figure 1 A in the middle is the Trem2 gene overexpression vector information, Figure 1 Middle B is qPCR detection of the expression changes of Trem2 gene at the mRNA level. Figure 1Middle C is Western blot detection of the expression changes of TREM2 protein at the protein level. Figure 1 D is Figure 1 Quantitative analysis results of C. NC, empty control group; Trem2-OE, Trem2 gene overexpression group; **, P<0.01; ***, P<0.001.

[0024] Figure 2 Strategy for knocking out the Trem2 gene using CRISPR / Cas9 gene editing technology. Figure 2 A in the middle is the location and sequence of the sgRNA targeting the Trem2 gene and the sequencing results. Figure 2 Middle B is the knockout band of Trem2 gene knockout cell line detected by PCR. Figure 2 Middle C is Western blot detection of TREM2 protein expression changes at the protein level. Figure 2 D is Figure 2 Quantitative analysis results of C. sgNT, wild-type BV2 cell group; sgTrem2, Trem2 gene knockout group; WT, wild-type identification primer; KO, knockout identification primer; Marker, DNA molecular weight standard; *, P<0.05.

[0025] Figure 3 This is the effect of Trem2 gene on cholesterol in microglia. Figure 3 A in the middle shows the changes of cholesterol in NC, Trem2-OE, sgNT and sgTrem2 cells detected by Filipin staining. The scale bar is 20 μm. Figure 3 B is Figure 3 Quantitative analysis results of A. NC, empty control group; Trem2-OE, Trem2 gene overexpression group; sgNT, wild-type BV2 cell group; sgTrem2, Trem2 gene knockout group; *, P<0.05; ***, P<0.001. DETAILED DESCRIPTION

[0026] The above contents of the present invention are further described in detail below through examples, but this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples, and all technologies implemented based on the above contents of the present invention belong to the scope of the present invention.

[0027] Example 1

[0028] This example is used to illustrate the construction of a BV2 cell line overexpressing the Trem2 gene, and specifically includes the following steps:

[0029] 1. Vector Construction

[0030] Based on the transposon-based Virus-Free system, the Trem2 gene overexpression vector pPB[Exp]-Puro-EF1A>mTrem2[NM_031254.3](ns) / FLAG:T2A:EGFP was constructed, carrying FLAG, EGFP and Puro, and a large amount of transfection-grade low-endotoxin nucleic acid was extracted.

[0031] 2. Cell Transfection

[0032] (1) Cell transfection was performed using the Neon electroporation system (MPK5000, ThermoFisher Scientific) according to the instructions on the official website;

[0033] (2) Take BV2 cells in good condition and in logarithmic phase, digest them, centrifuge them and discard the supernatant. Resuspend them in PBS solution and count them. Take 1×10 6 Transfer cells to a centrifuge tube and centrifuge again to obtain a cell pellet;

[0034] (3) Resuspend the cells using 10 μL of the resuspension buffer in the Neon transfection system kit (MPK1096, ThermoFisher Scientific), add the plasmid and mix thoroughly to resuspend, then transfer to an electroporation cuvette;

[0035] (4) Input electroporation parameters: voltage 1200 V, pulse width 20 ms, number of electric shocks 3, electroporate the above mixture, and electroporate the EGFP control group under the same parameters;

[0036] (5) After electroporation, transfer each group of cells to the corresponding culture vessels and culture them in a CO2 incubator. Observe the cell status after 24 hours and judge the electroporation efficiency based on the situation of the EGFP control group;

[0037] (6) After 48 hours of cell culture, puromycin is used to perform drug screening on the electroporated target cells. After the drug screening cycle is completed, the puromycin-containing culture medium is replaced with fresh culture medium and cultured for 24 to 48 hours to restore the cell state.

[0038] 3. Expansion of Stable Cell Lines

[0039] The Trem2 gene overexpression stable cell line was expanded and cultured using a puromycin-containing culture medium, and then frozen and verified after passing the mycoplasma test.

[0040] 4. Verification of Stable Cell Lines

[0041] (1) qPCR validation

[0042] The total RNA of the Trem2 gene overexpression stable cell line and the control cell line was extracted using a single column total RNA extraction kit (RC113-01, Vazyme), and then the total RNA was reverse transcribed into cDNA using the FastKing one-step genomic cDNA first-strand synthesis premix (KR118, TIANGEN). Finally, the blue universal dye method qPCR detection kit (Q321-02, Vazyme) was used for qPCR detection. The specific qPCR primers are shown in Table 1. The qPCR results showed that compared with the control cell line, the expression of the Trem2 gene in the Trem2 gene overexpression stable cell line was significantly increased by 21.36 times ( Figure 1 Middle B), it was preliminarily judged that the Trem2 gene overexpression stable transfection cell line was successfully constructed.

[0043] Table 1 qPCR primer sequences

[0044]

[0045] (2) Western blot identification

[0046] Protease inhibitor cocktail (CW2200, CWBIO) and phosphatase inhibitor cocktail (CW2383, CWBIO) were added to RIPA lysis buffer (CW2333, CWBIO) in advance, and then the total protein of the Trem2 gene overexpression stable cell line and the control cell line was extracted using RIPA lysis buffer. Western blot results showed that compared with the control cell line, the expression of TREM2 protein in the Trem2 gene overexpression stable cell line was significantly increased by about 6 times ( Figure 1 Middle C and Figure 1 Middle D), finally confirmed that the stable cell line overexpressing Trem2 gene was successfully constructed.

[0047] Example 2

[0048] This example is used to illustrate the construction of a Trem2 gene knockout BV2 cell line, which specifically includes the following steps:

[0049] 1. Target design and vector construction

[0050] The CDS region of the mouse Trem2 gene (NCBI: 83433) was searched in NCBI, the corresponding genomic structure was analyzed, and the exon part of the CDS was identified; Trem2-202 was used as the transcript, and the candidate exons to be knocked out were selected to determine the sites to be knocked out; one target site was designed upstream and downstream of exon1 and exon5 of the Trem2 gene through the online sgRNA design website CRISPOR (http: / / crispor.tefor.net / ), and the sgRNA sequences were: sgRNA1, ACA CCCTGGCTACAGCGTCAGGG; sgRNA2: CAGCCAATGGCAGTAGAACGGGG; finally, sgRNA materials and Cas9 proteins were synthesized according to the design plan.

[0051] 2. Cell Transfection

[0052] (1) Cell transfection was performed using the Neon electroporation system (MPK5000, ThermoFisher Scientific) according to the instructions on the official website;

[0053] (2) Take BV2 cells in good condition and in logarithmic phase, digest them, centrifuge them and discard the supernatant. Resuspend them in PBS solution and count them. Take 1×10 6 Transfer cells to a centrifuge tube and centrifuge again to obtain a cell pellet;

[0054] (3) Use the resuspension buffer in the Neon transfection system 10 μL kit (MPK1096, ThermoFisher Scientific) to incubate the sgRNA and Cas9 protein into an RNP complex, resuspend the cells as a suspension, and then transfer them to an electroporation cup;

[0055] (4) Input electroporation parameters: voltage 1680 V, pulse width 20 ms, number of electric shocks 1, electroporate the above mixture, and electroporate the EGFP control group under the same parameters;

[0056] (5) After electroporation, transfer each group of cells to the corresponding culture vessels and culture them in a CO2 incubator. Observe the cell status after 24 hours and judge the electroporation efficiency based on the situation of the EGFP control group.

[0057] 3. Monoclonal screening

[0058] Digest cell counts and inoculate single clones; observe clone growth status and replenish fluid in time; wait for single clones to grow to a sufficient number, back up and perform PCR identification.

[0059] 4. Knockout Cell Line Validation

[0060] (1) PCR identification

[0061] The genomic DNA of the Trem2 knockout cell line was extracted using a universal column-based genomic extraction kit (CW2298, CWBIO), and then PCR amplification was performed using a high-fidelity enzyme premix (CW2965, CWBIO), as shown in Tables 2 and 3. The PCR reaction conditions for Region 1 and Region 2 were: 95°C, 5 min; 95°C, 30 s; 60°C, 30 s; 72°C, 1 min; 35 cycles; 72°C, 10 min. The PCR reaction conditions for Region 3 were: 95°C, 5 min; 95°C, 30 s; 60°C, 30 s; 72°C, 7 min; 35 cycles; 72°C, 10 min. Agarose gel electrophoresis showed the PCR identification results, and the specific bands were: Region 1 (sgNT, 590 bp; sgTrem2, 0 bp), Region 2 (sgNT, 747 bp; sgTrem2, 0 bp), Region 3 (sgNT, 6890 bp; sgTrem2, ~711 bp) ( Figure 2 Middle B), it was preliminarily judged that the BV2 cell line with Trem2 gene knockout was successfully constructed.

[0062] Table 2 PCR primer sequences for identification of Trem2 gene knockout BV2 cell line

[0063]

[0064] Table 3 PCR reaction system

[0065]

[0066] (2) Sequencing and identification

[0067] The PCR product was sent to GeneWeiZ for sequencing verification. After comparison, the sequencing results confirmed that the Trem2 gene was knocked out by 6299 bp ( Figure 2 Middle A), specifically GGAACTCTGGCACTGGTCTGCATCCATACCTG-del 6299bp-CTGCCATTGGCTGTTGGGCTTTAGGGAAGTGCTGAGACA, further confirming that a large-fragment knockout of the Trem2 gene at the genomic level resulted in loss of gene function.

[0068] (3) Western blot identification

[0069] Western blot results showed that compared with wild-type BV2 cells (sgNT), TREM2 protein was almost not expressed in the BV2 cell line with Trem2 gene knockout (sgTrem2). Figure 2 Middle C and Figure 2 Middle D), finally confirmed that the BV2 cell line with Trem2 gene knockout was successfully constructed.

[0070] Example 3

[0071] This example is used to illustrate the effect of Trem2 gene on cholesterol in microglia

[0072] According to 1×10 5 NC, Trem2-OE, sgNT and sgTrem2 cells were seeded in 24-well plates containing cell slides at a density of 10 cells / well, respectively, and placed in a CO2 incubator for 12 hours before Filipin staining (100 μg / mL, SAE0088, Sigma-Aldrich) to analyze the effects of overexpression and knockout of Trem2 on cholesterol in microglia. Filipin staining results showed that compared with NC cells, cholesterol in Trem2-OE cells was significantly reduced. Compared with sgNT cells, cholesterol in sgTrem2 cells was significantly stored, indicating that the Trem2 gene can regulate the changes in cholesterol in microglia.

[0073] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. A person skilled in the art should understand that any modification, equivalent substitution or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. Overexpression based on transposon system Trem2 A method for constructing a BV2 cell line containing a gene, characterized in that The specific process is: build Trem2 Gene overexpression vector and cell transfection-grade low-endotoxin nucleic acid extraction, then the constructed vector was electroporated into BV2 cell line, and obtained after resistance screening. Trem2 Stable cell lines with gene overexpression Trem2 Gene overexpression in BV2 cell line.

2. Overexpression based on the transposon system according to claim 1 Trem2 A method for constructing a BV2 cell line containing a gene, characterized in that: Said Trem2 The gene overexpression vector is pPB[Exp]-Puro-EF1A> mTrem2 [NM_031254.3](ns) / FLAG:T2A:EGFP, cell transfection was performed by electroporation.

3. The overexpression based on the transposon system according to claim 1 Trem2 A method for constructing a BV2 cell line containing a gene, characterized in that The specific construction steps are: (1) Construction Trem2 Gene overexpression vector and large-scale extraction of cell transfection-grade low-endotoxin nucleic acid; (2) Take BV2 cells in good condition and in logarithmic phase growth, digest them, centrifuge and discard the supernatant to obtain BV2 cell pellet; resuspend the BV2 cells in electroporation buffer and add Trem2 The plasmid of the gene overexpression vector was fully mixed; the mixture was electroporated using the Neon transfection system, and the EGFP control group was electroporated under the same parameters; the electroporated BV2 cells were cultured for 48 hours and then screened with puromycin; after screening, the culture medium was replaced with fresh medium and cultured for 24 to 48 hours to restore the cell state; (3) Continue to expand the culture using culture medium containing puromycin Trem2 Gene overexpression stable cell lines; (4) Extraction Trem2 The total RNA of gene overexpression stable cell lines was detected by qPCR and analyzed Trem2 The expression changes of genes at the mRNA level; then extract Trem2 Western blot was used to detect the total protein of the gene overexpression stable cell line to analyze the expression changes of TREM2 protein at the protein level.

4. Knockout based on CRISPR / Cas9 gene editing technology Trem2 A method for constructing a BV2 cell line containing a gene, characterized in that The specific process is: designing and synthesizing targeted Trem2 The sgRNA sequence of the gene was synthesized, and the synthesized sgRNA and Cas9 protein were incubated to form an RNP complex, and the Neon transfection system was used for electroporation, and then the cells with monoclonal growth were screened and identified. Trem2 The gene knockout BV2 cell line, the target Trem2 The sgRNA sequences of the gene include sgRNA1 and sgRNA2: sgRNA1: ACACCCTGGCTACAGCGTCAGGG; sgRNA2: CAGCCAATGGCAGTAGAACGGGG.

5. The knockout based on CRISPR / Cas9 gene editing technology according to claim 4 Trem2 A method for constructing a BV2 cell line containing a gene, characterized in that The specific construction steps are: (1) Trem2 -202 is a transcript, and one target site is designed upstream and downstream of exon1 and exon5. Trem2 sgRNA and Cas9 protein of the gene; (2) Take BV2 cells in good condition and in logarithmic phase growth, digest them, centrifuge and discard the supernatant to obtain BV2 cell pellet; The sgRNA and Cas9 protein were incubated to form an RNP complex, and the BV2 cells were resuspended as a suspension; the mixture was electroporated using the Neon transfection system, and the EGFP control group was electroporated under the same parameters; the electroporated BV2 cells were placed in a CO2 incubator for culture; (3) Digest and count the electroporated BV2 cells, inoculate single clones, and screen for single clone growth. Trem2 Knockout BV2 cell line; (4) Extraction Trem2 The DNA of the gene knockout BV2 cell line was tested by PCR to analyze the target site and knockout band of sgRNA; then the DNA of the cell line with successful initial knockout was sequenced to analyze the knockout sequence; finally, the Trem2 The total protein of the gene knockout BV2 cell line was detected by Western blot to analyze the expression changes of TREM2 protein at the protein level.

6. A method constructed according to any one of claims 1 to 3 Trem2 Gene overexpression BV2 cell line or / and constructed according to the method described in any one of claims 4 to 5 Trem2 Gene knockout BV2 cell line in the preparation of microglia Trem2 Gene function research tools or Trem2 Application as a research tool for the treatment of central nervous system diseases.

Images