Electrochemical aptamer sensor for sex hormone estradiol detection and preparation and application thereof

Abstract

The invention discloses preparation and application of an electrochemical aptamer sensor for sex hormone estradiol detection, and belongs to the technical field of electrochemical biosensors. According to the sensor, sulfydryl polyethylene glycol and a capture chain are co-assembled on a gold electrode, so that the stability and pollution resistance of the electrode are remarkably enhanced. By means of specific binding and strand displacement reaction between the estradiol aptamer and the signal strand, accurate detection of estradiol without signal amplification is achieved. Electrochemical signals are collected by adopting differential pulse voltammetry, the detection range of the sensor is wide (7.5 pM to 100 nM), the detection limit is low (7.5 pM), the accuracy and reliability of detection are ensured, and good reproducibility is achieved. The preparation method of the sensor is simple, convenient and rapid, has high cost effectiveness, and is easy to realize large-scale production and application. In the fields of medical diagnosis, environmental monitoring, food safety and the like, the electrochemical aptamer sensor is rapid and accurate in detection, short in time consumption, suitable for rapid diagnosis and high-throughput screening and wide in application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of electrochemical biosensors, and in particular relates to the preparation and application of an electrochemical aptamer sensor for detecting sex hormone estradiol. Background Art

[0002] Estradiol (E2) is one of the main estrogens secreted by the ovaries. It is mainly produced by the ovaries and plays an important role in the female reproductive cycle. By detecting serum E2 levels, gynecological diseases such as polycystic ovary syndrome and dysfunctional uterine bleeding can be assisted in the diagnosis. In early pregnancy, the dynamic changes in serum E2 levels help monitor and evaluate the status of embryonic development. Therefore, accurate E2 detection is crucial for the comprehensive assessment of female reproductive health. However, the physiologically relevant serum E2 concentration of women can span nearly four orders of magnitude. For example, exogenous estrogen intake can cause a significant increase in female E2 levels to around 10,000 pM, while E2 levels can be reduced to less than 18 pM after aromatase inhibitor treatment. At present, the methods for detecting serum estradiol mainly include chemiluminescent immunoassay, high-performance liquid chromatography, and colorimetry. Although these methods have their own advantages, they all have certain limitations. For example, high-throughput automated immunoassays meet the clinical needs for E2 quantification, but the dynamic range of its commercial kit only spans 2 orders of magnitude, and it is impossible to accurately evaluate high-value serum samples. Samples need to be diluted twice for determination, but this significantly increases the cost of the test. High performance liquid chromatography is the gold standard for detecting serum E2. It can detect changes in E2 content efficiently and accurately, but its sensitivity is difficult to meet the demand. The colorimetric method for detecting serum E2 has the advantages of a wide dynamic range and fast analysis speed, but it is easily interfered by complex serum samples and has low specificity. Therefore, it is urgent to develop a new method for detecting serum E2 content with high sensitivity, strong specificity and a wide dynamic range, which has important clinical significance.

[0003] Electrochemical aptamer sensors are biosensor systems that convert the signals generated during the specific recognition of nucleic acid molecules into electrical signals, thereby achieving quantitative detection of target molecules. Due to its advantages such as simplicity, strong specificity and low cost, it has been widely used in clinical pathological diagnosis, environmental testing, drug analysis and other fields. In recent years, many electrochemical aptamer biosensors for E2 detection have been developed. These sensors convert the signals generated during the specific recognition of nucleic acid molecules into electrical signals to achieve quantitative detection of target molecules. Although electrochemical aptamer sensors have shown great potential in E2 detection, they still face some technical challenges. First, since the concentration of E2 in biological fluids such as blood is extremely low, usually at the picomolar level or even lower, it is necessary to combine signal amplification methods to improve sensitivity. At present, although some signal amplification strategies have been proposed, how to achieve high-sensitivity detection while maintaining specificity is still an urgent problem to be solved. Secondly, the complexity of blood samples poses a challenge to the specificity of sensors. Blood contains a large amount of proteins, ions and other biological molecules, which may interfere with the specific recognition of sensors, resulting in false positives or false negatives. Therefore, how to improve the specificity of the sensor so that it can accurately identify E2 molecules in complex blood samples is another key issue that needs to be addressed. Summary of the invention

[0004] In view of the problems that traditional electrochemical aptamer sensors are insufficiently sensitive and easily interfered by complex serum environments when detecting estradiol (E2) in serum, the present invention aims to provide a preparation and application of an electrochemical aptamer sensor for detecting the sex hormone estradiol. A non-amplification electrochemical aptamer sensor is constructed by utilizing a biorecognition interface co-assembled with thiol polyethylene glycol (HS-PEG) and a capture chain for the high-sensitivity and high-specificity determination of E2 in serum.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] The invention provides an electrochemical aptamer sensor for detecting sex hormone estradiol. The sensor adopts a three-electrode system, including a working electrode, a reference electrode and an auxiliary electrode. An estradiol aptamer is used as a recognition element. The working electrode is a gold electrode surface on which thiol polyethylene glycol and a capture chain are co-assembled. When detecting a sample to be tested containing estradiol, a complex formed by the estradiol aptamer and a signal chain is mixed with the sample to be tested. Estradiol combines with the estradiol aptamer to release the signal chain. The released signal chain hybridizes with the capture chain to form a DNA double-stranded structure. An electroactive label is introduced to combine with the DNA double-stranded structure. The electrochemical signal is measured by an electrochemical workstation to achieve the detection of sex hormone estradiol.

[0007] The capture chain sequence is shown in SEQ ID NO.1; the signal chain sequence is shown in SEQ ID NO.2; and the estradiol aptamer sequence is shown in SEQ ID NO.3.

[0008] Furthermore, the capture chain sequence is 5′-HS-GCTTCCAGCTTATTGAATTACACGC; the signal chain sequence is GCGTGTAATTCAATAAGCTGGAAGC, and the estradiol aptamer sequence is GCTTCCAGCTTATTGAATTACACGCAGAGGGTAGCGGCTCTGCGCATTCAA TTGCTGCGCGCTGAAGCGCGGAAGC.

[0009] The present invention provides a method for preparing the electrochemical aptamer sensor for detecting the sex hormone estradiol, comprising:

[0010] S1, preparation of reduced thiolated capture chain;

[0011] S2, dropping the reduced thiolated capture chain onto the surface of the gold electrode, freezing, thawing, washing, and sealing to obtain a working electrode co-assembled with thiolated polyethylene glycol and the capture chain;

[0012] S3, assembling the working electrode, reference electrode and auxiliary electrode of the co-assembled thiol polyethylene glycol and the capture chain to obtain an electrochemical aptamer sensor for the detection of the sex hormone estradiol.

[0013] In S1, the preparation of the reduced thiolated capture chain comprises: mixing a reducing agent tri(2-carboxyethyl)phosphine and the capture chain in a volume ratio of 2:3, and leaving the mixture to stand at room temperature in the dark for 1-2 hours.

[0014] Furthermore, the concentration of tris(2-carboxyethyl)phosphine is 100 mM, the concentration of the capture chain is 100 μM, and the solvent is a Tris-HCl buffer with a molar concentration of 20 mM and a pH of 7.4.

[0015] In S2, the freezing temperature is -20°C, and the freezing is for 10 to 20 minutes; the blocking agent used in the blocking is a Tris-HCl buffer containing thiol polyethylene glycol with a mass volume concentration of 1 mg / mL, and the blocking is incubated at room temperature for 2 to 3 hours.

[0016] Furthermore, the molar concentration of the reduced thiolated capture chain is 0.1-5 μM, and the volume ratio of the reduced thiolated capture chain to the blocking agent is 1:1.

[0017] Furthermore, the molecular weight of the thiol polyethylene glycol is 10000, and the molar concentration of the Tris-HCl buffer is 10 mM.

[0018] The present invention provides application of the electrochemical aptamer sensor in detecting the sex hormone estradiol.

[0019] The present invention provides a method for detecting the sex hormone estradiol based on the above-mentioned electrochemical aptamer sensor, comprising:

[0020] (1) at room temperature, mixing and hybridizing the estradiol aptamer solution and the signal chain solution to obtain a complex stock solution;

[0021] (2) adding the heparin-treated sample containing the sex hormone estradiol to be tested to the original solution of the complex in step (1), incubating in the dark, and obtaining a treated sample to be tested;

[0022] (3) placing the working electrode in the sample to be tested after being treated in step (2) for reaction, washing, and soaking in a buffer solution containing an electroactive label; placing the working electrode, the counter electrode, and the reference electrode in the buffer solution, using differential pulse voltammetry to collect the electrical signal of the working electrode, and drawing a standard curve based on the electrical signal difference versus the sex hormone estradiol concentration to achieve quantitative detection of the sex hormone estradiol.

[0023] In step (1), the molar ratio of the estradiol aptamer to the signal chain is 1 to 3:1, and the hybridization time is 1 to 2 hours.

[0024] Furthermore, the buffer solution contains Tris-HCl with a molar concentration of 10 mM, NaCl with a molar concentration of 200 mM, MgCl2 with a molar concentration of 10 mM and KCl with a molar concentration of 25 mM, the solvent is 5% ethanol by volume, and the pH is 8.0.

[0025] Furthermore, the molar ratio of the signal chain to the estradiol aptamer is 1:1, and the hybridization time is 1 hour.

[0026] In step (2), the volume ratio of heparin to the sample to be tested is 1:1-2, and the heparin concentration is 125 IU / mL; the volume ratio of the sample to be tested to the complex stock solution is 1:1, the light-proof incubation temperature is 50-70°C, and the time is 3-5 hours.

[0027] Furthermore, the molar concentration of the complex stock solution is 2 to 20 nM.

[0028] Furthermore, the molar concentration of the complex stock solution is 10 nM.

[0029] Furthermore, the light-proof incubation temperature is 60° C. and the time is 4 hours.

[0030] In step (3), the reaction is incubated at room temperature for 80 to 100 minutes, the buffer containing the electroactive label is a phosphate buffer containing methylene blue, the immersion time is 20 to 40 minutes, and the concentration of the sample to be tested is 7.5×10 -12 ~100000×10 - 12 M.

[0031] Furthermore, the room temperature incubation time is 90 minutes, the immersion time is 30 minutes, and the molar concentration of the phosphate buffer containing methylene blue is 40-60 μM.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] The electrochemical aptamer sensor for detecting the sex hormone estradiol provided by the present invention adopts a gold electrode as a substrate for the working electrode, and co-assembles thiol polyethylene glycol and a capture chain, which not only improves the stability of the electrode, but also reduces nonspecific adsorption and improves the repeatability of the measurement; the specific binding between the estradiol aptamer and estradiol is utilized to ensure that the sensor can accurately identify and respond to target molecules in complex biological samples, thereby achieving high-sensitivity detection of estradiol; the hybridization of the signal chain and the capture chain and the introduction of the electroactive label further enhance the intensity of the detection signal, so that the sensor can accurately detect the presence of estradiol at low concentrations, and can detect the estradiol concentration range from 7.5 pM to 100 nM, covering a wide range from low concentration to high concentration, and has broad application prospects in multiple fields such as clinical diagnosis, environmental monitoring and food safety.

[0034] The preparation method of the electrochemical aptamer sensor for detecting the sex hormone estradiol provided by the present invention has a relatively simple preparation process, does not require complicated equipment and operations, has low preparation cost, high preparation efficiency, and is conducive to large-scale production and application. The working electrode uses a gold electrode as a substrate, and is modified by co-assembling thiol polyethylene glycol and a capture chain. The gold electrode has good conductivity and chemical stability, and the introduction of thiol polyethylene glycol improves the anti-pollution ability and biocompatibility of the electrode surface, enhances the stability of the electrode, and thus improves the reproducibility and service life of the electrochemical aptamer sensor.

[0035] The detection method provided by the present invention can quickly and accurately detect the concentration of estradiol in a sample through the steps of mixed hybridization, light-proof incubation and electrochemical signal collection. The entire detection process is short in time and is suitable for rapid diagnosis and high-throughput screening, and can meet the needs of clinical and scientific research fields for rapid detection of estradiol. Differential pulse voltammetry is used to collect electrochemical signals, and combined with the specific recognition ability of the aptamer, the detection method has extremely high sensitivity and ultra-low detection limit, so that the electrochemical aptamer sensor can detect extremely low concentrations of estradiol, and can accurately identify target molecules even in complex biological samples, thereby improving the accuracy and reliability of the detection. It is not only suitable for estradiol detection in biological samples such as blood, but can also be extended to other sample types containing estradiol. The electrochemical aptamer sensor of the present invention has the characteristics of wide dynamic range and high sensitivity, and can meet the detection needs of estradiol in different concentration ranges. The detection method has broad application prospects and good market value in the fields of medical diagnosis, environmental monitoring, food safety, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Schematic diagram of the electrochemical aptamer sensor and the detection principle diagram of the present invention, wherein A is a schematic diagram of the electrochemical aptamer sensor based on the biorecognition interface co-assembled by thiol polyethylene glycol (HS-PEG) and capture chain (Cap-DNA) of the present invention, and B is a differential pulse voltammetry (DPV) response diagram of the sensor before and after incubation with 100 pM estradiol;

[0037] Figure 2 This is a graph showing the effect of the molar ratio of the signal chain / aptamer (Sig-DNA-MB / E2-apt76) of the present invention on the peak current of the 100 pM estradiol electrochemical aptamer sensor;

[0038] Figure 3 This is a graph showing the influence of different concentrations of signal chain / aptamer double chain on the current difference in the electrochemical aptamer sensor in a buffer solution containing 100 pM estradiol according to the present invention;

[0039] Figure 4 This is a graph showing the effect of incubation time on the current difference of the electrochemical aptamer sensor of the present invention in the presence of 100 pM estradiol;

[0040] Figure 5 This is a graph showing the effect of the initial assembly concentration of the capture probe HS-25mer on the current difference of the differential pulse voltammogram when the electrochemical aptamer sensor of the present invention is in the presence of 100 pM estradiol;

[0041] Figure 6This is a graph showing the influence of different interferents, different storage times and regeneration times on the current signal of the electrochemical aptamer sensor of the present invention, wherein A represents different interferents and E2, B represents different storage times, and C represents different regeneration times;

[0042] Figure 7 The current difference corresponding to the calibration curve of the electrochemical aptamer sensor of the present invention for recognizing E2 in 25% serum.

[0043] Figure 8 : This is a comparison between the electrochemical aptamer sensor of the present invention and different detection methods, wherein A is the Passing-Boblok regression analysis (Pearson r=0.958) between the chemiluminescence method and the E-DNA method, the dotted line is the regression line, and the shaded area represents the 95% confidence interval; B is the corresponding Bland-Altman plot. DETAILED DESCRIPTION

[0044] In order to enable those skilled in the art to better understand the scheme of the present invention, the technical scheme in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0045] The present invention is further described in detail below in conjunction with the accompanying drawings:

[0046] Example 1

[0047] See attached Figure 1 This embodiment provides an electrochemical aptamer sensor for E2 detection, and the specific preparation method is as follows:

[0048] 1. Gold electrode cleaning

[0049] Before modification, the gold electrode was polished on suede with 0.3 μm alumina powder suspended for 3 min, and then ultrasonically cleaned in ethanol for 3 min; then, the electrode was further polished on suede with 0.05 μm alumina powder suspended. After this step, ultrasonic cleaning was performed in ethanol and water for 3 min respectively. Next, a series of oxidation and reduction cycles were performed using cyclic voltammetry in 0.5 M H2SO4, 0.01 M KCl / 0.1 M H2SO4 and 0.05 M H2SO4, with a potential window of -0.1 V to 1.5 V and a scan rate of 100 mV s -1 , to further clean the electrode.

[0050] 2. Preparation of reduced thiolated capture chains

[0051] Material preparation: reducing agent: tris (2-carboxyethyl) phosphine, concentration is 100mM; thiolated Cap-DNA capture chain, concentration is 100μM, the solvent is Tris HCl buffer with pH=7.4 and molar concentration of 20mM, the thiolated capture chain sequence is 5′-HS-GCTTCCAGCTTATTGAATTACACGC (as shown in SEQ ID NO.1).

[0052] The tri(2-carboxyethyl)phosphine and the thiolated capture chain were mixed in a volume ratio of 2:3 and allowed to stand in a dark environment at room temperature for 1 to 2 hours to ensure that the reducing agent fully acts to obtain the reduced thiolated capture chain.

[0053] 3. Preparation of Working Electrode

[0054] Materials: 10 mM Tris-HCl buffer; HS-PEG, molecular weight 10,000.

[0055] Add 5 μL of reduced thiolated capture chain with a molar concentration of 0.1-5 μM to the surface of the gold electrode to ensure uniform coverage; freeze the gold electrode in a -20°C environment for 20 minutes; remove the gold electrode from the freezing environment and let it thaw naturally; wash the gold electrode three times with 10 mM Tris-HCl buffer to remove unbound capture chains; prepare the blocking agent: dissolve 1 mg HS-PEG in 1 mL 10 mM Tris-HCl buffer to obtain a 1 mg / mL HS-PEG solution, add 5 μL HS-PEG solution to the surface of the gold electrode, and incubate at room temperature for 2 hours to block the nonspecific binding sites on the surface of the gold electrode.

[0056] 4. E2 detection

[0057] (1) Solution preparation and mixing

[0058] Solution dilution: The estradiol E2 aptamer (E2-apt76), the signal chain (Sig-DNA) and the estradiol E2 are dissolved in a buffer solution, wherein the buffer solution has a pH of 8.0 and contains 10 mM Tris-HCl, 200 mM NaCl, 10 mM MgCl2 and 25 mM KCl, and the solvent is 5% ethanol by volume; the composition of the buffer solution should ensure the stability of the DNA and the binding ability of the aptamer to E2.

[0059] 50 μL of E2-apt76 solution (40 nM) was mixed with 50 μL of Sig-DNA solution (40 nM) at room temperature for 1 hour to form a complex stock solution. This step allowed the aptamer to hybridize with the signal DNA to form a stable double-stranded structure.

[0060] (2) Serum sample processing and incubation

[0061] Serum pretreatment: 80 μL of serum sample was mixed with 75 μL of heparin (concentration of 125 IU / mL) and incubated at 37°C for 5 min to release estradiol bound to sex hormone binding globulin (SHBG) and albumin.

[0062] 100 μL of pretreated serum sample was added to the complex stock solution obtained in step (1) and incubated at 60°C in the dark for 4 h to allow E2 to bind to the aptamer and trigger a strand displacement reaction, thereby releasing the signal DNA.

[0063] (3) Signal capture and electrochemical measurement

[0064] Incubation with mixed solution: Immerse the HS-PEG / Cap-DNA modified working electrode prepared in Experiment 3 in 200 μL of the sample to be tested (E2-apt76, Sig-DNA and E2) treated in step (2), and seal it with a sealing film to prevent solution evaporation and contamination. Incubate at room temperature for 90 minutes to allow the released signal DNA to hybridize with the capture chain on the electrode surface.

[0065] Washing: Wash the electrode three times with sensing buffer to remove unbound DNA and other impurities.

[0066] Electrochemical label binding: The electrode was immersed in 1xPBS containing 50 μM methylene blue (MB) for 30 minutes. MB will be inserted into the double-stranded DNA after hybridization and serve as the source of electrochemical signal.

[0067] Signal acquisition: The working electrode, counter electrode and reference electrode were placed in a buffer solution, and differential pulse voltammetry was used to acquire the electrochemical signal intensity of the working electrode.

[0068] The signal chain (Sig-DNA) has a sequence (as shown in SEQ ID NO. 2): GCGTGTAATTCAATAAGCTGGAAGC.

[0069] The sequence of the estradiol aptamer (E2-apt76) (as shown in SEQ ID NO. 3) is: GCTTCCAGCTTATTGAATTACACGCAGAGGGTAGCGGCTCTGCGCATTCAA TTGCTGCGCGCTGAAGCGCGGAAGC.

[0070] 5. Data Analysis

[0071] The samples were tested with different concentrations of E2 (7.5×10 -12 ~100000×10 -12M) as the abscissa and the corresponding electrical signal difference (compared with the blank control) as the ordinate to draw a standard curve; through the standard curve, quantitative detection of unknown concentration E2 can be achieved.

[0072] By the attached Figure 1 It can be seen that the DPV response of the electrochemical aptamer sensor after HS-PEG / Cap-DNA co-assembly is very high. After incubation with 100pM E2, the peak current increases from 190nA to 790nA. This shows that the electrochemical aptamer sensor of the present invention is very sensitive to E2, and can produce obvious electrical signal changes even at low concentrations. It can specifically identify E2 and interact with it, thereby producing electrical signal changes. These experimental results verify the detection principle of the present invention, indicating that the electrochemical aptamer sensor is successfully modified and can detect E2, and can achieve accurate and rapid detection of unknown concentrations of E2.

[0073] Example 2

[0074] In this embodiment, based on the embodiment 1, an optimization test is performed on the preparation parameters.

[0075] (1) Detection of the peak current of the electrochemical aptamer sensor of 100 pM estradiol by the molar ratio of the signal chain / estradiol (E2) aptamer (Sig-DNA-MB / E2-apt76)

[0076] Under the condition that the concentration of E2 aptamer was fixed at 40 nM, the effect of the molar ratio between the signal chain and E2 aptamer (1:2, 1:1, 1.5:1, 2:1) on the performance of electrochemical aptamer sensor was studied. Figure 2 As shown in the figure, in the presence of 100 pM E2, when the molar ratio is 1:1, the electrochemical signal reaches an inflection point. A lower concentration of the signal chain can provide a lower background signal by forming a stable signal chain / estradiol (E2) aptamer duplex, but the sensitivity of the assay is deteriorated. Insufficient signal chain can lead to unstable or less signal chain / aptamer duplexes, resulting in lower sensitivity. On the contrary, excessive signal chain can affect the interaction between E2 and its aptamer, and even lead to the generation of nonspecific signals. Therefore, the optimal molar ratio of signal chain to aptamer is 1:1 for the detection of E2.

[0077] (2) Peak current of the electrochemical aptamer sensor for detecting 100 pM estradiol with different concentrations of signal chain / estradiol aptamer duplex

[0078] The optimal molar ratio of signal chain to aptamer is 1:1. The aptamer labeled with estradiol and signal chain were mixed in binding buffer (10mM Tris, 10mM MgCl2, 25mM HCl, pH 8.0) with different molar concentrations of signal chain / estradiol aptamer duplex (5nM-20nM), heated to 85°C for 10 minutes, and then cooled to 25°C for subsequent experiments. Figure 3 The data show that in the presence of 100 pM E2, the signal difference of the electrochemical aptamer sensor reaches the maximum value when the concentration of the signal chain / aptamer duplex is 10 nM. Therefore, all subsequent experiments use a molar concentration of 10 nM signal chain / aptamer duplex as the optimal concentration.

[0079] (3) Detection of peak current of 100 pM estradiol electrochemical aptamer sensor at different incubation times

[0080] By the attached Figure 4 The data show that after the addition of estradiol, the estradiol aptamer binds to estradiol to open the double-stranded structure, releasing the signal chain, and then the electrochemical aptamer sensor captures the signal chain; the electrical signal gradually increases and reaches a plateau after the binding time exceeds 90 minutes. Therefore, in the following experiments, all electrochemical detections were started after 90 minutes of electrode incubation.

[0081] (4) Detection of peak current of 100 pM estradiol electrochemical aptamer sensor at different initial assembly concentrations of capture chain HS-25mer

[0082] To optimize the sensing performance, the effect of the initial assembly concentration of the capture chain HS-25mer was also evaluated. Figure 5 The data show that the current difference of the electrochemical aptamer sensor increases within the capture chain concentration range of 0.5-1μM, and reaches a maximum value at 1μM. As the assembly concentration continues to increase, the current difference decreases. Although a high capture chain assembly concentration can theoretically provide more binding sites, excessive density may cause mutual interference between probes, reduce the effective binding ability of the probes, and even cause signal saturation. Therefore, the optimized capture chain optimal assembly concentration was determined to be 1μM for subsequent sensing experiments.

[0083] (5) Effects of different interferents, storage time, and regeneration times on the peak current of 100 pM estradiol sensor

[0084] Complex sample matrices may affect the analysis of E2 using electrochemical aptasensors. Therefore, the selectivity of the assay is an important issue in practical E2 detection. To determine the specificity of the method, the effects of other serum interfering substances including ascorbic acid (AA), uric acid (UA), glucose (Glu), follicle-stimulating hormone (FSH), luteinizing hormone (LH) and carcinoembryonic antigen (CEA) on the electrochemical aptasensor were measured under the same experimental conditions as 100 pM E2. The concentration of the above interfering substances was 1 nM, see Appendix Figure 6 As shown, E2 and its mixture (including E2) induced no significant difference in the difference of electrical signals, indicating that the electrochemical aptamer sensor of the present invention has good specificity for E2; the storage stability and reproducibility of the electrochemical aptamer sensor were further studied, which are closely related to the sensing cost. The storage time of the prepared electrochemical aptamer sensor was investigated. The electrodes were placed at 25°C and 4°C, respectively, and the current response was measured on the 1st, 4th, 7th and 10th days. The current signal of the working electrode stored at 4°C remained almost unchanged within 10 days, while it gradually decreased over time when stored at 25°C, indicating that the working electrode can be stored at 4°C for at least 10 days, and the prepared electrochemical aptamer sensor can be stored at 4°C for at least 1 month; the working electrode of the electrochemical aptamer sensor was heated with 90°C Milli-Q water for 60 seconds to unwind the signal chain / capture chain double helix, and the electrochemical aptamer sensor was successfully restored. After 5 rounds of repeated use, the current signal value of the electrochemical aptamer sensor did not change significantly, indicating that the electrochemical aptamer sensor of the present invention has excellent reusability and good commercial application potential.

[0085] (6) Draw a standard curve

[0086] Under the above-mentioned optimal experimental conditions, the electrochemical aptamer sensor of the present invention was used to quantitatively determine a range of E2 concentrations (7.5 pM to 10000 pM), such as Figure 7 As shown in the figure, the current difference increases with the increase of E2 concentration, and shows a good relationship in the wide linear range of 7.5pM to 10000pM. The current difference is linearly related to the logarithm of E2 concentration (R 2 =0.984), and the detection limit was 7.5 pM, indicating that the method for detecting estradiol using the electrochemical aptamer sensor of the present invention has high sensitivity and can be used for the determination of E2 in actual samples.

[0087] (7) Comparison of different methods

[0088] The E2 concentration in the same group of samples was measured using the American Siemens estradiol assay kit (direct chemiluminescence method, Product No. 08056099) and the detection method of the present invention. Each method was performed independently to ensure the independence of the results, and the E2 concentration value measured by each method was recorded. The consistency and correlation between the two methods were evaluated by Passing-Bablok regression analysis and Bland-Altman plot analysis. For details, see the attached Figure 8 shown.

[0089] By the attached Figure 8 The data shows that Figure 8 In the figure, A is the Passing-Boblok regression analysis (Pearson r=0.958) between the chemiluminescence method and the E-DNA method, the dotted line is the regression line, and the shaded area represents the 95% confidence interval; B is the corresponding Bland-Altman plot, the black line in the figure represents the median difference, and the calculation formula is c(chemiluminescence method)-c(E-DNA method) / c(mean), where c is the measured E2 concentration. The Passing-Bablok regression analysis showed that the regression slope was 0.89 (95% confidence interval: 0.853 to 0.935) and the intercept was 22.49 (95% confidence interval: -119.81 to 176.8), indicating that there is good consistency between the two methods. In addition, the average deviation obtained from the Bland-Altman plot was 226.85, and only a few points fell outside the 95% consistency range, indicating that there is good correlation between the two methods.

[0090] The above contents are only for explaining the technical idea of ​​the present invention and cannot be used to limit the protection scope of the present invention. Any changes made on the basis of the technical solution in accordance with the technical idea proposed by the present invention shall fall within the protection scope of the claims of the present invention.

Claims

1. An electrochemical aptamer sensor for detecting the sex hormone estradiol, characterized in that: A three-electrode system is adopted, including a working electrode, a reference electrode and an auxiliary electrode, and an estradiol aptamer is used as a recognition element. The working electrode is a thiol polyethylene glycol and a capture chain co-assembled on the surface of a gold electrode, and the capture chain is complementary to the signal chain. When detecting a sample containing estradiol, a complex formed by the estradiol aptamer and the signal chain is mixed with the sample to be tested, estradiol binds to the estradiol aptamer to release the signal chain, and the released signal chain hybridizes with the capture chain to form a DNA double-stranded structure, an electroactive label is introduced to bind to the DNA double-stranded structure, and the electrochemical signal is measured by an electrochemical workstation to realize the detection of the sex hormone estradiol.

2. The electrochemical aptamer sensor for detecting the sex hormone estradiol according to claim 1, characterized in that: The capture chain sequence is shown in SEQ ID NO.1; the signal chain sequence is shown in SEQ ID NO.2; and the estradiol aptamer sequence is shown in SEQ ID NO.

3.

3. The method for preparing the electrochemical aptamer sensor for detecting the sex hormone estradiol according to any one of claims 1 to 2, characterized in that: include: S1, preparation of reduced thiolated capture chain; S2, dropping the reduced thiolated capture chain onto the surface of the gold electrode, freezing, thawing, washing, and sealing to obtain a working electrode co-assembled with thiolated polyethylene glycol and the capture chain; S3, assembling the working electrode, reference electrode and auxiliary electrode of the co-assembled thiol polyethylene glycol and the capture chain to obtain an electrochemical aptamer sensor for the detection of the sex hormone estradiol.

4. The method for preparing the electrochemical aptamer sensor for detecting the sex hormone estradiol according to claim 3, characterized in that: In S1, the preparation of the reduced thiolated capture chain comprises: mixing a reducing agent tri(2-carboxyethyl)phosphine and the capture chain in a volume ratio of 2:3, and leaving the mixture to stand at room temperature in the dark for 1-2 hours.

5. The method for preparing the electrochemical aptamer sensor for detecting the sex hormone estradiol according to claim 3, characterized in that: In S2, the freezing temperature is -20°C, and the freezing is for 10 to 20 minutes; the blocking agent used in the blocking is a Tris-HCl buffer containing thiol polyethylene glycol with a mass volume concentration of 1 mg / mL, and the blocking is incubated at room temperature for 2h to 3h.

6. Use of the electrochemical aptasensor according to any one of claims 1 to 2 in the detection of sex hormone estradiol.

7. A method for detecting sex hormone estradiol based on the electrochemical aptamer sensor according to any one of claims 1 to 2, characterized in that: include: (1) at room temperature, mixing and hybridizing the estradiol aptamer solution and the signal chain solution to obtain a complex stock solution; (2) adding the heparin-treated sample containing the sex hormone estradiol to be tested to the original solution of the complex in step (1), incubating in the dark, and obtaining a treated sample to be tested; (3) placing the working electrode in the sample to be tested after being treated in step (2) for reaction, washing, and soaking in a buffer solution containing an electroactive label; placing the working electrode, the counter electrode, and the reference electrode in the buffer solution, using differential pulse voltammetry to collect the electrical signal of the working electrode, and drawing a standard curve based on the electrical signal difference versus the sex hormone estradiol concentration to achieve quantitative detection of the sex hormone estradiol.

8. The method for detecting sex hormone estradiol using an electrochemical aptamer sensor according to claim 7, characterized in that: In step (1), the molar ratio of the estradiol aptamer to the signal chain is 1 to 3:1, and the hybridization time is 1 to 2 hours.

9. The method for detecting sex hormone estradiol using an electrochemical aptamer sensor according to claim 7, characterized in that: In step (2), the volume ratio of heparin to the sample to be tested is 1:1-2, and the heparin concentration is 125 IU / mL; the volume ratio of the sample to be tested to the complex stock solution is 1:1, the light-proof incubation temperature is 50-70°C, and the time is 3-5 hours.

10. The method for detecting sex hormone estradiol using an electrochemical aptamer sensor according to claim 7, characterized in that: In step (3), the reaction is incubated at room temperature for 80 to 100 minutes, the buffer containing the electroactive label is a phosphate buffer containing methylene blue, the immersion time is 20 to 40 minutes, and the concentration of the sample to be tested is 7.5×10 -12 ~100000×10 -12 M.

Images