Composition for improving acne, containing colloidal sulfur complex as active ingredient, and method for preparing same

Abstract

The present invention relates to a composition for improving acne comprising a colloidal sulfur complex as an active ingredient, and a method for preparing the same. When the composition containing sulfur, hesperidin and succinic acid as active ingredients of the present invention is used, excessive sebum can be suppressed and excessive sebum production can be regulated. Moreover, the composition containing sulfur, hesperidin and succinic acid as active ingredients of the present invention has a very excellent antibacterial effect against propionibacterium acnes, which are pathogenic bacteria of acnes, and thus can be usefully used as a functional cosmetic for improving acnes and a therapeutic agent for acnes, each of which contains the composition.

Description

[0001] This application claims the priority of Korean Patent Application No. 10-2023-0115726 filed on August 31, 2023 with the Korean Intellectual Property Office, the entire contents of which are incorporated herein by reference. [Technical field]

[0002] The present invention relates to an acne-improving composition comprising a colloidal sulfur complex as an active ingredient and a preparation method thereof, and more particularly to an acne-improving composition comprising sulfur, hesperidin and succinic acid as active ingredients and a preparation method thereof. [Background technology]

[0003] Sebocytes are cells that constitute sebaceous glands and secrete sebum through holocrine. Sebum is mainly composed of cell debris and neutral lipids such as triglycerides, wax, esters, squalene, cholesterol and free fatty acids. Sebum is secreted in the sebaceous follicles composed of sebaceous cells. If sebum is secreted at a higher level than normal, it will cause a bottleneck phenomenon and form comedone. If sebum is oxidized in a full state, blackheads will be formed. Sebum that is excessively produced due to external stimuli such as ultraviolet rays and heat becomes food for acne bacteria, and the proliferation of acne bacteria will cause skin problems such as inflammatory acne (or suppurative acne).

[0004] The male hormone androgen, which is known as an inducer related to the excessive secretion of sebum, is one of the direct causes of increasing sebaceous gland proliferation. Androgen causes a network process by binding to androgen receptors (AR), and it is known that androgen-mediated signaling plays a role in maximizing sebaceous cell differentiation and sebaceous lipogenesis. According to clinical evidence, regulating androgen-mediated signaling not only regulates the excessive secretion of sebum in female acne patients, but also plays a very important role in acne treatment.

[0005] Acetyl-CoA carboxylase (acetyl-coenzyme A carboxylase, ACC) is one of the factors that plays a very important role in the regulation of lipid metabolism (lipidmetabolism). Finally, fatty acids are the most common components in the composition of sebum, so ACC works as the main regulator of sebum production. ACC is regulated by cholesterol regulatory element binding protein (sterol regulatory element-binding protein, SREBP). According to a report of a study, when androgens are treated to female hamsters, SREBP-1 is activated, the size of sebocytes increases, and lipid synthesis increases. In addition, the expression of genes such as ACC related to synthetic fatty acids also increases significantly.

[0006] Fatty acid synthase (FAS) is an enzyme required for fatty acid synthesis and is induced by androgens to promote the lipid synthesis pathway. Among the components of sebum, triglycerides (1 glycerol + 3 fatty acids) as neutral fats account for about 50%, and fatty acids not contained in neutral fats account for about 30%, which constitute the majority of sebum. Fatty acids are overproduced due to the decomposition of triglycerides by bacteria, thus inducing inflammatory acne.

[0007] ACC, a major factor in regulating lipid metabolism, catalyzes the formation of FAS during fatty acid chain elongation and increases the oxidation of fatty acids. If sebum containing fatty acids is oxidized, it acts as a trigger for the formation of early acne and induction of acne, and then induces inflammatory acne through bacteria. The main cause of acne is the excessive production and imbalance of sebum, so such regulation of lipid production is one of the very important treatment methods for acne patients. That is, the sebum production regulation effect can be confirmed by inhibiting the gene expression of pathways related to sebum biosynthesis, such as ACC or FAS.

[0008] According to research reports, with the occurrence of acne, the expression of pro-inflammatory cytokine IL-1α increases to a high level. In particular, representative pathogen-associated molecular patterns (PAMs) and lipopolysaccharide (LPS) in the components that encapsulate Gram-positive bacteria (e.g., Propionibacterium acnes) activate TLR-2, TLR-4, and TLR-9, which are Toll-like receptors (TLRs), and secrete cytokines such as IL-1α through a nuclear factor κB-dependent mechanism. Among them, TLR-2 in particular acts as a receptor for the Gram-positive bacteria Propionibacterium acnes (C. acnes), and acts as a factor that has played a role in the formation of inflammatory acne. If TLR-2 is activated by Propionibacterium acnes, a variety of inflammatory genes are expressed and infiltration into immune cells is caused, thereby playing a decisive role in the onset of inflammatory acne.

[0009] The present inventors have studied materials having acne-improving effects, sebum secretion-regulating effects, and pore-tightening effects, and have confirmed that a stabilized colloidal sulfur complex inhibits excessive sebum production and regulates excessive sebum production. In addition, the present inventors have confirmed that the colloidal sulfur complex inhibits the expression of TLR-2 that plays a role in inflammatory acne and inhibits the growth of Propionibacterium acnes, which is an acne pathogen, and have found that the stabilized colloidal sulfur complex can be used as a cosmetic composition for improving acne, thereby completing the present invention.

[0010] [Prior art literature]

[0011] [Patent Literature]

[0012] Korean Patent Publication No. 10-2021-0034797 (published on March 31, 2021) [Summary of the invention]

[0013]

Technical issues

[0014] The present inventors have made many efforts to develop materials with acne-improving effects and sebum secretion-regulating effects. As a result, they have found that a composition containing sulfur, hesperidin and succinic acid regulates excessive sebum production and can effectively improve, prevent or treat acne by inhibiting the growth of Propionibacterium acnes, which is an acne pathogen, thereby completing the present invention.

[0015] Therefore, an object of the present invention is to provide a cosmetic composition for regulating sebum secretion or improving acne, comprising sulfur, hesperidin and succinic acid as active ingredients.

[0016] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating acne, comprising sulfur, hesperidin and succinic acid as active ingredients.

[0017] Another object of the present invention is to provide an antibacterial composition for Propionibacterium acnes comprising sulfur, hesperidin and succinic acid as active ingredients.

[0018] Another object of the present invention is to provide a method for preparing a composition comprising sulfur, hesperidin and succinic acid.

[0019]

Technical solution

[0020] In order to solve the above problems, the present inventors have made many efforts to develop materials with acne improvement effects and sebum secretion regulation effects. As a result, it was found that a composition containing sulfur, hesperidin and succinic acid regulates excessive sebum production and can effectively improve, prevent or treat acne by inhibiting the growth of Propionibacterium acnes, which is an acne pathogen, thereby completing the present invention.

[0021] According to one embodiment of the present invention, the present invention provides a cosmetic composition for regulating sebum secretion or improving acne, comprising sulfur, hesperidin and succinic acid as active ingredients.

[0022] In the present invention, "sulfur" is a finely ground light yellow powder, which has the effects of pain relief, inflammation removal, detoxification and sterilization. Sulfur has thermal toxicity, so it should be processed before use, and is divided into water-soluble sulfur and fat-soluble sulfur according to the processing method.

[0023] In one embodiment of the present invention, the sulfur of the present invention is dispersed in the composition in a colloidal state, and has the characteristics of smaller particles and being more soluble in water compared with the existing sulfur.

[0024] The sulfur of the present invention can exist not only in an alternate form but also in a non-solvated state. Furthermore, the sulfur of the present invention can exist in a crystalline or non-crystalline form, and all these physical forms are included in the scope of the present invention.

[0025] In the present invention, "hesperidin" is a compound represented by the following chemical formula 1, which is a flavanone glycoside in flavonoid pigments. It is a light yellow crystal or crystalline powder, and has anti-aging and anti-oxidation effects.

[0026]

Chemical formula 1

[0027]

[0028] In the present invention, "succinic acid" is a compound represented by the following Chemical Formula 2, and is a colorless, odorless, columnar or plate-like crystalline solid.

[0029]

Chemical formula 2

[0030]

[0031] The method for obtaining sulfur, hesperidin and succinic acid used in the present invention is not particularly limited, and they can be chemically synthesized by methods known in the technical field to which the present invention belongs, or commercially available substances can be used.

[0032] The term "comprising as an effective ingredient" used in the present invention means that a sufficient amount is contained to achieve the efficacy or activity of the above-mentioned sulfur, hesperidin and succinic acid.

[0033] The term "acne" in the present invention refers to an inflammatory skin disease of the sebaceous follicles, which manifests as closed or open comedones, papules, pustules, cysts, nodules and other skin lesions on the face, upper chest, back and upper limbs. The main causes of acne are excessive secretion of sebum, abnormal keratinization of hair follicles, proliferation of Propionibacterium acnes and inflammation, etc. In addition, it may also be related to hormones or immune factors. The combined action of the above factors causes the onset of acne.

[0034] The term "improvement" of the present invention refers to all actions of at least reducing the degree of acne symptoms by administering the composition comprising sulfur, hesperidin and succinic acid of the present invention as effective ingredients.

[0035] The term "sebum secretion regulation" of the present invention refers to all actions of at least reducing excessively produced sebum or the degree of sebum production by administering the composition of the present invention comprising sulfur, hesperidin and succinic acid as active ingredients.

[0036] The term "colloidal sulfur complex" of the present invention refers to a mixture that can be used by containing sulfur, hesperidin, and succinic acid in the following ratio and dispersing them.

[0037] In one embodiment of the present invention, the sulfur can be contained in a ratio of 0.001 to 30 weight percent relative to the total weight of the composition. More specifically, the sulfur can be contained in a ratio of 0.001 to 30 weight percent, 0.001 to 25 weight percent, 0.001 to 20 weight percent, 0.001 to 15 weight percent, 0.001 to 10 weight percent, 0.001 to 7 weight percent, 0.001 to 5 weight percent, 0.01 to 30 weight percent, 0.01 to 25 weight percent, 0.01 to 20 weight percent, 0.01 to 15 weight percent, 0.01 to 10 weight percent, 0.01 to 7 weight percent. The above sulfur is included in an amount of 0.01 to 5 weight percent, 0.1 to 30 weight percent, 0.1 to 25 weight percent, 0.1 to 20 weight percent, 0.1 to 15 weight percent, 0.1 to 10 weight percent, 0.1 to 7 weight percent, 0.1 to 5 weight percent, 1 to 30 weight percent, 1 to 25 weight percent, 1 to 20 weight percent, 1 to 15 weight percent, 1 to 10 weight percent, 1 to 7 weight percent, and 1 to 5 weight percent, but is not limited thereto. If less than 0.001 weight percent is included, the effect of sulfur is minimal, and if more than 30 weight percent, there is a risk of irritation to the skin, and it is difficult to dissolve and separate, resulting in problems of reduced stability and efficacy.

[0038] In one embodiment of the present invention, the hesperidin can be contained in a ratio of 0.001 weight percent to 30 weight percent relative to the total weight of sulfur. More specifically, the hesperidin can be contained in a ratio of 0.001 weight percent to 30 weight percent, 0.001 weight percent to 25 weight percent, 0.001 weight percent to 20 weight percent, 0.001 weight percent to 15 weight percent, 0.001 weight percent to 10 weight percent, 0.001 weight percent to 7 weight percent, 0.001 weight percent to 5 weight percent, 0.01 weight percent to 30 weight percent, 0.01 weight percent to 25 weight percent, 0.01 weight percent to 20 weight percent, 0.01 weight percent to 15 weight percent, 0.01 weight percent to 10 weight percent, 0.01 weight percent to 7 weight percent. , 0.01 weight percent to 5 weight percent, 0.1 weight percent to 30 weight percent, 0.1 weight percent to 25 weight percent, 0.1 weight percent to 20 weight percent, 0.1 weight percent to 15 weight percent, 0.1 weight percent to 10 weight percent, 0.1 weight percent to 7 weight percent, 0.1 weight percent to 5 weight percent, 1 weight percent to 30 weight percent, 1 weight percent to 25 weight percent, 1 weight percent to 20 weight percent, 1 weight percent to 15 weight percent, 1 weight percent to 10 weight percent, 1 weight percent to 7 weight percent, 1 weight percent to 5 weight percent includes the above hesperidin, but is not limited thereto. If the hesperidin is less than 0.001 weight percent relative to the total weight of sulfur, it is difficult to obtain the desired acne skin improvement effect, and if it is greater than 30 weight percent, it is difficult to expect an additional increase in the acne skin improvement effect.

[0039] In one embodiment of the present invention, the succinic acid may be contained in a ratio of 0.001 to 30 weight percent relative to the total weight of sulfur. More specifically, the succinic acid may be contained in a ratio of 0.001 to 30 weight percent, 0.001 to 25 weight percent, 0.001 to 20 weight percent, 0.001 to 15 weight percent, 0.001 to 10 weight percent, 0.001 to 7 weight percent, 0.001 to 5 weight percent, 0.01 to 30 weight percent, 0.01 to 25 weight percent, 0.01 to 20 weight percent, 0.01 to 15 weight percent, 0.01 to 10 weight percent, 0.01 to 7 weight percent. , 0.01 to 5 weight percent, 0.1 to 30 weight percent, 0.1 to 25 weight percent, 0.1 to 20 weight percent, 0.1 to 15 weight percent, 0.1 to 10 weight percent, 0.1 to 7 weight percent, 0.1 to 5 weight percent, 1 to 30 weight percent, 1 to 25 weight percent, 1 to 20 weight percent, 1 to 15 weight percent, 1 to 10 weight percent, 1 to 7 weight percent, 1 to 5 weight percent, but not limited thereto. If the succinic acid is less than 0.001 weight percent relative to the total weight of sulfur, it is difficult to obtain the expected acne skin improvement effect, and if it is greater than 30 weight percent, it is difficult to expect an additional increase in the acne skin improvement effect.

[0040] In the present invention, the composition comprising sulfur, hesperidin and succinic acid can reduce the expression levels of ACC, FAS and AR.

[0041] The term "acetyl-coenzyme A carboxylase (ACC)" of the present invention is one of the rate-limiting enzymes in fatty acid synthesis, which synthesizes malonyl-CoA by connecting the carboxyl group to acetyl-CoA, and malonyl-CoA combines with other acetyl-CoA to generate long-chain fatty acids.

[0042] In one embodiment of the present invention, the result of treating the sebocyte group treated with dihydrotestosterone (DHT) with a composition comprising sulfur, hesperidin and succinic acid confirmed that the expression level of ACC was significantly reduced compared with the group not treated with the composition comprising sulfur, hesperidin and succinic acid.

[0043] The term "fatty acid synthase (FAS)" of the present invention is an enzyme responsible for fatty acid synthesis, and synthesizes palmitic acid from acetyl-CoA and malonyl-CoA by using reduced nicotinamide adenine dinucleotide phosphate (NADPH).

[0044] In one embodiment of the present invention, when the DHT-treated sebocyte group was treated with a composition comprising sulfur, hesperidin, and succinic acid, it was confirmed that the FAS expression level was significantly reduced compared to the group not treated with the composition comprising sulfur, hesperidin, and succinic acid.

[0045] The term "androgen receptor (AR)" of the present invention refers to a receptor for the male hormone androgen, which is a direct cause of increasing sebaceous gland proliferation. Androgen increases sebocyte differentiation and sebum secretion lipid production by binding to the androgen receptor.

[0046] In one embodiment of the present invention, when the DHT-treated sebocyte group was treated with a composition comprising sulfur, hesperidin, and succinic acid, it was confirmed that the AR expression level was significantly reduced compared to the group not treated with the composition comprising sulfur, hesperidin, and succinic acid.

[0047] Therefore, it was confirmed that the composition containing sulfur, hesperidin, and succinic acid has an inhibitory activity on excessively produced sebum or an activity to inhibit sebum production.

[0048] In the present invention, the composition comprising sulfur, hesperidin and succinic acid can reduce the expression level of TLR-2.

[0049] The term "Toll-like receptor-2 (TLR-2)" of the present invention acts as a receptor for Propionibacterium acnes and functions as a factor that plays a role in the formation of inflammatory acne.

[0050] In one embodiment of the present invention, when the LPS-treated sebocyte group was treated with a composition comprising sulfur, hesperidin, and succinic acid, it was confirmed that the expression level of TLR-2 was significantly reduced compared to the group not treated with the composition comprising sulfur, hesperidin, and succinic acid.

[0051] The cosmetic composition of the present invention can be prepared into any dosage form commonly prepared in the technical field to which the present invention belongs, for example, it can be formulated into a solution, a suspension, an emulsion, a patch, a gel, a cream, a skin care lotion, a powder, a soap, a lotion containing a surfactant, an oil, a foundation, an emulsion foundation, a wax foundation, etc., but it is not limited thereto. More specifically, it can be prepared into a dosage form of a skin softening lotion, a nourishing lotion, a skin care lotion, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a facial mask, a spray or a powder.

[0052] In addition to the active ingredients, the cosmetic composition of the present invention may also include a carrier acceptable in cosmetic preparations. The above-mentioned "acceptable carrier in cosmetic preparations" refers to an additional ingredient that is known to be included in cosmetics for use and can improve the applicability of the active ingredients to the skin, the convenience of use and the preference of the user without attenuating the main efficacy of the active ingredients or showing side effects on the human body.

[0053] The carrier may contain about 1 weight percent to about 99.99 weight percent relative to the total weight of the composition of the present invention, preferably, about 50 weight percent to about 99 weight percent relative to the total weight of the composition. However, the content of the carrier may be appropriately adjusted according to the dosage form of the cosmetic, the specific application site, the preferred dosage, etc., and is not particularly limited.

[0054] When the dosage form of the present invention is a patch, cream, lotion or gel, the carrier component may include animal oil, vegetable oil, wax, paraffin, starch, tragacanth gum, cellulose derivatives, polyethylene glycol, silicon, bentonite, silicon dioxide, talc or zinc oxide.

[0055] When the dosage form of the present invention is a powder or a spray, lactose, talc, silicon dioxide, aluminum hydroxide, calcium silicate or polyamide powder can be used as a carrier component. Especially in the case of a spray, fillers such as chlorofluorocarbons, propane / butane or dimethyl ether can also be included.

[0056] When the dosage form of the present invention is a solution or an emulsion, a solvent, a solvating agent or an emulsifier can be used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan.

[0057] When the dosage form of the present invention is a suspension, liquid diluents such as water, ethanol or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitan esters and polyoxyethylene sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth gum can be used as carrier components.

[0058] When the dosage form of the present invention is a lotion containing a surfactant, fatty alcohol sulfates, fatty alcohol ether sulfates, sulfosuccinic acid monoesters, isethionates, imidazoline derivatives, methyl taurine, sarcosinates, fatty acid amide ether sulfates, alkylamide betaines, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, linolenic acid derivatives or ethoxylated glyceryl fatty acid esters can be used as carrier components.

[0059] The cosmetic composition of the present invention may contain, in addition to the active ingredient and the carrier component, ingredients commonly used in cosmetic compositions, for example, common auxiliary agents such as antioxidants, stabilizers, solubilizers, vitamins, pigments and fragrances.

[0060] The cosmetic composition of this embodiment has a stable dosage form due to its high dispersibility and can achieve excellent skin improvement effects.

[0061] According to one embodiment of the present invention, the present invention provides a pharmaceutical composition for preventing or treating acne, comprising sulfur, hesperidin and succinic acid as active ingredients.

[0062] When the composition of the present invention is provided as a pharmaceutical composition, the pharmaceutical composition of the present invention can be prepared using pharmaceutically acceptable carriers and / or excipients according to methods that are easily implemented by those skilled in the art, and can be prepared in a unit dosage form or loaded into a multi-dose container. Specifically, for example, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. can also be included as the above-mentioned excipients.

[0063] According to a preferred embodiment of the present invention, the pharmaceutical composition of the present invention has a skin external dosage form. The skin external dosage form is not particularly limited, but preferably a powder, gel, ointment, cream, liquid or spray.

[0064] In the present invention, the gel base of the skin external dosage form can be selected from one or more of carbopol, carbomer, polyethylene glycol, polypropylene glycol, polyacrylic acid, carboxymethyl cellulose, hydroxymethyl cellulose, polyvinyl pyrrolidone, gelatin, alginate, chitin or chitosan derivatives, hyaluronic acid, and collagen, but is not limited thereto.

[0065] The appropriate dosage of the pharmaceutical composition of the present invention can be prescribed in a variety of ways depending on the content of the active ingredient, the mode of administration, the patient's age, body weight, sex, disease state, diet, administration time, administration route, metabolic rate and reaction sensitivity. On the other hand, preferably, the dosage of the pharmaceutical composition of the present invention is 0.001-100 mg / kg (body weight) per day, and the pharmaceutical composition of the above dosage can be applied to the desired site in the form of a local or wide range of skin external dosage forms according to the purpose of application.

[0066] According to one embodiment of the present invention, there is provided an antibacterial composition for Propionibacterium acnes comprising sulfur, hesperidin, and succinic acid as active ingredients.

[0067] In the present invention, "Cutibacterium acnes (C.acnes)" is a Gram-positive bacterium that resides in hair follicles and is one of the pathogens of acne. The lipase secreted by Propionibacterium acnes decomposes the fatty acids secreted by sebum to form free fatty acids and stimulate hair follicles to cause the inflammatory response of acne.

[0068] The term "antibacterial" of the present invention refers to an activity of preventing or treating bacterial infection by inhibiting the reproduction or proliferation of bacteria including microorganisms.

[0069] The composition comprising sulfur, hesperidin and succinic acid may have an antibacterial effect on Propionibacterium acnes.

[0070] In one embodiment of the present invention, the antibacterial activity of a composition comprising sulfur, hesperidin and succinic acid against Propionibacterium acnes was tested. When the composition comprising sulfur, hesperidin and succinic acid was treated, it was confirmed that the growth of Propionibacterium acnes was inhibited and the number of bacteria was reduced. Therefore, it was confirmed that the composition comprising sulfur, hesperidin and succinic acid had specific antibacterial activity against Propionibacterium acnes strains.

[0071] According to one embodiment of the present invention, the present invention provides a method for preparing a composition comprising sulfur, hesperidin and succinic acid, comprising: step (a), dispersing sulfur in an aqueous solvent to prepare a dispersion; step (b), adding hesperidin and succinic acid to the dispersion obtained in the above step (a) and dissolving them; and step (c), high-pressure dispersing the solution obtained in the above step (b).

[0072] In one embodiment of the present invention, in the step (a), ultra sonication is used for dispersion.

[0073] In one embodiment of the present invention, the step (a) is performed at a frequency of 1 kHz to 30 kHz for 0.5 to 5 hours. More specifically, the frequency may be 1 kHz to 30 kHz, 5 kHz to 30 kHz, 10 kHz to 30 kHz, 15 kHz to 30 kHz, 20 kHz to 30 kHz, 1 kHz to 25 kHz, 5 kHz to 25 kHz, 10 kHz to 25 kHz, 15 kHz to 25 kHz, 20 kHz to 25 kHz, 1 kHz to 20 kHz, 5 kHz to 20 kHz, 10 kHz to 20 kHz or 15 kHz to 20 kHz, but is not limited thereto.

[0074] In an embodiment of the present invention, the aqueous solvent is selected from the group consisting of water, propylene glycol, pentylene glycol and butylene glycol.

[0075] In one embodiment of the present invention, in the step (b), a homogenizer is used for dissolving.

[0076] In one example of the present invention, the step (b) is performed at a speed of 1000 rpm to 5000 rpm for 0.5 to 5 hours. More specifically, the speed may be 1000 rpm to 5000 rpm, 1500 rpm to 5000 rpm, 2000 rpm to 5000 rpm, 2500 rpm to 5000 rpm, 3000 rpm to 5000 rpm, 1000 rpm to 4500 rpm, 1500 rpm to 4500 rpm, 2000 rpm to 4500 rpm, 2500 rpm to 4500 rpm, 3000 rpm to 4500 rpm, 1000 rpm to 4000 rpm, 1500 rpm to 4000 rpm, 1500 rpm to 4000 rpm. pm, 2000rpm to 4000rpm, 2500rpm to 4000rpm, 3000rpm to 4000rpm, 1000rpm to 3500rpm, 1500rpm to 3500rpm, 2000rpm to 3500rpm, 2500rpm to 3500rpm, 3000rpm to 3500rpm, 1000rpm to 3000rpm, 1500rpm to 3000rpm, 2000rpm to 3000rpm or 2500rpm to 3000rpm, but is not limited to these.

[0077] In one embodiment of the present invention, the step (b) is carried out at a temperature of 40° C. to 90° C. More specifically, the temperature may be 40° C. to 90° C., 45° C. to 90° C., 50° C. to 90° C., 55° C. to 90° C., 60° C. to 90° C., 65° C. to 90° C., 70° C. to 90° C., 75° C. to 90° C., 80° C. to 90° C., 40° C. to 85° C., 45° C. to 85° C., 50° C. to 85° C., 55° C. to 85° C., 60° C. to 85° C., 65° C. to 85° C., 70° C. to 85° C., 75° C. to 85° C., 80° C. to 85° C., 40° C. to 80° C., 45° C. to 80° C., 50° C. to 80° C., 55° C. to 80° C., 60° C. to 80° C., 65° C. to 80° C., 70° C. to 80° C. or 75° C. to 80° C., but is not limited thereto.

[0078] In one embodiment of the present invention, the step (c) is performed at a pressure of 100 bar to 1500 bar for 1 to 5 cycles. More specifically, the pressure may be 100 bar to 1500 bar, 200 bar to 1500 bar, 300 bar to 1500 bar, 400 bar to 1500 bar, 500 bar to 1500 bar, 600 bar to 1500 bar, 700 bar to 1500 bar, 800 bar to 1500 bar, 900 bar to 1500 bar, 1000 bar to 1500 bar, 100 bar to 1400 bar, 200 bar to 1400 bar, 300 bar to 1400 bar, 400 bar to 1400 bar, 500 bar to 1500 bar, or 600 bar to 1500 bar. ar to 1400bar, 600bar to 1400bar, 700bar to 1400bar, 800bar to 1400bar, 900bar to 1400bar, 1000bar to 1400bar, 100bar to 1300bar, 200bar to 1300bar, 300bar to 1300bar, 400bar to 1300bar, 500bar to 1300bar, 600bar to 1300bar, 700bar to 1300bar, 800bar to 1300bar, 900bar to 1300bar, 1000bar 1bar to 1300bar, 100bar to 1200bar, 200bar to 1200bar, 300bar to 1200bar, 400bar to 1200bar, 500bar to 1200bar, 600bar to 1200bar, 700bar to 1200bar, 800bar to 1200bar, 900bar to 1200bar, 1000bar to 1200bar, 100bar to 1100bar, 200bar to 1100bar, 300bar to 1100bar, 400bar to 1100bar, 500bar to 1200bar r to 1100bar, 600bar to 1100bar, 700bar to 1100bar, 800bar to 1100bar, 900bar to 1100bar, 1000bar to 1100bar, 100bar to 1500bar, 200bar to 1000bar, 300bar to 1000bar, 400bar to 1000bar, 500bar to 1000bar, 600bar to 1000bar, 700bar to 1000bar, 800bar to 1000bar or 900bar to 1000bar, but is not limited to this.

[0079] The compositions and methods of the above-mentioned embodiments of the present invention relate to compositions comprising sulfur, hesperidin and succinic acid as common active ingredients and methods for preparing the above-mentioned compositions, and the features, definitions and limitations of the common structural elements between the inventions can be commonly applied between the inventions.

[0080] As demonstrated in the specific examples of the present invention, the composition of the present invention has the effect of inhibiting sebum secretion by inhibiting sebum synthesis in pores. The above sebum synthesis inhibition effect depends on the concentration of the composition containing sulfur, hesperidin and succinic acid.

[0081] Furthermore, the composition of the present invention has the effect of inhibiting the generation of acne or inflammation.

[0082] The above results show that the composition comprising sulfur, hesperidin and succinic acid of the present invention is helpful for improving or treating oily skin or acne caused by sebum.

[0083] Furthermore, the composition comprising sulfur, hesperidin and succinic acid of the present invention has excellent dispersibility and formulation stability.

[0084] [Effects of the invention]

[0085] Features and advantages of the present invention are summarized as follows.

[0086] (a) The present invention provides a cosmetic for regulating sebum secretion or improving acne, comprising sulfur, hesperidin and succinic acid as active ingredients.

[0087] (b) The present invention provides a pharmaceutical composition for preventing or treating acne, comprising sulfur, hesperidin and succinic acid as active ingredients.

[0088] (c) The present invention provides an antibacterial composition for Propionibacterium acnes comprising sulfur, hesperidin and succinic acid as active ingredients.

[0089] (d) The present invention provides a method for preparing a composition comprising sulfur, hesperidin and succinic acid.

[0090] (e) When the composition of the present invention comprising sulfur, hesperidin and succinic acid as active ingredients is used, excessive sebum production can be suppressed and excessive sebum production can be regulated. Furthermore, the composition of the present invention comprising sulfur, hesperidin and succinic acid as active ingredients has an extremely excellent antibacterial effect against Propionibacterium acnes, which is a pathogenic bacterium of acne, and can therefore be effectively used as an acne-improving functional cosmetic and acne therapeutic agent containing the composition.

Brief Description of the Drawings

[0091] Figure 1 Comparative results of the stability of the colloidal sulfur complexes with dispersion methods are shown.

[0092] Figure 2 The results are as follows: the expression level of messenger RNA (mRNA) of ACC was measured in sebocytes induced to overproduce sebum by DHT following treatment with colloidal sulfur complex.

[0093] Figure 3 The results are as follows: measurement of the mRNA expression level of FAS in sebocytes induced to overproduce sebum by DHT following treatment with colloidal sulfur complex.

[0094] Figure 4 The results are as follows: measurement of the mRNA expression level of AR in sebocytes induced to overproduce sebum by DHT following treatment with colloidal sulfur complex.

[0095] Figure 5 The effect of the colloidal sulfur complex on keratinization improvement in human skin is shown compared with that of a blank formulation.

[0096] Figure 6 Images of keratin areas in human skin following treatment with empty dosage form and colloidal sulfur complex are shown.

[0097] Figure 7 Shown are the results of measuring the messenger RNA expression level of TLR-2 following the treatment of colloidal sulfur complex in sebocytes induced by LPS.

[0098] Figure 8 An image showing the control area of ​​the P. acnes antibacterial activity test.

[0099] Fig. 9 An image showing the test area for the P. acnes antibacterial activity test.

[0100] Fig.10 The results of confirming the dispersion stability of the essence cosmetic compositions of Example 1 and Comparative Example 1 according to the present invention are shown.

[0101] Fig.11 The results of confirming the sustained stability of the essence cosmetic compositions of Example 1 and Comparative Example 1 according to the present invention are shown. [Specific implementation method]

[0102] The present invention is described in more detail below by way of examples. These examples are only used to describe the present invention in more detail, and it is obvious to a person skilled in the art that the present invention is not limited to these examples according to the gist of the present invention.

[0103] Throughout this specification, unless otherwise specified, “%” is used to express the concentration of a specific substance, solid / solid is (weight / weight)%, solid / liquid is (weight / volume)%, and liquid / liquid is (volume / volume)%.

[0104] [Example]

[0105] [Example 1: Preparation of colloidal sulfur complex]

[0106] The present inventors prepared a colloidal sulfur complex in order to develop an acne-alleviating cosmetic composition containing a colloidal sulfur complex as an active ingredient.

[0107] Specifically, 300 g of 1,3-butylene glycol was added to 50 g of colloidal sulfur and dispersed under ultrasonic conditions of 20 kHz for 1 hour. After slowly adding 649 g of pure water while stirring the dispersion at 4000 rpm at 80°C to 90°C using a mechanical homogenizer, 0.5 g of hesperidin and 0.5 g of succinic acid were added and dissolved for 1 hour. After the above solution was circulated 3 times at a pressure of 1000 bar using a high-pressure disperser (microfluidizer), a colloidal sulfur complex was prepared using a 150 mesh filter. The component contents of the colloidal sulfur complex are shown in Table 1.

[0108]

Table 1

[0109] Ingredient name content(%) Pure water 64.9％ 1,3-Butanediol 30.0％ Colloidal sulfur 5.0％ Hesperidin 0.05％ Succinic acid 0.05％

[0110] [Comparative Example 1: Colloidal sulfur complex without using ultrasonic wave or high pressure disperser]

[0111] In order to compare the stability of the colloidal sulfur complex according to the dispersion method, the present inventors prepared Comparative Example 1 in the same manner as in Example 1 except that ultrasonic waves and a high-pressure disperser were used.

[0112] Specifically, 649 g of pure water and 300 g of 1,3-butanediol were added to 50 g of colloidal sulfur, 0.5 g of hesperidin, and 0.5 g of succinic acid, dissolved by a homogenizer at 80° C. to 90° C., and filtered using 150 mesh to prepare Comparative Example 1.

[0113] [Comparative Example 2: Colloidal sulfur composite without using a high-pressure disperser]

[0114] In order to compare the stability of the colloidal sulfur complex according to the dispersion method, the present inventors prepared Comparative Example 2 in the same manner as in Example 1 except that a high-pressure disperser was used.

[0115] Specifically, 300 g of 1,3-butanediol was added to 50 g of colloidal sulfur and dispersed under ultrasonic conditions of 20 kHz for 1 hour. 649 g of pure water was slowly added while stirring the primary dispersion at 4000 rpm at 80° C. to 90° C. using a mechanical homogenizer, and then 0.5 g of hesperidin and 0.5 g of succinic acid were added and dissolved for 1 hour. The solution was filtered using 150 mesh to prepare Comparative Example 2.

[0116] The results of the stability of the preparation methods of Example 1, Comparative Example 1 and Comparative Example 2 are as follows: Figure 1 shown.

[0117] like Figure 1 As shown, it was confirmed that the preparation according to Example 1 had the most stable dosage form compared with Comparative Example 1 in which the mixture was dissolved by a homogenizer at high temperature and Comparative Example 2 in which the mixture was dissolved by an ultrasonic homogenizer without using a high-pressure disperser.

[0118] [Comparative Example 3: Colloidal sulfur without adding hesperidin and succinic acid]

[0119] In order to compare the efficacy of the colloidal sulfur complex, the present inventors prepared Comparative Example 3 by the same preparation method as that of Example 1, except that hesperidin and succinic acid were not added.

[0120] 300 g of 1,3-butanediol was added to 50 g of colloidal sulfur and dispersed under ultrasonic conditions of 20 kHz for 1 hour. 649 g of pure water was slowly added to dissolve the primary dispersion while stirring the primary dispersion at 4000 rpm at 80° C. to 90° C. using a mechanical homogenizer. The solution was circulated three times at a pressure of 1000 bar using a high-pressure disperser and then filtered using 150 mesh to prepare Comparative Example 3.

[0121] The results of the anti-oily efficacy test of Example 1, Comparative Example 3, the hesperidin treatment group, and the succinic acid treatment group are shown in Table 2.

[0122]

Table 2

[0123]

[0124] As shown in Table 2, it was confirmed that the sample prepared by the method of Example 1 had a superior sebum suppressing ability compared to Comparative Example 3 in which hesperidin and succinic acid were not added, and that the sebum suppressing ability in Example 1 was superior to that in the hesperidin and succinic acid treated group.

[0125] Therefore, such results indicate that the colloidal sulfur complex exhibits a high sebum suppressive ability by a synergistic effect, compared with the group treated with colloidal sulfur, hesperidin, and succinic acid alone.

[0126] [Experimental Example 1: Pore Care: Anti-Oil Efficacy Test – Confirmation of ACC mRNA Expression]

[0127] In order to confirm the inhibitory effect of the colloidal sulfur complex on ACC, a gene related to sebum biosynthesis, the present inventors confirmed the mRNA expression level of ACC following the treatment of the colloidal sulfur complex using real time polymerase chain reaction (Real time PCR).

[0128] Specifically, human sebocytes were inoculated in a 60 mm culture dish and cultured in an incubator at 37°C and 5% CO2 for 24 hours. Then, the culture medium of the cultured cells was replaced with a serum free medium (DMEM / Ham's F12 1:1 (Gibco)), and the cells were treated with the sample and cultured for 24 hours (in an incubator at 37°C and 5% CO2). Dihydrotestosterone was used as an inducing substance to induce excessive sebum production. Using QIAzol TM The cultured cells were collected by Lysis Reagent (Qiagen) and RNA was isolated according to the manufacturer's method. The isolated RNA was quantified and then complementary deoxyribonucleic acid (cDNA) was synthesized and real-time polymerase chain reaction was performed using the following primers.

[0129] SEQ ID NO. name sequence 1 ACC_F CCACTTGGCTGAGCGATT 2 ACC_R CCAGGTCCTC CAGCAGAA

[0130] The results are as follows Figure 2 As shown in Table 3.

[0131]

Table 3

[0132]

[0133] like Figure 2 As shown in Table 3, the ACC inhibitory effect of the colloidal sulfur complex at a concentration of 2% or more was shown to reach the level of normal skin (untreated group) for ACC increased by induction of DHT. In addition, it was confirmed that the ACC inhibitory effect of the colloidal sulfur complex was outstanding compared with the group treated with colloidal sulfur, hesperidin and succinic acid alone.

[0134] Therefore, such results confirmed that the colloidal sulfur complex can effectively inhibit ACC by a synergistic effect compared with the group treated with colloidal sulfur, hesperidin, and succinic acid alone, and the colloidal sulfur complex regulates excessive sebum production caused by hormone imbalance by effectively inhibiting ACC induced by DHT.

[0135] [Experimental Example 2: Pore Care: Anti-Oil Efficacy Test – Confirmation of FAS mRNA Expression]

[0136] In order to confirm the regulatory ability of the colloidal sulfur complex on excess sebum production, the present inventors induced overexpression of fatty acid synthase FAS and then confirmed the mRNA expression level of FAS following the treatment with the colloidal sulfur complex using real-time polymerase chain reaction.

[0137] Specifically, human sebocyte cell lines were inoculated in a 60 mm culture dish and cultured in a constant temperature incubator at 37°C and 5% CO2 for 24 hours. Then, the culture medium of the cultured cells was replaced with a serum-free medium (DMEM / Ham's F12 1:1 (Thermo Fisher Scientific)), and the cells were treated with the sample and cultured for 24 hours (37°C and 5% CO2 constant temperature incubator). DHT was used as an inducing substance to induce excessive sebum production. Using QIAzol TM The cultured cells were collected with a lysis reagent (Qiagen) and RNA was isolated according to the manufacturer's method. The isolated RNA was quantified and then complementary deoxyribonucleic acid was synthesized and real-time polymerase chain reaction was performed using the following primers.

[0138] SEQ ID NO. name sequence 3 FAS_F CGTCCTCTTC CCCGCCAC 4 FAS_R GCACCACATC CTCAAACACC ACA

[0139] The results are as follows Figure 3 As shown in Table 4.

[0140]

Table 4

[0141]

[0142] like Figure 3 As shown in Table 4, FAS, which was increased by induction of DHT, showed a clear tendency to decrease to a level similar to that of normal skin (untreated group) starting from a concentration of 2% or more of the colloidal sulfur complex. In addition, it was confirmed that the expression level of FAS in the colloidal sulfur complex group was significantly reduced compared with the group treated with colloidal sulfur, hesperidin and succinic acid alone.

[0143] Therefore, compared with the colloidal sulfur, hesperidin and succinic acid treatment groups, the colloidal sulfur complex treatment group can effectively inhibit the expression of FAS through a synergistic effect. From this result, it is judged that the colloidal sulfur complex can be used as a raw material for cleaning and maintaining healthy pores by regulating excessive sebum production.

[0144] [Experimental Example 3: Pore Care: Anti-Oil Efficacy Test – Confirmation of AR mRNA Expression]

[0145] In order to confirm the efficacy of the colloidal sulfur complex in regulating sebum by inhibiting androgen receptor expression, the present inventors used real-time polymerase chain reaction to confirm the expression level of AR messenger RNA following the treatment of the colloidal sulfur complex.

[0146] Specifically, human sebocyte cell lines were inoculated in a 60 mm culture dish and cultured in a constant temperature incubator at 37°C and 5% CO2 for 24 hours. Then, the culture medium of the cultured cells was replaced with a serum-free medium (DMEM / Ham's F12 1:1 (Thermo Fisher Scientific)), and the cells were treated with the sample and cultured for 24 hours (37°C and 5% CO2 constant temperature incubator). DHT was used as an inducing substance to induce excessive sebum production. Using QIAzol TM The cultured cells were collected with a lysis reagent (Qiagen) and RNA was isolated according to the manufacturer's method. The isolated RNA was quantified and then complementary deoxyribonucleic acid was synthesized and real-time polymerase chain reaction was performed using the following primers.

[0147] SEQ ID NO. name sequence 5 AR_F CCTGGCTTCC GCAACTTACA C 6 AR_R GGACTTGTGC ATGCGGTACT CA

[0148] The results are as follows Figure 4 As shown in Table 5.

[0149]

Table 5

[0150]

[0151] As shown in Table 5 and Figure 4 As shown, the expression of AR induced by DHT was significantly reduced in the colloidal sulfur complex at a concentration of 3%. In addition, it was confirmed that the colloidal sulfur complex group had a more prominent inhibitory effect on AR expression than the group treated with colloidal sulfur, hesperidin, and succinic acid alone.

[0152] Therefore, the above results indicate that colloidal sulfur complex exhibits an outstanding sebum regulating effect by inhibiting the AR-mediated signaling pathway related to DHT receptors.

[0153] [Experimental Example 4: Pore Care: Skin Exfoliation Test-Clinical (Simplified Clinical Evaluation of Human Skin)]

[0154] In order to confirm the keratin-improving effect of the colloidal sulfur complex at the clinical level, the present inventors conducted a simple clinical evaluation on human skin using the colloidal sulfur complex on three (male) 32-year-old (±4.5 years) subjects.

[0155] Specifically, keratin was sampled from a site with a lot of keratin (inner side of the lower arm) by tape stripping using a tape (B-squam tape), and the keratin sampled before and after application of the colloidal sulfur complex was compared. The keratin was magnified and photographed using a skin scope (Moritex, Japan) (×200 magnification), and the area of ​​the keratin was quantified using the Image J program.

[0156] The results are as follows Figure 5 , Figure 6 As shown in Table 6.

[0157]

Table 6

[0158]

[0159] like Figure 5 , Figure 6 As shown in Table 6, the reduction was 43.5% when the colloidal sulfur complex was treated compared to the empty formulation (vehicle). The improvement rate relative to the empty formulation was calculated as follows.

[0160] Improvement rate relative to empty dosage form (%) = (76.76 / 76.76*100) - (43.36 / 76.76*100)

[0161] The keratin area of ​​the blank dosage form (76.76%) was set as 100%, and the keratin area of ​​the treated sample (43.36%) was calculated. Therefore, the above results indicate that the colloidal sulfur complex is a raw material that has the effect of improving keratin.

[0162] [Experimental Example 5: Anti-acne efficacy test – TLR-2 messenger RNA expression]

[0163] In order to confirm the anti-acne efficacy of the colloidal sulfur complex by inhibiting TLR-2 expression, the present inventors used real-time polymerase chain reaction to confirm the expression level of TLR-2 messenger RNA following the treatment of the colloidal sulfur complex.

[0164] Specifically, human sebocyte cell lines were inoculated in a 60 mm culture dish and cultured in a constant temperature incubator at 37°C and 5% CO2 for 24 hours. Then, the culture medium of the cultured cells was replaced with a serum-free medium (DMEM / Ham's F12 1:1 (Thermo Fisher Scientific)), and the cells were treated with the sample and cultured for 24 hours (37°C and 5% CO2 constant temperature incubator). DHT was used as an inducing substance to induce excessive sebum production. Using QIAzol TMThe cultured cells were collected with a lysis reagent (Qiagen) and RNA was isolated according to the manufacturer's method. The isolated RNA was quantified and then complementary deoxyribonucleic acid was synthesized and real-time polymerase chain reaction was performed using the following primers.

[0165] SEQ ID NO. name sequence 7 TLR-2_F GGCCAGCAAATTACCTGTGT 8 TLR-2_R TTCTCCACCC AGTAGGCATC

[0166] The results are as follows Figure 7 As shown in Table 7.

[0167]

Table 7

[0168]

[0169] like Figure 7 As shown in Table 7, it was confirmed that the 3% concentration of the colloidal sulfur complex showed an effect of suppressing the overexpression of TLR-2 induced by LPS to the level of the untreated group. In addition, it was confirmed that the expression level of TLR-2 in the colloidal sulfur complex-treated group was significantly reduced compared with the group treated with colloidal sulfur, hesperidin, and succinic acid alone.

[0170] Therefore, it was determined that the colloidal sulfur complex inhibits the expression of TLR-2 induced by LPS and is a raw material having an anti-acne effect capable of inhibiting the generation of inflammatory acne.

[0171] [Experimental Example 6: Antibacterial test on Propionibacterium acnes]

[0172] In order to confirm the antibacterial activity of the colloidal sulfur complex against Propionibacterium acnes, which is an acne bacterium, the present inventors measured the bacterial reduction rate following the treatment with the colloidal sulfur complex.

[0173] Specifically, the Propionibacterium acnes strain was cultured in a 5% blood TSA medium under anaerobic conditions at 37° C. for 5 days. The culture conditions of Propionibacterium acnes are shown in Table 8.

[0174]

Table 8

[0175]

[0176] After adding the bacterial solution adjusted for the number of bacteria to the test area and the control area (peptone water) and stirring for 10 seconds, the mixture was placed at room temperature for 30 minutes. The supernatant was then removed by centrifugation at 13,000 rpm for 2 minutes, and phosphate buffered saline (PBS) was added to wash twice. The stock solution was diluted gradiently and inoculated into the culture medium, and the bacterial reduction rate was measured by counting CFU, and the reduction rate was calculated as follows.

[0177] Reduction rate (%) = [(inoculation number - strain after time) / inoculation number] × 100

[0178] The results are as follows Figure 8 , Fig. 9 As shown in Table 9.

[0179]

Table 9

[0180]

[0181] like Figure 8 and Fig. 9 As shown in Table 9, it was confirmed that the number of Propionibacterium acnes in the test area was significantly reduced compared with that in the control area. 4 The inoculum number of CFU / mL was reduced to an inoculum number of 59 CFU / mL, showing a reduction rate of 99.9%.

[0182] Therefore, the colloidal sulfur complex was judged to be a raw material having an anti-acne effect capable of inhibiting acne bacteria.

[0183] [Preparation Example 1: Preparation of cosmetics]

[0184] 【1-1. Preparation of essence】

[0185] An essence containing the colloidal sulfur complex of the present invention as an active ingredient was prepared with the composition shown in Table 10 below.

[0186] Specifically, disodium edetate, glycerin, propylene glycol, and sodium polyacryloyldimethyl taurate were dispersed in pure water and heated to 70°C to 75°C, and then stirred for 5 minutes using an Agi-Mixer. 1,2-hexanediol and ethylhexylglycerin were added at 45°C and stirred for 3 minutes, and then cooled to 30°C. Then, Example 1 and Comparative Example 1 were added, stirred for 3 minutes, and defoamed to prepare an essence formulation.

[0187]

Table 10

[0188]

[0189] [Experimental Example 7. Evaluation of dispersion stability]

[0190] In order to compare the dispersion states of the essences prepared with the compositions of Formulation Example 1 and Comparative Formulation Example 1, the present inventors evaluated the dispersion stability using the principle of multiple light scattering.

[0191] In order to quantify the dispersion stability, the transmittance (transmission) and the amount of backscattering (flux, %) were measured using a particle size dispersion meter (Formulaction, Turbiscan) to compare the dispersion states.

[0192] Specifically, after the prepared dosage form example 1 and comparative dosage form example 1 were filled into a cylindrical glass vial (via), the measurement was performed once every 25 seconds at a temperature of 40° C. for 4 hours, for a total of 577 measurements. The measured transmittance and backscattering results are as follows: Fig.10 As shown in Part A and Part B of .

[0193] Fig.10 The X-axis represents the height of the measuring glass bottle, and the Y-axis represents the transmittance and backscattering value at each height. The transmittance and backscattering value are confirmed at a measured height of 30 mm based on 4 hours. The results are shown in Table 11 below.

[0194]

Table 11

[0195]

[0196]

[0197] like Fig.10 As shown in Table 11, the transmittance of Comparative Formulation Example 1 is low and the backscattering is high, whereas Formulation Example 1 has a high transmittance, indicating that the effect of improving the dispersion within the formulation is excellent.

[0198] [Experimental Example 8. Evaluation of Acceleration Stability]

[0199] In order to confirm the stability of the essence dosage forms prepared with the compositions of the above-mentioned dosage form example 1 and comparative dosage form example 1, the present inventors conducted an accelerated stability evaluation for measuring the degree of redissociation of the dosage forms under centrifugal force.

[0200] In order to evaluate the accelerated stability of the dosage form, the sample was analyzed using a LumiSizer Dispersion Analyser, which is an apparatus for analyzing the stability of a sample under centrifugal force, at 50° C. and 4,000 rpm for about 4 hours.

[0201] The instability index (Instabiity Index) value represents the dispersion stability of the sample. The dispersion stability results of the samples are compared. Fig.11 As shown in Part A, Part B and Table 12.

[0202]

Table 12

[0203] like Fig.11 As shown, in the case of Formulation Example 1, it was confirmed that the change in permeability due to the centrifugal force was small, whereas in the case of Comparative Formulation Example 1, it was confirmed that the change in permeability due to the centrifugal force was large.

[0204] Furthermore, as shown in Table 12, the instability index of Formulation Example 1 is lower than that of Comparative Formulation Example 1. The above results indicate that the stability of Formulation Example 1 is relatively superior.

[0205] Instability Index Dosage Form Example 1 0.280 Comparative dosage form example 1 0.302

Claims

1. A cosmetic composition for regulating sebum secretion or improving acne, comprising sulfur, hesperidin and succinic acid as active ingredients.

2. The cosmetic composition for regulating sebum secretion or improving acne according to claim 1, wherein the sulfur is dispersed in the composition in a colloidal state.

3. The cosmetic composition for regulating sebum secretion or improving acne according to claim 1, wherein the sulfur is contained in a ratio of 0.001 weight percent to 30 weight percent relative to the total weight of the composition.

4. The cosmetic composition for regulating sebum secretion or improving acne according to claim 1, wherein the hesperidin is contained in a ratio of 0.001 weight percent to 30 weight percent relative to the total weight of sulfur. 5 . The cosmetic composition for regulating sebum secretion or improving acne according to claim 1 , wherein the succinic acid is contained in a ratio of 0.001 weight percent to 30 weight percent relative to the total weight of sulfur.

6. A pharmaceutical composition for preventing or treating acne, comprising sulfur, hesperidin and succinic acid as active ingredients.

7. An antibacterial composition for Propionibacterium acnes, comprising sulfur, hesperidin and succinic acid as active ingredients.

8. A method for preparing a composition comprising sulfur, hesperidin and succinic acid, comprising: Step (a), dispersing sulfur in an aqueous solvent to prepare a dispersion; Step (b), adding hesperidin and succinic acid to the dispersion obtained in step (a) and dissolving them; as well as Step (c), high pressure dispersing the solution obtained in step (b).

9. The method for preparing a composition comprising sulfur, hesperidin and succinic acid according to claim 8, wherein in the step (a), ultrasonic dispersion is used.

10. The method for preparing a composition comprising sulfur, hesperidin and succinic acid according to claim 9, wherein the step (a) is performed at a frequency of 1000 Hz to 30000 Hz for 0.5 hour to 5 hours. 11 . The method for preparing a composition comprising sulfur, hesperidin and succinic acid according to claim 8 , wherein the aqueous solvent is one or more aqueous solvents selected from the group consisting of water, propylene glycol, pentanediol and butylene glycol.

12. The method for preparing a composition comprising sulfur, hesperidin and succinic acid according to claim 8, wherein in the step (b), a homogenizer is used for dissolution.

13. The method for preparing a composition comprising sulfur, hesperidin and succinic acid according to claim 12, wherein the step (b) is performed at a rotation speed of 1000 rpm to 5000 rpm for 0.5 hour to 5 hours.

14. The method for preparing a composition comprising sulfur, hesperidin and succinic acid according to claim 8, wherein the step (b) is performed at 40°C to 90°C.

15. The method for preparing a composition comprising sulfur, hesperidin and succinic acid according to claim 8, wherein the step (c) is performed at a pressure of 100 bar to 1500 bar for 1 to 5 cycles.

Images