Marine fungus Nigrogra sp.B143 and application thereof

Abstract

The invention provides a marine fungus Nigrogra sp.B143 and application thereof, and belongs to the technical field of microbial prevention and control. The marine fungus Nigrogra sp.B143 is preserved in the China General Microbiological Culture Collection Center (CGMCC), the address is No.3, yard 1, Beichen West Road, Chaoyang District, Beijing, the preservation date is September 23, 2024, and the preservation number is CGMCC No.41460. The marine fungus Nigrogra sp.B143 is named as Nigrogra sp.B143. The marine fungus Nigrogra sp.B143 is named as Nigrogra sp.B143. The marine fungus Nigrogra sp.B143 provided by the invention is a bacterial strain with a broad-spectrum bacteriostatic effect, and can be used for preventing and treating plant pathogenic bacteria.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial control, and in particular relates to a marine fungus Nigrograna sp. B143 and an application thereof. Background Art

[0002] Aspergillus flavus is a pathogenic fungus and one of the common sources of food contamination. It is often found on moldy food, food products and other foods, causing serious damage to crops, endangering food safety, and easily contaminating food and crops. A. flavus is the main pathogenic fungus that causes food mold. It mainly infects grain and oil crops such as peanuts, corn and nuts before and after harvest and during storage, causing them to mold. Among them, peanuts and corn are the most seriously contaminated, and their edible value and economic value are directly affected by the production of aflatoxins.

[0003] Aflatoxin produced by the secondary metabolism of Aspergillus flavus has carcinogenic, mutagenic and teratogenic properties. The International Agency for Research on Cancer (IARC) has classified it as a Class I carcinogen. It can be found in up to 80% of food crops, causing certain economic losses to agriculture and animal husbandry, and posing a serious threat to the health of animals and humans. Aflatoxin mainly harms the liver of humans and animals, and the degree of damage varies depending on factors such as age and physical condition. It mainly interferes with the synthesis of DNA and RNA, causing chromosomal abnormalities and DNA damage, thereby interfering with the synthesis of biological proteins and finally affecting cell metabolism. Therefore, the prevention and control of aflatoxin contamination has become a very urgent task, and it is of great significance to seek a product that can safely and effectively inhibit Aspergillus flavus. Summary of the invention

[0004] The purpose of the present invention is to provide a marine fungus Nigrograna sp. B143 and its application, so as to provide a new biological material for inhibiting plant pathogens such as Aspergillus flavus.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a marine fungus Nigrograna sp.B143, which is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is September 23, 2024, and the deposit number is CGMCC No.41460.

[0007] The invention provides a crude extract of fermentation liquid of the marine fungus Nigrograna sp. B143.

[0008] The present invention provides a method for preparing the crude extract of fermentation broth, comprising the following steps:

[0009] (1) activating the marine fungus Nigrograna sp. B143 and culturing it in a culture medium to obtain a strain fermentation liquid;

[0010] (2) The obtained fermentation liquid of the strain is separated into solid and liquid, the liquid part and the solid part are extracted with organic solvents respectively, and the organic phase obtained by extraction is dried to obtain a crude extract of the fermentation liquid.

[0011] Preferably, the culture medium in step (1) is PDB liquid culture medium; the temperature during the culture is 25-35°C, the rate is 150-250 rpm, and the time is 15-30 days.

[0012] Preferably, the organic solvent in step (2) is ethyl acetate, and the extraction is performed 1 to 5 times.

[0013] Preferably, in step (2), when the solid part is extracted with an organic solvent, ultrasound is also performed to assist the extraction; the frequency of the ultrasound is 40 to 60 Hz, and the time is 40 to 80 minutes.

[0014] Preferably, the drying method in step (2) is rotary evaporation drying.

[0015] The present invention provides a microbial preparation, which contains the marine fungus Nigrograna sp. B143 or the crude fermentation broth extract or the crude fermentation broth extract prepared according to the method.

[0016] The invention provides an application of the microbial preparation in preventing and controlling plant pathogens.

[0017] Preferably, the plant pathogens include Aspergillus flavus, Fusarium oxysporum, Fusariumfujikuroi, Fusarium solani, banana wilt race 1 pathogen, banana wilt race 4 pathogen, Alternaria alternata, kumquat Botrytis cinerea, pearl plum Botrytis cinerea, pearl plum anthracnose pathogen, mango anthracnose pathogen, Staphylococcus aureus, methicillin-resistant Staphylococcus aureus and Bacillus subtilis.

[0018] The invention provides a marine fungus Nigrograna sp.B143, the strain and the fermentation liquid crude extract of the strain have obvious inhibitory effect on Aspergillus flavus. At the same time, the marine fungus Nigrograna sp.B143 also has obvious inhibitory effect on Aspergillus flavus, Fusarium oxysporum, Fusariumfujikuroi, Fusarium solani, banana wilt species 1 pathogen, banana wilt species 4 pathogen, Alternaria alternata, kumquat Botrytis cinerea, pearl plum Botrytis cinerea, pearl plum anthracnose pathogen, mango anthracnose pathogen, Staphylococcus aureus, methicillin-resistant Staphylococcus aureus and Bacillus subtilis, indicating that the marine fungus Nigrograna sp.B143 provided by the invention is a strain with a broad-spectrum antibacterial effect and can be used for the prevention and treatment of plant pathogens. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0020] Figure 1 This is a schematic diagram of the insert culture in Example 1;

[0021] Figure 2 The morphological diagram of the B143 strain after culture in Example 1, wherein A is the colony morphology of the B143 strain after culture on the PDA medium, and B to E are the thick-walled spore structures of the B143 strain (scale bar is 10 μm);

[0022] Figure 3 The phylogenetic tree constructed based on the ITS, LSU, SSU and TEF1-α sequences using the maximum likelihood method in Example 1;

[0023] Figure 4 It is a schematic diagram of the flat plates facing each other in Example 2;

[0024] Figure 5 The morphology of the B143 strain and Aspergillus flavus after being cultured on PDA medium in Example 2;

[0025] Figure 6 The calculation results of the effect of strain B143 on the colony diameter of Aspergillus flavus and the inhibition rate in Example 2;

[0026] Figure 7 Schematic diagram of the flat plate confrontation method in Example 3;

[0027] Figure 8 The results of the inhibition of the fermentation broth crude extract of the B143 strain on the growth of Aspergillus flavus hyphae in Example 3 are shown;

[0028] Fig. 9 The results of the calculation of the effect of the crude extract of the fermentation broth of the B143 strain on the colony diameter of Aspergillus flavus and the inhibition rate of mycelial growth in Example 3;

[0029] Fig.10 The effect of the crude extract of the fermentation broth of the B143 strain in Example 3 on the germination of Aspergillus flavus spores;

[0030] Fig.11 The calculation result of the germination rate of Aspergillus flavus spores by the crude extract of the fermentation broth of strain B143 in Example 3;

[0031] Fig.12 This is a schematic diagram of the plate design for the cross-seeding method in Example 4;

[0032] Fig.13 The inhibition of 10 plant pathogenic fungi by strain B143 in Example 4;

[0033] Fig.14 The results of calculating the inhibition rate of strain B143 against 10 plant pathogenic fungi in Example 4;

[0034] Fig.15 The inhibitory effect of the B143 strain in Example 5 on Staphylococcus aureus 6538, methicillin-resistant Staphylococcus aureus USA300 and Bacillus subtilis.

[0035] Collection Instructions

[0036] Marine fungus Nigrograna sp.B143, the strain is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, the address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, the preservation date is September 23, 2024, and the preservation number is: CGMCC No.41460. DETAILED DESCRIPTION

[0037] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0038] Example 1 Morphological characteristics and strain identification of B143 strain

[0039] 1. Morphological identification

[0040] The marine microbial strain B143 preserved in the Beibu Gulf Marine Microbial Germplasm Resource Bank (specimen citation: Tonghua community sediment, Nanliujiangkou, Hepu County, Beihai, 2022Ⅳ12) was cultured by the insert culture method (the microbial block was inoculated in the center of the PDA plate, and after the mycelium grew to 1 / 2 of the culture dish, a sterilized cover glass was inserted obliquely, the plate was sealed, and cultured in a 30°C incubator, as shown in the schematic diagram). Figure 1 A temporary slide was prepared (a drop of sterile water was placed in the center of the slide as a floating medium, and a cover slip cultured for 7 days was taken out and placed on the floating medium (mycelium facing downward)). The morphology of hyphae, chlamydospores, conidia, and sporangiophores was observed under a Nikon inverted microscope, and photographs were taken and data were measured.

[0041] Among them, the status of the colony of strain B143 after 40 days of culture on PDA plate is shown in the figure below: Figure 2 As shown in Figure A, it can be seen that the colonies of strain B143 after culture on PDA medium are dark gray, with a colony diameter of only 21-24 mm. The hyphae grow closely to the medium, with more aerial hyphae; the hyphae are separated, branched, colorless, and smooth; no spores were found under normal culture conditions. By adding glutamic acid to the culture medium, thick-walled spores were found to be produced, with a size of (4.17-4.67)×(6.70-10.83) μm ( Figure 2 In B-E, the scale bar is 10 μm).

[0042] 2. Molecular Biology Identification

[0043] The DNA of B143 strain was obtained by the chelex-100 method and amplified with four pairs of primers: ITS1 / ITS4, LROR / LR5, NS1 / NS4 and EF1-983F / EF1-2218R to obtain the sequences of internal transcribed spacer (ITS), large ribosomal subunit (LSU), small ribosomal subunit (SSU) and translation elongation factor EF-1alpha (TEF1-α). The PCR products were sent to Guangzhou BGI Biotechnology Co., Ltd. for sequencing.

[0044] The obtained sequences were aligned in NCBI and related sequences were downloaded. All tree-building sequences were aligned in Clustal X1.83, and the file format was converted to FASTA and ML trees were constructed in MEGA v6.06. The maximum likelihood bootstrap proportions (MLBP) were higher than 50%.

[0045] Among them, the ITS sequence of the B143 strain is shown in SEQ ID NO.1, the LSU sequence is shown in SEQ ID NO.2, the SSU sequence is shown in SEQ ID NO.3, and the TEF sequence is shown in SEQ ID NO.4.

[0046] SEQ ID NO.1: GTTGGAGCTCGCTCCAATCCGGGATAGAACCCTTG CCTTTGAGTACCTCTGTTTCCTCGGTGGCTCGCCCACCGGTGGACAACTCGAAACTCTTGTAGCAGCAGTATCTTCTGAGAAAAATCTTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGA ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTCGGAATTCCGTTGGGCATGCCTGTTCGAGCGTCATTTGCATATTCAAGCCCAGCTTGGTGTTGGGTGCTTGTCCCCCCGCTCGGTGGCGGACTCACCTCAAATGCATTGGCGGCCGGTATGTTGAGCTACAGCGCA

[0047] SEQ ID NO.2:CAACAGGGATTGCCCTAGTAACGGCGAGTGAAGC GGCAACAGCTCAAATTTGAAATCTGGCCCTTTCAGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGTGTTGGCCGCAGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCTGATGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGATCAGACTTGCTCGTAGTTGCTCATCTAGGCTCTTGCCTGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGCTGGATAAAGGCCTCTATCACGTATCTTCCTTCGGGATGACCTTATAGGGGAGGCGTAATGCAGCCAGCTCGGATTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGATCGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTCACGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAAC TATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAAC

[0048] SEQ ID NO.3:CCAATGCCCTTCGGGGCTCTTTGGTGATTCATGAT AACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTTCTGGAGATCCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTGTGAACAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGG

[0049] SEQ ID NO.4: TACCAGGAGATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGATACAACCCCAAGACTGTTCCCTTTGTCCCCATCTCCGGCTTCAACGGTGACAACATGATCGAGGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGTCTAAGTCCACTGGTAAGACCCTCCTCGAGGCTATCGACGCTATCGACCCACCAACCCGTCCCTCCGACAAGCCTCTCCGTCTTCCTCTCCAGGATGTGTACAAGATTGGCGGTATTGGCACGGTCCCAGTCGGTCGTGTCGAGACCGGTGTCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCTGCTGGTGTTACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTTGCTGAGGGTCTTCCCGGTGACAACGTTGGATTCAACGTCAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCTGGTGACTCCAAGACCGACCCTCCCAAGGGCTGCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGCCAGGTCGGTGCTGGTTACGCTCCAGTCTTGGATTGCCACACGGCCCACATTGCCTGCAAGTTCTCTGAGCTCTTGGAGAAGATCGATCGACGAACTGGCAAGTCTGTTGAAGACAGCCCCAAGTTCATCAAGTCTGGTGATGCCGCTATCGTCAAGATGATTCCCTCCAAGCCCATGTG

[0050] Based on the ITS, LSU, SSU, and TEF1-α sequences, a phylogenetic tree was constructed using the maximum likelihood method with the K2 model. The results are as follows Figure 3As shown, it can be seen that strain B143 and MN047085Nigrograna rhizophorae MFLU 19-1233 are clustered in the same branch, and its maximum likelihood support rate is only 68%, but the ITS similarity between this specimen and MN047085Nigrogranarhizophorae MFLU 19-1233 is 94.92%. Therefore, strain B143 is tentatively identified as a new species in the marine fungus Nigrograna sp.

[0051] Example 2 Antibacterial effect of strain B143 on Aspergillus flavus

[0052] The flat plate confrontation method (schematic diagram as shown in Figure 4 A hole with a diameter of 0.4 cm was punched on both sides of the PDA plate at a distance of about 1 cm from the edge, the agar block was taken out, and the same hole was used to punch out the B143 strain cake with the same diameter. The cake was inoculated into one of the holes on one side. After culturing in a 30°C incubator for 2 days, 5 μL of Aspergillus flavus spore suspension (10 8 CFU / mL), and after culturing in a 30°C incubator for 5 days, the diameter was observed, measured, photographed, and recorded, and the inhibition rate was calculated (the control group was the treatment group inoculated only with the Aspergillus flavus spore suspension).

[0053]

[0054] The morphology of B143 strain and Aspergillus flavus after culture on PDA medium is as follows Figure 5 As shown in the figure, the diameter of the Aspergillus flavus colony after cultivation and the calculation results of the inhibition rate of Aspergillus flavus are shown in the figure. Figure 6 As shown, it can be seen that the B143 strain can significantly inhibit the growth of Aspergillus flavus, and its inhibition rate is as high as 43.85±8.03%.

[0055] Example 3 Inhibitory effect of crude extract of fermentation broth of strain B143 on Aspergillus flavus

[0056] 1. Preparation of crude strain extracts

[0057] After the B143 strain was activated, it was inoculated into a 500 mL conical flask containing 300 mL of PDB liquid culture medium, and cultured with shaking at 30° C. and 200 rpm for 21 days to obtain a fermentation liquid of the B143 strain.

[0058] The obtained strain fermentation broth was filtered, the supernatant was separated from the mycelium, and the supernatant was extracted 3 times with an equal volume of ethyl acetate to obtain 3 organic phases; 2 volumes of ethyl acetate were added to the mycelium, ultrasonicated at 220V and 50Hz for 60 minutes, soaked overnight, the liquid was collected, and the process was repeated 2 times to obtain 3 organic phases; the organic phase obtained by supernatant extraction and the organic phase obtained by mycelium soaking were combined and then rotary evaporated on a rotary evaporator to an extract state, dried, and a crude extract of the fermentation broth of the B143 strain was obtained and stored at 4°C for later use.

[0059] 2. Effect of crude extract of fermentation broth on the growth of Aspergillus flavus hyphae

[0060] By the plate standoff method (schematic diagram as shown Figure 7 The effect of crude extract of fermentation broth on the growth of Aspergillus flavus hyphae was determined. First, the crude extract obtained by extraction was dissolved in chromatographic methanol to 50 mg / mL. A hole with a diameter of 0.4 cm was punched on both sides of the PDA plate at a distance of about 1 cm from the edge and in the center. The agar block was taken out and 50 μL of crude extract with a concentration of 50 mg / mL was inoculated in the holes on both sides. The control group was inoculated with pure methanol solvent and 5 μL of Aspergillus flavus spore suspension (10 8 CFU / mL), and after culturing in a 30°C incubator for 5 days, the diameter of the Aspergillus flavus colony was measured, observed and photographed, and the inhibition rate was calculated (the control group was the treatment group inoculated only with the Aspergillus flavus spore suspension).

[0061] The results of the inhibition of the fermentation broth extract of strain B143 on the growth of Aspergillus flavus hyphae are as follows: Figure 8 The diameter of the Aspergillus flavus colony after cultivation and the calculation results of the inhibition rate of Aspergillus flavus are shown in Fig. 9 It can be seen that the crude extract of the fermentation broth of strain B143 can significantly inhibit the growth of Aspergillus flavus hyphae, with an inhibition rate of 28.90±3.76%, indicating that strain B143 can produce metabolites that have an inhibitory effect on Aspergillus flavus.

[0062] 3. Effect of crude extract of fermentation broth on spore germination of Aspergillus flavus

[0063] Pipette 100 μL of Aspergillus flavus spore suspension (10 8 CFU / mL), inoculated into 900 μL PDB medium containing crude extract of fermentation broth, so that the final concentration of crude extract of fermentation broth was 25 mg / mL, while the control group was not added with crude extract of fermentation broth, and cultured at 30°C constant temperature shaker, 200 rpm for 24 h, and the spore germination was observed under an optical microscope and the spore germination rate was calculated.

[0064] Effects of crude extracts from fermentation broth of strain B143 on the germination of Aspergillus flavus spores Fig.10The calculation results of spore germination rate and spore germination inhibition rate of the fermentation broth crude extract of strain B143 are shown in Fig.11 As shown. It can be seen that there is a significant difference in the germination rate of Aspergillus flavus spores between the PDB control group and the group with crude extract of fermentation broth of B143 strain (P<0.01), and the crude extract of fermentation broth of B143 strain has a very significant inhibitory effect on the germination of Aspergillus flavus spores; the germination rate of Aspergillus flavus spores in the control group reached 97.44±4.44%, while the germination rate of Aspergillus flavus spores in the group with crude extract of fermentation broth of B143 strain was only 1.73±0.09%, and its inhibition rate on the germination of Aspergillus flavus spores was as high as 98.23±0.10%.

[0065] Example 4 Inhibitory Effect of B143 Strain on Plant Pathogenic Fungi

[0066] The cross-inoculation method was used (schematic diagram as shown in Fig.12 As shown in the figure, A represents B143 strain and B represents plant pathogenic fungi). B143 strain was plated opposite to 10 plant pathogenic fungi. After being cultured in an incubator at 30°C for 7 days, photos were taken and the colony diameters of plant pathogenic fungi were measured to calculate the inhibition rate of B143 strain on plant pathogenic fungi.

[0067] Fig.13 and Fig.14 The results are as follows: the inhibition of B143 strain on 10 plant pathogenic fungi and the calculation results of the inhibition rate. It can be seen that B143 strain can inhibit the growth of mycelium of F.oxysporum, F.fujikuroi, F.solani, banana wilt species 1 pathogen, banana wilt species 4 pathogen, Alternaria, kumquat Botrytis cinerea, pearl plum Botrytis cinerea, pearl plum anthracnose pathogen and mango anthracnose pathogen, that is, B143 strain has a significant inhibitory effect on these 10 plant pathogenic fungi, and its inhibition rate is higher than 10%, and the inhibition rate of B143 strain on F.fujikuroi, banana wilt No. 4, Alternaria, kumquat Botrytis cinerea, and mango anthracnose pathogen is higher than 30%, and the inhibition rate on Alternaria is the highest, which is 42.15±1.01%.

[0068] Example 5 Inhibitory Effect of B143 Strain on Plant Pathogenic Bacteria

[0069] After activation, the plant pathogenic bacteria were inoculated into a 250 mL conical flask containing 100 mL LB liquid culture medium. After shaking culture for 24 h, 1 mL of the bacterial suspension was aspirated and added to the potato dextrose agar culture medium cooled to 50 °C. After shaking well, the plate was poured to make a plate with bacteria. The B143 strain was inoculated in the center of the plate. After culture in a 30 °C incubator for 7 days, the diameter of the transparent circle around the colony of the B143 strain was observed and measured, and photographed and recorded.

[0070] Fig.15 This is the inhibitory effect of strain B143 on Staphylococcus aureus 6538, methicillin-resistant Staphylococcus aureus USA300 and Bacillus subtilis. It can be seen that obvious transparent circles can be observed around strain B143, indicating that strain B143 has inhibitory effects on Staphylococcus aureus 6538, methicillin-resistant Staphylococcus aureus USA300 and Bacillus subtilis, among which the transparent circle to Bacillus subtilis is the largest, with a diameter of 2.0 cm.

[0071] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A marine fungus Nigrograna sp.B143, which is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is September 23, 2024, and the deposit number is CGMCC No.41460.

2. A crude extract of the fermentation broth of the marine fungus Nigrograna sp. B143 according to claim 1.

3. A method for preparing the crude extract of fermentation broth according to claim 2, characterized in that: The steps include: (1) activating the marine fungus Nigrograna sp. B143 and culturing it in a culture medium to obtain a strain fermentation liquid; (2) The obtained fermentation liquid of the strain is separated into solid and liquid, the liquid part and the solid part are extracted with organic solvents respectively, and the organic phase obtained by extraction is dried to obtain a crude extract of the fermentation liquid.

4. The method according to claim 3, characterized in that The culture medium in step (1) is PDB liquid culture medium; the temperature during the culture is 25-35°C, the speed is 150-250rpm, and the time is 15-30d.

5. The method according to claim 4, characterized in that In step (2), the organic solvent is ethyl acetate, and the extraction is performed 1 to 5 times.

6. The method according to claim 5, characterized in that In step (2), when the solid part is extracted with an organic solvent, ultrasound is also performed to assist the extraction; the frequency of the ultrasound is 40 to 60 Hz, and the time is 40 to 80 minutes.

7. The method according to any one of claims 3 to 6, characterized in that: The drying method in step (2) is rotary evaporation drying.

8. A microbial preparation, characterized in that: The microbial preparation comprises the marine fungus Nigrograna sp. B143 according to claim 1 or the crude fermentation broth extract according to claim 2 or the crude fermentation broth extract prepared according to any one of claims 3 to 7.

9. Use of the microbial preparation according to claim 8 in controlling plant pathogens.

10. The use according to claim 9, characterized in that The plant pathogens include Aspergillus flavus, Fusarium oxysporum, Fusarium fujikuroi, Fusarium solani, banana wilt species 1 pathogen, banana wilt species 4 pathogen, Alternaria alternata, kumquat Botrytis cinerea, pearl plum Botrytis cinerea, pearl plum anthracnose pathogen, mango anthracnose pathogen, Staphylococcus aureus, methicillin-resistant Staphylococcus aureus and Bacillus subtilis.

Images