Universal chimeric antigen receptor T cell

Abstract

The invention discloses a universal chimeric antigen receptor T cell, the universal chimeric antigen receptor comprises an extracellular region, a transmembrane region and an intracellular region, the intracellular region comprises an intracellular signal transduction region, and the intracellular region further comprises a lectin-like transcript 1 (LLT1) molecule directly or indirectly connected to the tail end of the intracellular signal transduction region. When being applied to clinical treatment, the universal CAR-T cell provided by the invention can be put into standardized mass production, and T lymphocytes of a patient do not need to be collected during treatment, so that the universal CAR-T cell is not limited by the condition of the patient and a treatment method. And the patient selecting the universal CAR-T can be treated in time without delaying the illness state. Healthy human lymphocytes have higher activity and functions, and the universal CAR-T prepared from the healthy human lymphocytes can have higher CAR positive rate and cell proliferation level, so that the universal CAR-T can play a more remarkable treatment effect on the condition of a patient.

Description

Technical Field

[0001] The present disclosure relates to the field of biomedicine, and in particular, to a universal chimeric antigen receptor T cell. Background Art

[0002] Chimeric antigen receptor T cell technology is based on T lymphocytes isolated from blood circulation, which are then engineered to express chimeric antigen receptors (CARs), enabling the modified T lymphocytes to recognize and respond to cancer cells independently of the involvement of the major histocompatibility complex (MHC). After in vitro proliferation, these cells are re-infused into the patient to drive an anti-tumor immune response. The first generation of CAR uses an extracellular antigen binding domain (usually a single-chain variable fragment of an antibody), a transmembrane domain, and an intracellular signaling domain CD3z chain. The second generation of CAR adds co-stimulatory molecules such as CD28 / 4-1BB / OX40, which improves the anti-tumor ability and survival ability of CAR-T cells in vivo. The third generation CAR structure is formed by pairing co-stimulatory molecules. The fourth generation CAR is further modified to enhance cell viability by secreting cytokines and activate other immune cells. CAR-T cells are usually transduced using viral vectors, most of which are lentiviral vectors, which have good transfection efficiency and stable expression.

[0003] Autologous CAR-T cell therapy often has defects due to dysfunction and tumor contamination, which affects the safety and effectiveness of the treatment. Allogeneic T cells have a TCR-MHC barrier, which may lead to severe graft-versus-host disease (GVHD), with large side effects and short duration. Currently, CRISPR / Cas9 or TALEN technology can be used to simultaneously knock out multiple genes in T cells, inactivate T cell antigen receptors (TCR) and major histocompatibility complexes (MHCⅠ, MHCⅡ) to reduce immune rejection reactions. Safe and effective universal CAR-T cells. However, despite this, universal CAR-T cells with HLAⅠ and HLAⅡ knocked out will cause allogeneic NK cells to "recognize" and "attack", causing NK cells to recognize universal CAR-T cells and eliminate them, which will reduce the anti-tumor effect of CAR-T cells. The current methods are to resist NK cell toxicity by retaining some HLA genes such as HLA-C / HLA-E / HLA-F / HLA-G, but this method increases the risk of graft-versus-host disease (GVHD). Therefore, the above-mentioned technical problems have become the main constraints on the application of allogeneic universal CAR-T technology, and solving this problem has become a top priority. Summary of the invention

[0004] Technical issues solved:

[0005] One aspect of the present invention is to provide a new universal chimeric antigen receptor T cell to address the problem of poor therapeutic effect of universal CAR-T cell therapy in the prior art.

[0006] Specifically, in the prior art, autologous chimeric antigen receptor T (CAR-T) cells have limitations such as tumor cell contamination of leukocytes, low activity and quality of T cells caused by chemotherapy, possible preparation failure, and delayed treatment of blood diseases. Allogeneic therapy refers to cells derived from individuals of the same species but with different genes. Since healthy donors have a large number of T lymphocytes and good functions, CAR-T can be guaranteed to have a high infection efficiency, proliferation ability, and anti-tumor ability in the body. However, due to the immunogenetic differences between donors and recipients, the infusion of allogeneic CAR-T cells into patients can cause host versus graft reaction (HVGR) and graft versus host reaction (GVHR). HVGR and GVHR-related genes include TCR and major histocompatibility complex (MHCⅠ, MHCⅡ)-related genes. The single TRAC gene is a gene encoding the TCR α chain and forms a complete functional TCR complex with the two TRBC genes encoding TCRβ. Knocking out TRAC is the optimal solution to achieve TCR inactivation. B2M and CIITA are MHCⅠ and MHCⅡ-related genes, respectively. T lymphocytes with the above three genes knocked out at the same time will not cause graft-versus-host disease (GVHD) when they are re-infused into allogeneic patients.

[0007] Universal CAR-T cells that knock out HLAⅠ and HLAⅡ will cause "recognition" and "attack" of allogeneic NK cells, causing NK cells to recognize and eliminate universal CAR-T cells, which will reduce the anti-tumor effect of CAR-T cells. The lectin-like transcript 1 (LLT1) gene is overexpressed in the disclosed technical solution. Experiments have verified that after universal CAR-T cells overexpress LLT1 molecules, CAR-T cells still maintain good proliferation, expansion, and killing abilities, while having low immunogenicity and good resistance to NK cell lysis, thereby solving the above problems.

[0008] Technical solution:

[0009] A universal chimeric antigen receptor T cell, wherein the universal chimeric antigen receptor comprises an extracellular region, a transmembrane region and an intracellular region, wherein the intracellular region comprises an intracellular signal transduction region, and wherein the intracellular region further comprises a lectin-like transcript 1 (LLT1) molecule directly or indirectly connected to the end of the intracellular signal transduction region.

[0010] In certain embodiments of the present disclosure, the intracellular region may further comprise a lectin-like transcript 1 (LLT1) molecule connected to a terminal end of the intracellular signal transduction region via a linker, and the linker is selected from a P2A peptide.

[0011] In certain embodiments of the present disclosure, the genome of the T cell may not contain a gene encoding a protein bound by the binding domain in the extracellular region.

[0012] Preferably, in certain embodiments of the present disclosure, the above-mentioned protein can be selected from CD38, CD5, CD7, CD19, CD20, CD22, CD32b, CD33, CD64, CD123, mesothelin, Her2, CA125, GD2, Claudin18.2 or EGFR.

[0013] In certain embodiments of the present disclosure, the genome of the T cell may not contain genes encoding B2M, CIITA and TRAC.

[0014] Preferably, in one embodiment of the present disclosure, the universal chimeric antigen receptor in the universal chimeric antigen receptor T cell can express a lectin-like transcript 1 (LLT1) molecule;

[0015] The genome of the T cell in the universal chimeric antigen receptor T cell may not include:

[0016] 1) a gene encoding a protein bound by the binding domain in the extracellular region, and

[0017] 2) Genes encoding B2M, CIITA and TCR.

[0018] In certain embodiments of the present disclosure, the T cells may be derived from T cells isolated from blood or induced pluripotent stem cells (iPSCs).

[0019] In certain embodiments of the present disclosure, the universal chimeric antigen receptor may be a first generation CAR, a second generation CAR, a third generation CAR, or a fourth generation CAR.

[0020] Another aspect of the present disclosure is to provide a method for preparing the universal chimeric antigen receptor T cell, comprising:

[0021] Step 1) constructing a viral expression vector according to the sequence of the universal chimeric antigen receptor and packaging it;

[0022] Step 2) constructing a gene editing system;

[0023] Step 3) using an electroporation system to transfer the RNP obtained in step 2) into the separated T lymphocytes;

[0024] Step 4) The cells obtained in step 3) are cultured under conventional conditions for 24 hours and then collected, and the collected cells are infected with the virus obtained in step 1), and the cells are cultured and sorted to obtain the universal chimeric antigen receptor T cells.

[0025] Another aspect of the present disclosure is to provide use of the universal chimeric antigen receptor T cell in preparing a drug for treating tumors.

[0026] Preferably, in certain embodiments of the present disclosure, the tumor is a blood tumor.

[0027] Further preferably, in certain embodiments of the present disclosure, the tumor is multiple myeloma, acute lymphocytic leukemia, acute myeloid leukemia, non-Hodgkin's lymphoma or chronic lymphocytic leukemia.

[0028] Beneficial effects:

[0029] When the universal CAR-T cells provided by the present disclosure are applied to clinical treatment, they can be put into standardized mass production, and there is no need to collect the patient's T lymphocytes during treatment, so they are not limited by the patient's condition and treatment methods. Patients who choose universal CAR-T can receive timely treatment without delaying their condition. Healthy human lymphocytes have higher activity and function, and the universal CAR-T prepared in this way can have a higher CAR positivity rate and cell proliferation level, thus having a more significant therapeutic effect on the patient's condition. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is a graph showing the positive rate of CAR-T cells 48 hours after viral infection in the disclosed embodiment;

[0031] Figure 2 This is a diagram showing the expression detection results using MHCⅠ, MHCⅡ, CD3, and CD38 antibodies after CRISPR / Cas9 knocked out B2M, CIITA, TRAC, and CD38 on the surface of CAR-T cells in the disclosed embodiment;

[0032] Figure 3 This is a flow chart for preparing universal CAR-T cells in the embodiments of the present disclosure;

[0033] Figure 4 This is a flow cytometry result diagram of 99% negative CAR-T after negative sorting in the disclosed embodiment;

[0034] Figure 5Schematic diagram of the in vitro proliferation of universal CAR-T cells in the disclosed embodiments, wherein CD38 CAR-T is a CAR structure that only expresses the CD38-targeting CAR, 1KO CAR-T is a CD38-targeting CAR-T with CD38 knocked out, and 4KO CAR-T is a CD38-targeting CAR-T with TCR & HLAⅠ & HLAⅡ & CD38 knocked out;

[0035] Figure 6 This is a graph showing the specific killing effect of universal CAR-T on CD38-positive tumor cells in the embodiments of the present disclosure;

[0036] Figure 7 This is a result diagram of the in vivo anti-tumor effect of universal CAR-T cells in the embodiments of the present disclosure;

[0037] Figure 8 This is a graph showing the immunogenicity test results of allogeneic PBMC induced by universal CAR-T in the embodiments of the present disclosure;

[0038] Fig. 9 This is a graph showing the results of detecting the ability of universal CAR-T cells to kill allogeneic NK cells in the disclosed embodiments. DETAILED DESCRIPTION

[0039] This article discloses a universal chimeric antigen receptor T cell, and those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be particularly pointed out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention, and relevant personnel can obviously modify or appropriately change and combine the contents described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0040] In the present disclosure, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Unless otherwise expressly stated, throughout the specification and claims, the term "comprising" or its variations such as "including" or "including" etc. will be understood to include the elements or components stated, without excluding other elements or other components. The term "a", "an" and "the" include plural indicators. The term "multiple" refers to two (kinds) or more (kinds). The terms "such as", "for example" etc. are intended to refer to exemplary embodiments, and are not intended to limit the scope of the present disclosure.

[0041] In the present disclosure, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Definitions of common terms in molecular biology can be found in Lewin's GENES XII, Jocelyn E. Krebs / Elliott S. Goldstein / Stephen T. Kilpatrick, published by Jones & Bartlett, 2018.

[0042] Chimeric Antigen Receptor T Cells:

[0043] The term "chimeric antigen receptor T cells" or "CAR-T" or "Chimeric antigen receptor T cells" in the present disclosure may also be referred to as engineered immune T cells.

[0044] The chimeric antigen receptor is a recombinant polypeptide (or artificial fusion protein) comprising at least an antigen binding domain. The domain is connected to the signal activation portion via a hinge and a transmembrane domain. The antigen binding domain can be in various forms. For example, in certain embodiments of the present disclosure, the antigen binding domain is Fab, Fab', F(ab')2, Fd, FCL, dAb, single-chain antibody scFv, chimeric antibody, humanized antibody or fully human antibody. It can be monovalent or multivalent, and it can competitively bind to the target molecule and produce an effect different from that of a monovalent antibody. The multivalent antibody can be obtained, for example, by protein fusion, adding a connector, a covalent bond or a non-covalent bond.

[0045] With the development, chimeric antigen receptors have appeared in many different forms (or generations), see Kevin Pan.et al.CAR race to cancer immunotherapy:from CAR T,CAR NK to CARmacrophage therapy.J Exp Clin Cancer Res.2022Mar 31;41(1):119. In certain disclosed embodiments, the chimeric antigen receptor may be a first-generation CAR, that is, the chimeric antigen receptor is composed of an extracellular antigen binding domain, a transmembrane domain, and an intracellular signaling domain. In other embodiments of the present disclosure, the chimeric antigen receptor may be a second-generation CAR, that is, on the basis of the first-generation CAR, the intracellular region in the chimeric antigen receptor structure adds a co-stimulatory molecule, thereby improving the anti-tumor ability and in vivo survival ability of CAR-T cells. In other embodiments of the present disclosure, the chimeric antigen receptor may be a third-generation CAR, that is, on the basis of the first-generation CAR, two series of co-stimulatory molecules are added to increase T cell proliferation activity, cytotoxicity, and prolong T cell survival time. In other embodiments of the present disclosure, the chimeric antigen receptor may be a fourth-generation CAR, that is, based on the third-generation CAR, the CAR is further modified to enhance cell viability and activate other immune cells by secreting cytokines.

[0046] In certain embodiments of the present disclosure, the hinge region in the chimeric antigen receptor may be a hinge region sequence in a CD8α molecule.

[0047] In certain embodiments of the present disclosure, the transmembrane region in the chimeric antigen receptor may be a transmembrane domain selected from the following proteins or a sequence having 90% or more identity with the proteins and having the same biological function as the proteins: α, β or ζ chain of T cell receptor, CD2, CD3ε, CD4, CD7, CD8α, CD8β, CD11a, CD11b, CD11c, CD11d, CD18, CD19, CD27, CD28, CD29, CD30, CD40, CD48, CD49a, CD49d, CD49f, CD66a, CD66b, CD66c, CD66d, CD66e, CD69, CD79A, CD79B, CD84, CD96 , CD100, CD103, CD134, CD137, CD150, CD158A, CD158B1, CD158B2, CD158C, CD158D, CD158F1, CD158F2, CD158K, CD160, CD162, CD226, CD229, CD244, CD247, CD258, CD268, CD270, CD272, CD276, CD279, CD314, CD319, CD335, CD336, CD337, CD352, CD353, CD355, CD357, LFA-1, NKG2C, DAP-10, ICAM-1, NKp80, IL-2R beta, IL-2Rgamma, IL-7R alpha, LFA-1, SLAMF9, LAT, GADS, SLP-76, PAG1 / CBP, CD83 ligand, Fc gamma receptor, integrin, activating NK cell receptor or Toll ligand receptor, or a combination thereof. Preferably, the transmembrane region is a transmembrane region sequence in a CD8α molecule.

[0048] In certain embodiments of the present disclosure, the co-stimulatory molecule in the chimeric antigen receptor can be one or more of the functional signaling domains selected from the following proteins or sequences having more than 90% identity with the proteins and having the same biological functions as the proteins: integrin, BTLA, Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1, 4-1BB, B7-H3, CD278, GITR, BAFFR, LIGHT, HVEM, KIRDS2, SLAMF7, NKp80, NKp44, NKp30, NKp46, CD19, CD4, CD8α, CD8β, IL2Rβ, IL 2Rγ, IL7Rα, ITGA4, VLA1, CD49α, IA4, CD49D, ITGA6, VLA6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11α, ITGAM, CD11b, ITGAX, CD11c, CD29, ITGB1, ITGB2, CD18, ITGB7, NKG2D, NKG2C, TNFR2, CD226, CD84, CD96, CEACAM1, CRTAM, CD229, CD160, PSGL1, CD100, CD69, SLAMF6, SLAM, BLAME, CD162, LTBR, ​​LAT, GADS or SLP-76. Preferably, the co-stimulatory factor is CD28 or 4-1BB.

[0049] In certain embodiments of the present disclosure, the intracellular signal transduction region in the chimeric antigen receptor can be selected from the following proteins or sequences having more than 90% identity with the proteins and having the same biological function as the proteins: 4-1BB, B7-H3, BAFFR, BLAME, BTLA, CD100, CD103, CD160, CD18, CD19, CD19a, CD2, CD247, CD27, CD276, CD28, CD29, CD3ζ, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8alpha, CD8beta, CD96, CDS, CEACAM1, CRTAM, DAP-10, DNAM1, Fc gamma receptor, GADS, GITR, HVEM, IA4, ICAM-1, ICAM-1, Ig alpha, IL2R beta, IL2R gamma, IL7R alpha, integrin, ITGA4, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, KIRDS2, LAT, LFA-1, LFA-1, LIGHT, LIGHT, LTBR, ​​Ly9, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80, OX-40, PAG / Cbp, PD-1, PSGL1, SELPLG, SLAMF4, SLAMF6, SLAMF7, SLP-76, TNFR2, Toll ligand receptor, TRANCE / RANKL, VLA1 or VLA-6, or a combination thereof. Preferably, the intracellular signal transduction region is CD3ζ.

[0050] In certain embodiments of the present disclosure, amino acid modifications may be made to chimeric antigen receptor protein molecules to produce functionally equivalent variants that do not significantly affect their properties. Examples of such modifications include conservative substitutions (replacements) of amino acid residues, deletions or additions of one or more amino acids that do not significantly change the functional activity of the antibody or mature the affinity of the antibody for its target antigen. Examples of amino acid residues that are mutually conservatively substituted (replaced) may be amino acids in the following groups, 1) alanine (A), glycine (G); 2) aspartic acid (D), glutamic acid (E); 3) asparagine (N), glutamine (Q); 4) arginine (R), lysine (K); 5) isoleucine (I), leucine (L), methionine (M), valine (V); 6) phenylalanine (F), tyrosine (Y), tryptophan (W); 7) serine (S), threonine (T); and 8) cysteine ​​(C), methionine (M).

[0051] The present disclosure also provides an isolated nucleic acid molecule encoding the chimeric antigen receptor. The preparation method can be based on the base sequences of the above-mentioned antigen recognition region, hinge region, transmembrane region and intracellular signal region, and prepared by known techniques such as chemical synthesis or PCR amplification. Generally, the codons encoding the amino acids of the above-mentioned domains can be optimized to optimize their expression in host cells. The information of the above-mentioned base sequence can be obtained by searching known literature or databases such as NCBI (https: / / www.ncbi.nlm.nih.gov / ).

[0052] The present disclosure also provides a vector, which comprises the above nucleic acid molecule.

[0053] In certain embodiments of the present disclosure, the vector may be a linear vector or a circular vector. It may be a non-viral vector such as a plasmid, a viral vector, or a vector using a transposon. The vector may contain regulatory sequences such as a promoter and a terminator, as well as marker sequences such as a drug resistance gene and a reporter gene. In addition, the above-mentioned vector may also contain a sequence encoding a suicide gene, and the number of CAR-T cells in the body may be controlled by administering a substance that activates the suicide gene according to the treatment process.

[0054] The viral vector may be a plasmid vector, a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, etc. In one embodiment of the present invention, a lentiviral expression vector is used.

[0055] In certain embodiments of the present disclosure, the T cells are human T cells. The T cells can be obtained from body fluids such as blood and bone marrow, or from tissues such as spleen, thymus, lymph nodes, or cancer tissues such as primary tumors, metastatic tumors, and cancerous ascites, after separation and purification. Preferably, the T cells are autologous T cells. At the same time, the T cells can be CD4 + T cells, CD8 + T cells, αβT cells or γδT cells, or a mixture of the above multiple types of T cells.

[0056] The present disclosure also provides a pharmaceutical composition. The pharmaceutical composition refers to a composition that contains at least one other substance in addition to the chimeric antigen receptor T cells described in the present disclosure. The other substance can be, for example, a pharmaceutically acceptable carrier, an excipient, physiological saline, a cell culture medium, glucose, water for injection, glycerol, ethanol and their combination, a stabilizer, a surfactant, a preservative, an isotonic agent, etc. It can also be other therapeutic agents, for example, chemotherapeutic drugs: melphalan, doxorubicin, cyclophosphamide, vincristine, etc.; glucocorticoid drugs: prednisone, dexamethasone, etc.; immunomodulatory drugs: thalidomide, lenalidomide, pomalidomide, etc.

[0057] In the present disclosure, the term "does not include" refers to the fact that a genome naturally or artificially does not include a certain gene or several genes. The artificial cause is the directional destruction of genes in cells or in vivo, resulting in complete loss of their function. Targeted destruction can be achieved using suitable methods in the prior art, including but not limited to, rendering the target gene non-functional by inserting an unrelated gene into the target gene, such as by homologous recombination, or by any other method of destroying gene function in cells; RNAi method, i.e., a method of using small RNA molecules to silence or degrade the messenger RNA (mRNA) of the target gene to prevent it from being translated into protein; gene editing methods based on the CRISPR system, for example, the CRISPR / Cas9 system, which uses guide RNA (sgRNA) and Cas9 enzymes to introduce targeted DNA breaks at specific locations in the genome, resulting in gene destruction.

[0058] CRISPR (Clustered Regularly Interspaced Short Repeats) is a new genome engineering tool developed based on the adaptive immune system components of the bacterium S. pyogenes. This tool contains multiple components, including Cas endonucleases and guide RNA molecules. This RNA molecule can drive the endonuclease to certain specific genomic sequences. At the target sequence where the Guide RNA binds to the genomic sequence, the Cas endonuclease can cut the DNA. Various gene editing methods have been used to improve the efficiency of transfer, such as zinc finger nucleases (ZFNs), transcription activator-like nucleases (TALENs) and CRISPR / Cas9. CRISPR / Cas9 provides greater flexibility, operability and relative accuracy, providing more possibilities for gene editing.

[0059] Example:

[0060] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention is further described in detail below in conjunction with specific embodiments.

[0061] Example 1: Preparation of CAR-T cells by infecting T lymphocytes with lentivirus containing CAR vector

[0062] 1. Isolation of peripheral blood T lymphocytes

[0063] After obtaining 80mL of peripheral blood cells from a normal donor, divide them into 50mL centrifuge tubes, each with 40mL. Add 8mL of hydroxyethyl starch solution to each tube, mix them upside down, and let them settle at room temperature for 45 minutes. Collect the upper plasma and add it to the upper layer of Ficoll lymphocyte separation solution in a 1:1 ratio. Gradient centrifugation is performed at 400g for 20 minutes, with a slow rise and fall. After centrifugation, take the white lymphocyte layer, wash it twice with PBS solution containing 2% FBS, and obtain peripheral blood mononuclear cells. Count human peripheral blood mononuclear cells. Resuspend every 108 cells with 1mL of PBS solution containing 2% FBS, and add 100μL of human CD3 cell separation magnetic beads (Stem Cell human CD3 Microbeads) to the resuspended cells. 100μL can separate up to 5×10 7 Personal peripheral blood CD3 + T cells.

[0064] 2. Construction of vectors expressing chimeric antigen receptor (CAR).

[0065] This embodiment constructs a CAR targeting CD38, and the gene sequence is composed of a signal peptide, a single-chain antibody variable region fragment (scFv), a CD8a hinge region, a CD8a transmembrane region, a 4-1BB intracellular segment, a CD3ζ intracellular segment, a P2A peptide segment, and LLT1, which belongs to the second-generation CAR structure. ScFv comes from the monoclonal antibody Daratumumab. Except for scFv, the rest of the CAR structure is from the NCBI nucleotide database. The DNA sequence of CAR is synthesized by Jin Weizhi after codon optimization. The cloning site at the 5' end is XmaI (C / CCGGG), and the cloning site at the 3' end is SalI (G / TCGAC). The CAR sequence is transferred to the CMV promoter behind the lentiviral expression vector pCDH-EF1a-CMV to start the expression of the CAR gene.

[0066] 3. Packaging of CAR vector lentivirus

[0067] The packaging plasmids Rev, VSVG, pMDL and the target plasmid scFv-CD8a-4-1BB-CD3ζ-P2A-LLT1 were extracted using the Endofree Plasmid Kit (QIAGEN). The four plasmids were transfected into uniformly adherent 293T cells using PEI transfection reagent (Yeasen) at a certain ratio. Fresh DMEM medium containing 10% FBS was replaced 8 hours after transfection. The viral supernatant was collected 48 hours later, filtered at 4°C, 3000 rpm, for 15 minutes, and stored at -80°C through a 0.45 μm filter.

[0068] 4. Detection of lentivirus-infected T cells and infection positive rate

[0069] CD3 + After T cells were stimulated with CD3 / CD28 antibodies for 48 hours, they were counted and infected with the corresponding lentivirus at an MOI of 10, and 1000×polybrane was added. The cells were seeded into the well plate and centrifuged at 4°C, 2000 rpm for 1 hour. After centrifugation, they were placed in a 37°C incubator and replaced with fresh cytokine-containing medium after 8 hours. After 48 hours, 2×10 5 Cell detection, labeled with anti-human 1μL CD38 protein (his tag) antibody, 1ul anti-human LLT1 primary antibody, incubated at 4℃ for 30 minutes, washed with PBS containing 2% FBS, then labeled with anti-His antibody, anti-goat IgG secondary antibody, flow cytometry to detect CAR positivity and LLT1 positivity. The results are as follows Figure 1 The results showed that the positive rates of pCDH-T and CAR-T were 0% and 77% 2 days after virus infection.

[0070] Example 2: CRISPR / Cas9 system construction and sgRNA screening

[0071] 1. When performing gene editing, sgRNA and Cas9 protein (Thermo Fisher Scientific) were first incubated at room temperature for 15 minutes to form ribonucleoprotein (RNP). RNP was then transfected into the cell by Lonza 4D Nucleofector. sgRNA was designed based on the CDS sequence of the target gene and then evaluated for off-target risks. The gene editing efficiency of simultaneous knockout of B2M, CIITA, TCR, and CD38 antigens was detected by flow cytometry, and it was found that the simultaneous use of four sgRNAs did not affect the knockout efficiency of a single sgRNA.

[0072] 2. Screening of efficient sgRNAs.

[0073] TCR is composed of one α chain and two β chains. The purpose of knocking out TCR is achieved by designing the TRAC locus targeting the conserved region of the TCR α chain. MHC class I molecules consist of one heavy chain or α chain (the α chain is divided into α1, α2 and α3 regions) and the other is β2 microglobulin (β2m). When β2m is lost, the expression of MHC I will also be lost. The expression of MHC II and its related mechanisms is driven by the transcriptional master regulator type II transactivator (CIITA). When CIITA is inactivated, MHC II is lost due to the lack of transcription factors necessary for the transcription start site.

[0074] The selected sgRNA sequences are as follows:

[0075] TRAC Seq1:ACCCGGCCACTTTCAGGAGG AGG

[0076] TRAC Seq2:ATCCTCCTCCTGAAAGTGGC CGG

[0077] B2M Seq1: TTCCTGAATTGCTATGTGTC TGG

[0078] B2M Seq2:ATACTCATCTTTTTCAGTGG GGG

[0079] CIITA Seq1:GCAGTTGATGGTGTCTGTGT CGG

[0080] CIITA Seq1:GGAAGGTGATGAAGAGACCA GGG

[0081] CD38 Seq1: GCGCTTTCCCGAGACCGTCC TGG

[0082] The knockout results are as follows Figure 2 Shown

[0083] Example 3: Production of UCAR-T

[0084] 1. After 48 hours of stimulation of isolated primary T lymphocytes with CD3 / 28, 2-3×10 6 Cells were centrifuged at 400 g for 5 minutes, and the supernatant was discarded. The cells were resuspended with the incubated RNPs and added to the electrode strips. The 4D-Nucleofector System (Lonza) was used for electroporation, and the EO115 program was selected for electroporation. After electroporation, the cells were resuspended in preheated T cell culture medium at a density of 1×10 6 / mL is appropriate. After culturing in a cell culture incubator for 24 hours, the cells are collected and infected with lentivirus at MOI=10. After adding virus particles for 8 hours, the cells are centrifuged and replaced with fresh culture medium, which is then placed in a cell culture incubator for further culture. Negative cells can be sorted seven days after CAR-T virus infection. The specific preparation process is as follows. Figure 3 shown.

[0085] 2. 48 hours after virus infection, the gene editing efficiency and CAR infection positivity rate can be detected by flow cytometry. During the cell culture process, the culture medium can be aspirated and replaced with fresh culture medium every 1-2 days, and the CAR-T cells can be counted at the same time. On the seventh day after virus infection, CD3, MHCⅠ, MHCⅡ, and CD38 antibodies can be marked for screening. CAR-T cells with four gene knockouts are the required universal CAR-T cells. After sorting, place them in an incubator for 1-2 days and then freeze them. Figure 4It is a universal CAR-T with 99% negative after sorting. The CAR-T proliferation curve is drawn based on the change in the number of CAR-T cells within seven days, such as Figure 5 shown.

[0086] Example 4: Functional detection of UCAR-T

[0087] 1. UCAR-T in vitro anti-tumor function detection

[0088] Three cell lines Nalm6, Molt4, and CCRF CEM that highly express CD38 antigen were used as target cells to detect the killing effect of universal CAR-T. 4KOCAR-T and tumor cells were plated into 96-well plates at effector-target ratios of 2:1, 1:1, 1:2, and 1:5, respectively, and three parallel control wells were set up in each group. After 12 hours, the cells in the wells were aspirated and antibody-labeled with CD38 (tumor cells are CD38 positive, and UCAR-T is CD38 negative) to distinguish CAR-T cells from target cells. Microbeads for counting (Precision Count Beads, BioLegend) were added to each tube of cells. The specific killing effect of CAR-T cells on CD38-positive tumor cells was calculated according to the formula: specific killing ratio (% specific lysis) = (1-the number of tumor cells remaining in each well) / the total number of tumor cells previously seeded in the well, as shown in Figure 2. Figure 6 shown.

[0089] 2. UCAR-T in vivo anti-tumor function detection

[0090] Packaging pCDH-GFP-Luciferase lentivirus, infecting CCRF CEM tumor cells to construct GFP + Luc + CCRF tumor cell line. Each NSG mouse (purchased from Biocytogen) was injected with 3×10 5 7 days after tumor cell transplantation, after in vivo imaging confirmed that tumor transplantation was successful, CAR-T cells could be injected into the tail vein for treatment. The mice were ear-tagged and divided into three groups: universal targeted CD38 4KO CAR-T group (CD3, HLAⅠ, HLAⅡ, CD38 knockout), 1KO CD38 CAR-T group (CD38 knockout), and Mock-T group. Each group was injected with 2×10 6 CAR-T cells (CAR + The therapeutic effect of CAR-T was evaluated by in vivo imaging of mice every seven days after CAR-T transplantation. Figure 7 shown.

[0091] 3. Evaluating the immunogenicity of universal CAR-T

[0092] After 20Gy irradiation, the CAR-T cells were co-cultured with PBMC from another donor for 10 days, which caused the CAR-T cells to lose their proliferation and killing abilities, but maintained their activity and antigen presentation abilities for a period of time. The CAR-T targeting CD38 was divided into three groups according to the gene editing combination: CD38KO group (referred to as 1KO group), TCR&HLAⅠ&CD38 KO group (3KO group), and TCR&HLAⅠ&HLAⅡ&CD38 KO group (4KO group).

[0093] After one week of stimulation, PBMCs were marked with Cell trace to distinguish them from CAR-T cells, and co-cultured with non-irradiated CAR-T cells at a ratio of 1:4 for 24 hours. Cells were aspirated to detect the release of cell-specific cytokines such as IFN-γ, TNF-α, and IL-2 in CD8+T cells in PBMCs. Based on the test results, it can be concluded that allogeneic PBMCs showed very low IFN-γ release after co-culture with 4KO CAR-T, i.e., UCAR-T, while CAR-T cells without HLAⅡ knockout still released IFN-γ, but it was lower than CAR-T cells without TCR and HLA knockout. The more IFN-γ released, the higher the immunogenicity of this type of CAR-T, and the higher the probability of causing allogeneic T lymphocyte rejection. The test results are as follows: Figure 8 As shown in A.

[0094] After one week of stimulation, PBMC and CAR-T were mixed and cultured at an effector-target ratio of 1:4. After 24 hours of co-culture, the cell culture plate was centrifuged at 400g for 5 minutes, and 100 μL of the supernatant from each well was taken and added to the corresponding wells of a new 96-well plate. The corresponding reagent in the Biyuntian LDH detection kit was added, and after incubation in the dark for 30 minutes, the assay was performed using an ELISA instrument. The killing effect of PBMC cells on CAR-T cells was calculated according to the formula: LDH activity unit in the sample = (absorbance of the sample well - absorbance of the background blank control well) / (absorbance of the standard well - absorbance of the background blank control well). According to the results, it can be concluded that the release of LDH after co-culture of allogeneic PBMC and 4KO CAR-T, namely UCAR-T, is the lowest, which is lower than that of CAR-T cells without knocking out HLAⅡ, and both are lower than CAR-T without knocking out TCR and HLA. It means that UCAR-T causes the mildest allogeneic killing reaction. The test results are as follows Figure 8 As shown in B.

[0095] 4. Evaluate the ability of universal CAR-T cells to kill allogeneic NK cells

[0096] PBMCs were separated from fresh peripheral blood, counted, and resuspended in NK cell culture medium containing IL-2 and IL-15. After one week of culture, appropriate amount of cells were taken and labeled with CD3 and CD56 antibodies for flow cytometry. If compared with Day 0, NK cells (CD3 - CD56 + If the proportion of NK cells increases and the NK cell count value increases, it means that the NK cell activity in the sample is good. NK cells were mixed and cultured with CAR-T cells labeled with cell trace (Dapi channel) at different effector-target ratios of 1:1, 2:1, and 4:1 for 24 hours. CAR-T cells targeting CD38 can be divided into three groups as target cells: CD38 KO group (referred to as 1KO group), TCR&HLAⅠ&HLAⅡ&CD38 KO group (4KO group) and TCR&HLAⅠ&HLAⅡ&CD38 KO and overexpression of LLT1 group (4KO-LLT1 group). After the cells were aspirated, they were resuspended in PBS solution containing 1% 7-AAD. Microbeads for counting (Precision Count Beads, BioLegend) were added to each tube of cells, and the remaining 7-AAD-Dapi + The cell number is the number of CAR-T cells to calculate the specific killing ratio of NK cells. Calculate the killing effect of NK cells on CAR-T cells, such as Fig. 9 As shown. According to the test results, it can be concluded that CAR-T with B2M and CIITA knocked out cannot protect them from NK cell-mediated cytotoxicity due to the lack of HLAⅠ and HLAⅡ. The killing of universal CAR-T cells without knocking out HLAⅠ and HLAⅡ in the 1KO group and expressing LLT1 is basically the same. The expression of LLT1 can compensate for the function of HLA molecules, inhibit the activation of NK cells, and reduce the killing of universal CAR-T cells.

[0097] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A universal chimeric antigen receptor T cell, wherein the universal chimeric antigen receptor comprises an extracellular region, a transmembrane region and an intracellular region, wherein the intracellular region comprises an intracellular signal transduction region, characterized in that: The intracellular region also comprises a lectin-like transcript 1 (LLT1) molecule directly or indirectly linked to the end of the intracellular signal transduction region.

2. The universal chimeric antigen receptor T cell according to claim 1, characterized in that The intracellular region further comprises a lectin-like transcript 1 (LLT1) molecule connected to the end of the intracellular signal transduction region via a linker, and the linker is selected from the P2A peptide.

3. The universal chimeric antigen receptor T cell according to claim 1, characterized in that The universal chimeric antigen receptor T cell is characterized in that the genome of the T cell does not contain a gene encoding a protein bound by the binding domain in the extracellular region.

4. The universal chimeric antigen receptor T cell according to claim 3, characterized in that The protein is selected from CD38, CD5, CD7, CD19, CD20, CD22, CD32b, CD33, CD64, CD123, mesothelin, Her2, CA125, GD2, Claudin18.2 or EGFR.

5. The universal chimeric antigen receptor T cell according to claim 1, characterized in that The genome of the T cells does not contain genes encoding B2M, CIITA and TRAC.

6. The universal chimeric antigen receptor T cell according to claim 1, characterized in that The universal chimeric antigen receptor in the universal chimeric antigen receptor T cell expresses a lectin-like transcript 1 (LLT1) molecule; The genome of the T cell in the universal chimeric antigen receptor T cell does not include: 1) a gene encoding a protein to which the binding domain in the extracellular region binds, and 2) Genes encoding B2M, CIITA and TCR.

7. The universal chimeric antigen receptor T cell according to claim 1 or 6, characterized in that The T cells are derived from T cells isolated from blood or induced pluripotent stem cells (iPSCs).

8. The universal chimeric antigen receptor T cell according to claim 1 or 6, characterized in that The universal chimeric antigen receptor is a first generation CAR, a second generation CAR, a third generation CAR or a fourth generation CAR.

9. The method for preparing universal chimeric antigen receptor T cells according to any one of claims 1 to 8, characterized in that: include: Step 1) constructing a viral expression vector according to the sequence of the universal chimeric antigen receptor and packaging it; Step 2) constructing a gene editing system; Step 3) using an electroporation system to transfer the RNP obtained in step 2) into the separated T lymphocytes; Step 4) The cells obtained in step 3) are cultured under conventional conditions for 24 hours and then collected, and the collected cells are infected with the virus obtained in step 1), and the cells are cultured and sorted to obtain the universal chimeric antigen receptor T cells.

10. Use of the universal chimeric antigen receptor T cell as claimed in any one of claims 1 to 8 in the preparation of a drug for treating tumors; Preferably, the tumor is a blood tumor; More preferably, the tumor is multiple myeloma, acute lymphocytic leukemia, acute myeloid leukemia, non-Hodgkin's lymphoma or chronic lymphocytic leukemia.

Images