Construction method and application of recombinant Getah virus for expressing H1N1 subtype swine influenza virus HA protein

Abstract

The invention discloses a recombinant Getai virus for expressing H1N1 subtype swine influenza virus HA protein, the virus has an H1N1 subtype swine influenza virus HA1 protein gene, and the HA1 protein gene is located between E1 and 3 'UTR genes of a Getai virus genome. Accordingly, a corresponding construction method is also established. Furthermore, a corresponding recombinant Geitai virus inactivated vaccine is also developed. Researches show that the inactivated vaccine is used for immunizing mice, can well induce test animals to generate specific antibodies aiming at the H1N1 subtype swine influenza virus, also can generate specific antibodies for expressing the Geitai virus, and provides immune protection for attack of the H1N1 subtype swine influenza virus; and the H1N1 subtype swine influenza virus and Getah virus bivalent inactivated vaccine is successfully prepared. Therefore, the invention has a better effect on prevention and control of the H1N1 subtype swine influenza virus, lays a foundation for the Geitai virus as a carrier to express other exogenous genes, is expected to be used clinically, and can protect a pig farm from being attacked by the two viruses at the same time.

Description

Technical Field

[0001] The present invention belongs to the technical field of recombinant viruses, and in particular relates to a construction method and application of a recombinant Geta virus expressing HA protein of H1N1 subtype swine influenza virus. Background Art

[0002] Getah virus (GETV) is a single-stranded positive-sense RNA virus belonging to the Togaviridae family and the Alphavirus genus. It was discovered in the snow-backed Culex mosquito in Malaysia in 1955. GETV can reproduce in mosquitoes and spread to other host animals through bites. Since the beginning of the 21st century, the geographical range and hosts of GETV infection have further expanded. The positive rate of GETV in pig farms in my country is still on the rise. In order to control the upward trend, the development of related GETV vaccines has become urgent. GETV has typical alphavirus characteristics, can stably express exogenous genes in large quantities, and can induce immunized animals to produce corresponding specific antibodies. These all suggest the possibility that GETV can be used as a vector to express other exogenous genes to construct a two-in-one vaccine.

[0003] Swine influenza virus (SIV) is a single-stranded negative-strand RNA virus. The entire genome consists of eight structural proteins, PB2, PB1, PA, HA, NP, NA, M1, and M2, and two non-structural proteins, NS1 and NS2. The subtypes of influenza viruses are distinguished by HA and NA. HA is the most important immunogenic protein of SIV. Selecting HA1 protein as the exogenous gene interception site for insertion can effectively induce an immune response in the body. The H1N1 subtype swine influenza virus has been prevalent in the pig farming industry in various countries around the world, and there has even been a phenomenon of swine influenza virus being transmitted from pigs to humans. Therefore, it is essential to develop vaccines related to influenza viruses for prevention and control in pig farms. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a method for constructing a recombinant Geta virus expressing the HA protein of the H1N1 subtype swine influenza virus and its application. The obtained inactivated vaccine has good safety and can induce mice to produce good specific immune responses to the H1N1 subtype swine influenza virus and Geta virus, and at the same time has good protection efficiency against the attack of the H1N1 subtype swine influenza virus.

[0005] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0006] A recombinant Geta virus expressing HA protein of H1N1 subtype swine influenza virus, wherein the virus has HA1 protein gene of H1N1 subtype swine influenza virus, and the HA1 protein gene is located between E1 and 3'UTR genes of the Geta virus genome.

[0007] The method for constructing the recombinant Geta virus comprises inserting the H1N1 subtype swine influenza virus HA1 protein between E1 and 3'UTR of GETV on the constructed infectious clone pGETV-GX vector, thereby obtaining the recombinant virus rGEEH1N1-HA1; the infectious clone pGETV-GX vector is prepared from the Geta virus with a deposit number of CCTCC NO: V 202069; the H1N1 subtype swine influenza virus is the H1N1 subtype swine influenza virus CZ7 strain (A / swine / Guangxi / CZ7 / 2014(H1N1).

[0008] In the above construction method, the SOE-PCR method is used to fuse part of the GETV genome sequence with the secretory peptide USP, the truncated H1N1 HA1 protein gene, and the Flag tag in the GETV infectious clone, and then the two restriction enzyme cutting sites of BstbI and MluI are used to insert the fusion fragment between the E1 and 3'UTR genes to obtain the recombinant plasmid pGEEH1N1-HA1, and then the virus is rescued by transfecting sensitive cell lines to obtain the recombinant Geta virus rGEEH1N1-HA1 that recombinantly expresses the H1N1 subtype swine influenza virus HA protein.

[0009] The recombinant plasmid was constructed as follows: First, using the amplification primers BstbI-F1 / E1-T2A-R1 and Flag-3'UTR-F3 / Mlu I-R3, the GETV full-length infectious clone pGETV-GX was used as a template to amplify PCR products 1 containing the restriction enzyme site BstbI and 2 containing the restriction enzyme site Mlu IPCR product 2; then, using mutant primers T2A-H1N1-HA1-F2 and H1N1-HA1-Flag-R2, with swine influenza virus plasmid pH1N1-HA as a template, PCR product 3 containing the sequence of H1N1-HA1 protein and the Flag tag sequence was amplified; then, using PCR product 3 and PCR product 2 as templates, primers T2A-H1N1-HA1-F2 and MluI-R3 were used for fusion PCR amplification, and the fused PCR product 4 and PCR product 1 were used as templates, and the outer primers BstbI-F1 and MluI-R3 were used for the last fusion amplification to obtain PCR product 5; finally, the vector pGETV-GX and PCR product fragment 5 were digested with BstbI and MluI, and the PCR product fragment 5 was inserted into pGETV-GX by a one-step cloning method to obtain the recombinant plasmid pGEEH1N1-HA1.

[0010] The amplification primers BstbI-F1, E1-T2AR1, Flag-3'UTR-F3, MluI-R3, T2A-H1N1-HA1-F2, and H1N1-HA1-Flag-R2 respectively have the base sequences of SEQ.NO.ID.1-6 in the sequence table; the sensitive cells are BHK-21 cells, PK-15 cells, and MARC-145 cells.

[0011] Application of the above recombinant Geta virus or recombinant plasmid in the preparation of medicine or vaccine.

[0012] The vaccine is an inactivated vaccine.

[0013] The preparation method of the recombinant Geta virus inactivated vaccine is to inactivate the recombinant virus or the recombinant virus constructed by the construction method after amplification, and then add the vaccine adjuvant to obtain the vaccine.

[0014] After inactivation, neutralization is performed.

[0015] Expand until the virus titer reaches at least 10 6 TCID 50 / mL; inactivation using formaldehyde with a final concentration of 0.15% as an inactivator at 37°C for 24 hours; neutralization using 5% Na2S203 solution for 30 minutes; the vaccine adjuvant is a commercial aluminum salt adjuvant, added in a 1:1 ratio.

[0016] In response to the current need for prevention and control of H1N1 subtype swine influenza virus, the invention combines the results of previous research to construct a recombinant Geta virus that expresses the HA protein of the H1N1 subtype swine influenza virus. The virus has the HA1 protein gene of the H1N1 subtype swine influenza virus, and the HA1 protein gene is located between the E1 and 3'UTR genes of the Geta virus genome. Based on this, a corresponding construction method is also established. On the constructed infectious clone pGETV-GX vector, the HA1 protein of the H1N1 subtype swine influenza virus is inserted between the E1 and 3'UTR of GETV, thereby obtaining the recombinant virus rGEEH1N1-HA1; the infectious clone pGETV-GX vector is deposited with CCTCC NO: V 202069; the H1N1 subtype swine influenza virus is the H1N1 subtype swine influenza virus CZ7 strain (A / swine / Guangxi / CZ7 / 2014(H1N1). Furthermore, a corresponding recombinant Geta virus inactivated vaccine was also developed. Experimental studies have shown that the rGEEH1N1-HA1 inactivated vaccine of the present invention can well induce the experimental animals to produce specific antibodies against the H1N1 subtype swine influenza virus, and can also produce specific antibodies expressing Geta virus, and provide immune protection against the attack of the H1N1 subtype swine influenza virus, and successfully prepare the H1N1 subtype swine influenza virus and Geta virus bivalent inactivated vaccine. It can be seen that the present invention has a good effect on the prevention and control of the H1N1 subtype swine influenza virus, and also lays a foundation for the Geta virus to be used as a vector to express other exogenous genes, which is expected to be used in clinical practice, and can protect pig farms from the attack of Geta virus and H1N1 subtype swine influenza virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The schematic diagram is a construction method of the Geta virus recombinant plasmid pGEEH1N1-HA1 of the present invention.

[0018] Figure 2 The electrophoresis results of plasmid construction are as follows: Figure A: M: DL 2000 DNA Marker, S1 is the amplified GETV S1 fragment, S2 is the amplified GETV S2 fragment; Figure B: M: DL 5000 DNA Marker, S3 is a PCR product containing USP secretory peptide, truncated H1N1 HA1 protein sequence and Flag tag sequence amplified from the pH1N1-HA plasmid stored in the laboratory; Figure C: M: DL 5000 DNA Marker, S4: the product of the fragment S3 fused with USP and the fusion product of the fragment S1 and S2.

[0019] Figure 3This is the electrophoresis result of restriction enzyme digestion identification of the recombinant plasmid pGEEH1N1-HA1, in the figure: M: DL15000 DNAMarker; Lane 1: pGEEH1N1-HA1; Lane 2: pGETV-GX.

[0020] Figure 4 This is a diagram showing the cytopathic effect (CPE) caused by virus infection of BHK-21 cells; in the figure: A: rGETV-GX; B: rGEEH1N1-HA1; C: normal BHK-21 cells.

[0021] Figure 5 These are the results of indirect immunofluorescence test using Flag-tagged mouse antibody and GETV E2 mouse polyclonal antibody as primary antibodies after BHK-21 cells were infected with the recombinant virus P3 (20×); in the figures: the primary antibody in Figure A and Figure B is Flag-tagged mouse antibody; the primary antibody in Figure C, Figure D, and Figure E is GETV E2 mouse polyclonal antibody.

[0022] Figure 6 The results of Western blot analysis of the recombinant virus P3 generation, M in the figure: protein marker (10-180KDa); lane 1: rGEEH1N1-HA1 infected cell lysate; lane 2: rGEEH1N1-HA1 infected supernatant; lane 3: rGETV-GX infected cell lysate; lane 4: rGETV-GX infected supernatant;

[0023] Figure 7 The figures are comparison diagrams of the plaque morphology of rGEEH1N1-HA and rGETV-GX, wherein: Figure A is the plaque morphology of rGETV-GX; Figure B is the plaque morphology of rGEEH1N1-HA1.

[0024] Figure 8 The growth curves of rGEEH1N1-HA1 and rGETV-GX are shown in Figure 2.

[0025] Fig. 9 This is a validation diagram of rGEEH1N1-HA1 inactivation. In the figure: Figure A shows BHK-21 cells inoculated with inactivated virus and blindly propagated for 3 generations; Figure B is a positive control of non-inactivated virus; Figure C is BHK-21 cells not inoculated with any virus

[0026] Fig.10 This is the result of indirect immunofluorescence experiment using immunized mouse serum as primary antibody (20×), in which: A, B, C, and D are BHK-21 cells infected with rGETV-GX strain, BHK-21 cells, MDCK cells infected with H1N1 subtype swine influenza virus strain, and MDCK cells, respectively.

[0027] Fig.11This is a curve chart showing the changes in antibodies against HA1 protein of H1N1 subtype swine influenza virus detected by ELISA in the sera of mice on days 0, 7, 14, 21 and 28 after immunization with rGEEH1N1-HA1 inactivated vaccine.

[0028] Fig.12 This is a graph for detecting the neutralizing antibody titers of GETV and H1N1 subtype swine influenza virus in the serum of immunized mice.

[0029] Fig.13 This is the result of the protection of mice with the rGEEH1N1-HA1 inactivated vaccine against H1N1 subtype swine influenza virus. In the figure: Figure A: weight change; B: survival rate; C: lung tissue virus titer

[0030] Fig.14 The results of pathological sections of lung tissue of mice in rGEEH1N1-HA1 group and DMEM group on the 3rd and 5th days after infection with H1N1 subtype swine influenza virus (200×) are shown in the figure: Figure A: Pathological section of lung tissue of rGEEH1N1-HA1 group on the 3rd day after infection; B: Pathological section of lung tissue of DMEM group on the 3rd day after infection; C: Pathological section of lung tissue of rGEEH1N1-HA1 group on the 5th day after infection; D: Pathological section of lung tissue of DMEM group on the 5th day after infection

[0031] Storage Information

[0032] Swine getta virus GETV-GX201808, the deposit number is CCTCC NO: V 202069, the deposit date is October 13, 2020, the deposit address is: Wuhan University, Wuhan, China, postal code 430072, the deposit unit is: China Center for Type Culture Collection. DETAILED DESCRIPTION

[0033] 1 Materials and methods

[0034] 1.1 Viruses, cells, strains and reference sequences

[0035] BHK-21 cells (baby hamster kidney cells), MDCK cells, pGETV-GX, pH1N1-HA, and H1N1 subtype swine influenza virus CZ7 strain (A / swine / Guangxi / CZ7 / 2014(H1N1) (reference: He P, Wang G, Mo Y, et al. Novel triple-reassortant influenza viruses in pigs, Guangxi, China [J]. Emerg Microbes Infect, 2018, 7(1): 85.) were maintained by the applicant's laboratory, and the competent cell bacteria DH5α was purchased from Qingke Reagent Co., Ltd.

[0036] 1.2 Main reagents and instruments

[0037] Green Taq Mix (Vazyme), restriction endonuclease, Vazyme one-step cloning kit, Plasmid Mini Kit, Gel Extraction Kit, Viral RNA Kit (OMEGA), Lipfectamine 2000 (Invitrogen), EB alternative dye (Beijing Pulilai Gene Technology Co., Ltd.), DNA Marker nucleic acid molecular mass standard (TaKaRa), regular agarose, plasmid mini kit (Plasmid Mini Kit), gel extraction kit (Gel Extraction Kit), reaction solution recovery kit (Cycle-Pure Kit), 4% paraformaldehyde (Sevier Biotechnology Co., Ltd.), nucleic acid electrophoresis instrument (Beijing Junyi Oriental Electrophoresis Equipment), CO2 constant temperature incubator (Thermo Fisher), inverted microscope (OlympusCKX41), HRP-goat anti-mouse IgG (H+L) (Beyotime), FlagTag Mouse Monoclonal Antibody (Beyotime); crystal violet powder (Shanghai Jereh Biotechnology), formaldehyde, Purified Agar low melting point agarose (OXOID).

[0038] 1.3 Primer design

[0039] (1) Using the full-length infectious clone of GETV, pGETV-GX (reference: Geta virus full-length infectious clone, replicon system and its preparation and application, patent application number 2020113085094, publication date 2021-03-09) as a template, the two end products containing BstbI and MluI restriction enzyme cleavage sites were amplified respectively.

[0040] BstbI-F1: TGCTGTCCATTCTCATTCGAATGTAGCCACCATACAG GAGGC (SEQ.NO.ID.1)

[0041] E1-T2A-R1: AGGCCGGGGATTCTCCTCCACGTCACCGCATGTTAGAAGACTTCCTCTGCCCTCTTAGCGGCGCATAGT (Sequence Listing SEQ.NO.ID.2)

[0042] Flag-3'UTR-F3: GGACGACGATGACAAGTAACCGGGAGGCTTGACATAATGTATAT (Sequence Listing SEQ.NO.ID.3)

[0043] MluI-R3:ATGCCATGCCGACCCACGCGTTTTTTTTTTTTTTGT (Sequence Listing SEQ.NO.ID.4)

[0044] (2) Primers for amplifying HA1 protein and flag tag were designed based on the genome base sequence and flag tag sequence of the H1N1 subtype swine influenza virus strain CZ7.

[0045] T2A-H1N1-HA1-F2: GAGGAGAATCCCGGCCCTATGGACACAATATTGGAGAAAAATG (Sequence Listing SEQ.NO.ID.5)

[0046] H1N1-HA1-Flag-R2: CTTGTCATCGTCGTCCTTGTAATCGGATTGAATAGAGGGGATAT (Sequence Listing SEQ.NO.ID.6)

[0047] (3) Design primers for detecting exogenous genes, and the PCR amplification site is the exogenous gene and the fragments of the vectors on both sides.

[0048] Flag-3'UTR-F3: Same as (1)

[0049] MluI-R3: Same as (1)

[0050] The above primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0051] 1.4 Construction process of recombinant clone pGEEH1N1-HA1

[0052] Using the amplification primers BstbI-F1 / E1-T2AR1 and Flag-3'UTR-F3 / MluI-R3, the GETV full-length infectious clone pGETV-GX was used as a template to amplify the products containing BstbI and Mlu I restriction enzyme sites at both ends as PCR product 1 (SEQ.NO.ID.7 in the sequence list) and PCR product 2 (SEQ.NO.ID.8 in the sequence list), respectively; using the mutation primers T2A-H1N1-HA1-F2 and H1N1-HA1-Flag-R2, the plasmid pH1N1-HA encoding the swine influenza virus HA gene was used as a template to amplify the PCR product 3 (SEQ.NO.ID.9 in the sequence list) containing the sequence of the H1N1-HA1 protein and the Flag tag sequence; using the PCR product 3 and the PCR product 2 as templates, the primers T2A-H1N1-HA1-F2 and MluI-R3 were used for PCR product 4 (the base sequence is PCR product 1 sequence + PCR product 2 sequence + PCR product 3 sequence) was obtained by fusion PCR amplification. PCR product 4 and PCR product 1 were used as templates and outer primers BstbI-F1 and MluI-R3 were used to perform the final fusion amplification. The final fused PCR product 5 (the base sequence is the same as PCR product 4) was digested with BstbI and MluI, and the full-length infectious clone pGETV-GX of the vector GETV was digested at the same time. The fusion PCR product fragment containing the restriction site after digestion was cloned into pGETV-GX in one step to obtain the recombinant plasmid pGEEH1N1-HA1.

[0053] The PCR reaction system is as follows: the total volume is 50 μL, including 25 μL of Prime STAR, 3 μL of cDNA template, 1 μL of upstream primer and downstream primer, and 20 μL of dd H2O. The specific reaction program conditions are 95℃ pre-denaturation for 5 min, 98℃ denaturation for 20 s, 55℃ annealing for 10 s, 72℃ extension for 20 s, and 35 cycles in total; 72℃ extension for 10 min. When performing SOE-PCR, two cDNA templates are added in a molar ratio of 1:1. No primers are added on both sides. After the program runs for 6 cycles, primers are added and run according to the originally designed PCR program. After the PCR reaction program is completed, the PCR product is recovered by running on gel (OMEGA gel recovery kit), and the recovered product is stored at -20℃.

[0054] The specific steps of enzyme digestion are as follows: 30μL of target gene or plasmid, 1μL each of BstbI and Mlu I, 5μL of CutSmart Buffer, and dd H2O to 50μL. The reaction conditions are as follows: After adding BstbI and Mlu I, place the enzyme in a 37℃ water bath for 5h, then use the liquid recovery reagent for recovery (OMEGA's reaction solution recovery kit), and store the recovered sample in a -20℃ refrigerator.

[0055] The results are as follows Figure 2 , the amplified target fragment is consistent with the designed target fragment.

[0056] The vector pGETV-GX and the target fragment were connected by one-step cloning. According to the instructions of the one-step cloning kit of Vazyme, the specific reaction system is as follows: Exnase II 2μL, 5×CE II Buffer 4μL, vector pGETV-GX 50ng≤X≤200ng, target fragment 50ng≤Y≤200ng, and sterile water to 20μL. After the system is complete, place it in a 37℃ water bath for reaction for 30 minutes, then transfer it to an ice bath for cooling, and then transform the reaction solution into DH5α competent cells. The transformed bacterial solution is evenly spread on an LB culture dish and cultured at 37℃. Positive screening is performed when uniform colonies grow. The recombinant plasmid pGEEH1N1-HA1 obtained by positive screening is then digested with BstbI and Mlu I for restriction enzyme identification, and the plasmid with correct enzyme digestion is sequenced for identification.

[0057] The result is Figure 3 The double bands observed after restriction digestion were of the correct size.

[0058] 2. Rescue of recombinant viruses and analysis of their biological characteristics

[0059] BHK-21 cells were passaged into 6-well plates and transfected when the cell density reached about 80%. Transfection was performed according to the instructions of Lipofectamine 2000. After transfection, the cells were cultured in a 37°C incubator with 5% CO2 for 6 hours and then replaced with 2 mL of DMEM medium containing 2% FBS. After 48 hours, the supernatant of the transfected cells was collected and inoculated into fresh BHK-21 cells. After the cells showed pathological changes, the supernatant was collected and stored at -80°C.

[0060] The results are as follows Figure 4 , the cells showed phenomena such as drawing, shrinking, and breaking, indicating that the virus was successfully rescued.

[0061] 2.1 Indirect immunofluorescence assay (IFA) of recombinant viruses

[0062] When the BHK-21 cell density in the 12-well plate was 80%, the recombinant virus rGEEH1N1-HA1 and the parental virus rGETV-GX were inoculated respectively, and the inoculation dose was 0.01MOI. The inoculation medium DMDM ​​group was set up as a negative control. After inoculation, the plates were placed in an incubator at 37°C and 5% CO2 for incubation for 1 hour, and then the supernatant was discarded. DMEM medium containing 2% fetal bovine serum was added. When cytopathic effects appeared, the supernatant was discarded, and ice methanol was added to fix at 4°C overnight, and then washed twice with PBS for 5 minutes each time. 1% BSA was added to block in a 37°C incubator for 1 hour, and then washed three times with PBS, and 600 μL of Flag-tagged mouse antibody (1:1000) and mouse polyclonal antibody of GETVE2 (1:1000) were added respectively, and the plates were incubated at 4°C overnight. The next day, the cells were washed five times with PBS and then 600 μL (1:1000) diluted goat anti-mouse fluorescent secondary antibody was added. The cells were incubated in a 37°C incubator in the dark for 45 min. After incubation and washing, DAPI was added for nuclear staining and the cells were observed under a fluorescence microscope.

[0063] The results are as follows Figure 5 It can be seen that the recombinant virus rGEEH1N1-HA1 (A) incubated with Flag tag mouse antibody as the primary antibody produces specific fluorescence, and the negative control group (B) does not produce any specific fluorescence; the recombinant virus rGEEH1N1-HA1 (C) and the parent virus rGETV-GX (D) incubated with GETV E2 mouse polyclonal antibody as the primary antibody both produce specific fluorescence, and the negative control group (E) does not produce specific fluorescence, proving that the recombinant Geta virus with exogenous genes has been successfully rescued. Therefore, the present invention can successfully induce mice to produce specific antibodies for Geta virus and H1N1 subtype H1N1 subtype swine influenza virus. The IFA results show that the mouse serum 28 days after immunization can be specifically recognized by Geta virus and H1N1 subtype H1N1 subtype swine influenza virus at the same time, indicating that the inactivated vaccine can successfully induce mice to produce corresponding specific antibodies.

[0064] 2.2 Western Blot Identification of Recombinant Virus Proteins

[0065] When the density of BHK-21 cells in the 6-well plate was 100%, the recombinant virus rGEEH1N1-HA1 and the parental virus rGETV-GX were inoculated respectively. After the cytopathic effect appeared, the supernatant and cells were collected, and the Loading Buffer was added and boiled in boiling water for 5-10 minutes, and then the SDS-PAGE electrophoresis experiment was performed. After the electrophoresis experiment was completed, the protein gel was placed in a semi-dry transfer apparatus, and the protein was transferred to a PVDF membrane by semi-dry transfer, and blocked with 5% skim milk powder. Then, the membrane was incubated at 4°C overnight with a Flag-tagged mouse antibody as the primary antibody. The next day, it was washed 5 times with TBST, each time for 5 minutes, and HRP-labeled goat anti-mouse IgG was used as the secondary antibody for incubation in a 37°C incubator for 1 hour, and the membrane was imaged and photographed on a Western blot imager.

[0066] The results are as follows Figure 6 , it can be seen that obvious specific bands appeared in the protein samples of rGEEH1N1-HA1 infected cells, while there were no specific bands in the samples of rGETV-GX infected wells, indicating that the recombinant virus expressed the H1N1 HA1 protein;

[0067] 2.3 Virus plaque phenotype determination

[0068] When the BHK-21 cell density in the 6-well plate reached 100%, the recombinant virus rGEEH1N1-HA1 or the parent virus rGETV-GX was inoculated at a dose of 100 TCID 50 After inoculation, place in a 37°C, 5% CO2 incubator for 1 hour, then discard the supernatant, add a 1:1 mixture of 2×DMEM and 2% low melting point agar, add 2mL to each well, and after solidification, invert and continue to culture in a 37°C, 5% CO2 incubator. After obvious plaques appear, fix with 4% paraformaldehyde for 8 hours, rinse off the fixative and agar layer with running water, then add 0.5% crystal violet stain for 30 minutes, wash off the stain with clean water and observe.

[0069] The results are as follows Figure 7 It can be seen that the plaque morphology of the recombinant virus rGEEH1N1-HA1 is similar to that of the parental strain rGETV-GX.

[0070] 2.4 Determination of multi-step growth curve of recombinant virus

[0071] When the BHK-21 cell density in the 6-well plate was 100%, the recombinant virus rGEEH1N1-HA1 and the parental virus rGETV-GX were inoculated at a dose of 0.01 MOI, respectively. The cell supernatant was collected at 6h, 12h, 18h, 24h, 36h, 48h, and 60h after infection, and the virus titer at each time point was determined, and the virus multi-step growth curve was drawn.

[0072] Draw a curve like Figure 8 As shown, the parental virus reached the peak of virus titer at 18 hours after infection, while the recombinant virus reached the peak at 24 hours, indicating that the virulence of the recombinant virus was slower than the replication ability of the parental virus.

[0073] 2.5 Inactivation and identification of recombinant viruses

[0074] After rGEEH1N1-HA1 was expanded, the titer was measured to be at least 10 6 TCID 50 / mL, add 0.15% formaldehyde and place at 37℃ for 24 hours for inactivation, then use 5% sodium thiosulfate at 37℃ for neutralization, take 300μL of inactivated recombinant virus rGEEH1N1-HA1 and inoculate it into BHK-21 cells in 6-well plates, incubate for 1 hour, discard the infection solution, add 2% FBSDMEM for culture observation, blindly pass for 3 generations, and observe whether cytopathic effects occur during the period. At the same time, set up the inactivated recombinant virus as a positive control and the uninoculated culture medium DMEM as a negative control.

[0075] The results are as follows Fig. 9 As can be seen, the cell states of the negative control groups in Figure A and Figure C are consistent, indicating that the cells have been successfully inactivated.

[0076] 2.6 Preparation of rGEEH1N1-HA1 inactivated vaccine

[0077] The completely inactivated recombinant virus rGEEH1N1-HA1 was mixed with an aluminum salt adjuvant (Biodragon AluminymHydroxide Gels Adjuvant) in a volume ratio of 1:1 to form an aqueous inactivated vaccine.

[0078] 3. Immunoprotective experiment of rGEEH1N1-HA1 inactivated vaccine

[0079] 3.1 Immunity and virus attack

[0080] Thirty healthy female BALB / c mice aged 6 weeks were randomly divided into 3 groups, with 10 mice in each group, namely rGEEH1N1-HA1 inactivated vaccine group, DMEM group and pure negative group. The mice were immunized by intraperitoneal injection, and the immunization dose of each mouse was 200 μL rGEEH1N1-HA1 inactivated vaccine; two weeks after the first immunization, the second immunization was performed with the same immunization method and dose; 7 days after the second immunization, the mice were challenged with H1N1 subtype swine influenza virus strain CZ7 by nasal drops, and the survival and clinical symptoms of the mice were observed every day for 14 days after the challenge.

[0081] 3.2 IFA detection of antibodies in mice

[0082] When the density of BHK-21 cells reached about 80%, H1N1 and GETV were inoculated at a dose of 0.01 MOI, and cultured in an incubator at 37°C and 5% CO2 until cytopathic effects appeared. The supernatant was discarded, and the cells were washed twice with PBS and incubated overnight with 4% paraformaldehyde solution at 4°C, and then washed twice with PBS, and then blocked at 37°C for 1 hour after adding 5% BSA. After blocking, 600 μL of mouse serum (1:100) was added and incubated overnight. After incubation, the cells were washed 5 times with PBS, and then 600 μL (1:1000) of goat anti-mouse secondary antibody was added, and incubated in a 37°C incubator in the dark for 45 minutes. After incubation and washing, DAPI was added for nuclear staining, and the cells were observed under a fluorescence microscope.

[0083] The results are as follows Fig.10 It can be seen that both Group A and Group C showed specific red fluorescence, indicating that the mice produced both specific antibodies to GETV and specific antibodies to the exogenous gene. Immunization with the rGEEH1N1-HA1 inactivated vaccine can induce mice to produce specific viral immune responses and thus produce antibodies.

[0084] 3.3 Indirect ELISA to detect the titer of H1N1 subtype swine influenza virus antibodies in mouse serum

[0085] Take the purified H1N1-HA protein and dilute it to 200μg / well to calculate the dosage, mix it with the ELISA coating solution and add it to each well of the 96-well ELISA plate (100μL / well), and coat it overnight at 4℃; wash it with PBST 5 times, add 5% skim milk powder (diluted with PBST) to each well of the ELISA plate (300μL / well) to block, and incubate it at 37℃ for 2h; wash it with PBST 5 times, dilute the mouse serum to be tested with PBST containing 1% BSA at 1:100, and add the diluted serum to ELISA Each well of the ISA plate (100 μL / well), incubate at 37°C for 1h, and wash thoroughly with PBST; HRP-labeled goat anti-mouse IgG antibody was diluted 1:5000 with PBST containing 1% BSA, added to each well of the ELISA plate (100 μL / well), incubated at 37°C for 45min, and washed thoroughly with PBST; TMD color development solution was added to develop at 37°C in the dark for 15min, and then the ELISA stop solution was added to stop (50 μL / well), and the absorbance was measured at a wavelength of 450nm on an enzyme reader.

[0086] The results are as follows Fig.11 It can be seen that the antibodies produced by mice against the H1N1 subtype swine influenza virus showed a linear upward trend. The H1N1 subtype swine influenza virus HA protein antibodies in the serum could be detected 7 days after the first vaccination, and the antibody level showed a linear upward trend afterwards. And 14 days after the second vaccination, the TCID 50The neutralizing antibody titer was determined by the method of rGEEH1N1-HA1 inactivated vaccine immunization group. The neutralizing antibody titer of H1N1 subtype swine influenza virus was 2 5.36 TCID 50 / mL, and the negative group did not produce neutralizing antibodies.

[0087] 3.4 Detection of neutralizing antibodies in serum of mice immunized with recombinant virus

[0088] TCID 50 The neutralizing antibody titer of the mouse serum immunized for 28 days was detected by diluting the serum at a ratio of 1:4, 1:8, 1:16, and 1:32 with 100 TCID 50 Geta virus and swine influenza virus were mixed in a 1:1 ratio and incubated in a 37°C culture medium containing 5% CO2 for 1 hour. After adding to a 96-well cell plate, the cytopathic effect was observed after 3 days and the corresponding neutralizing antibody titer was calculated.

[0089] The results are as follows Fig.12 It can be seen that the mice produced 2 neutralizing antibodies against GETV 28 days after immunization. 4.6 TCID 50 / mL, and produced 2 neutralizing antibodies against H1N1 subtype swine influenza virus 5.36 TCID 50 / mL.

[0090] 3.5 Viral load in lung tissue of mice after virus challenge

[0091] The weight changes and survival rates of mice in each group were recorded 14 days after the challenge. The mice were killed on the 3rd and 5th days after the challenge, and 0.15 g of lung tissue was added to 1 mL of DMEM for grinding. After centrifugation, 100 μL of the supernatant was taken and the viral load was titrated by plaque titration.

[0092] The results are as follows Fig.13 , Fig.13 The mice in the rGEEH1N1-HA1 inactivated vaccine immunization group shown in A lost weight two days after the virus challenge but then began to recover. The weight increase trend in the later period was similar to that of the pure negative control group, but the weight of the DMEM group began to gradually decrease after the virus challenge. Fig.13 As shown in Figure B, mice in the DMEM group began to die on the 7th day and all died on the 9th day, while the protection rate of mice in the immunization group was as high as 100%, indicating that the vaccine has a good protective effect. Fig.13 As shown in C, the viral load in the lung tissue of mice in the DMEM group could be detected to a value of 10 on day 3. 3 PFU / g, while the viral load of the immunized mice was less than 10 on the 3rd and 5th days. 0 PFU / g.

[0093] The experimental results showed that the rGEEH1N1-HA1 inactivated vaccine has good safety and immunogenicity, and the immunized mice can provide good protection against the attack of swine influenza virus. After the virus attack, the mice in the non-immunized control group began to show depression and difficulty breathing on the fifth day after the virus attack, and began to die on the seventh day. All died on the ninth day after the virus attack; the mice in the immunized group did not show the corresponding clinical symptoms and death.

[0094] 3.6 Pathological sections of lung tissues of mice after virus attack

[0095] On the 3rd and 5th days after infection, mice were killed, and half of the relatively intact mouse lung tissue was placed in a 4 mL EP tube containing 4% paraformaldehyde solution and sent to Sewell Biotechnology Co., Ltd. for preparation of pathological sections and HE staining.

[0096] The results are as follows Fig.14 , Fig.14 A and Fig.14 The lung pathological sections of mice immunized with the inactivated rGEEH1N1-HA1 vaccine in C showed no obvious lesions in the lung tissues on days 3 and 5 after infection. Fig.14 The lung tissue pathological sections of mice in the DMEM group B showed that on the third day after the virus attack, vascular cuffs with inflammatory cells infiltrating around the blood vessels had begun to form in the lungs of mice, alveolar wall congestion and edema, vacuolar degeneration of epithelial cells, basement membrane damage, alveolar hemorrhage, lymphocyte and monocyte infiltration, etc.; and by Fig.14 As can be seen in D, the lung lesions of mice worsened on the 5th day after infection.

Claims

1. A recombinant Geta virus expressing the HA protein of the H1N1 subtype swine influenza virus, characterized in that The virus has the HA1 protein gene of the H1N1 subtype swine influenza virus, and the HA1 protein gene is located between the E1 and 3'UTR genes of the Geta virus genome.

2. The method for constructing the recombinant Getavirus according to claim 1, characterized in that: On the constructed infectious clone pGETV-GX vector, the H1N1 subtype swine influenza virus HA1 protein is inserted between E1 and 3'UTR of GETV to obtain the recombinant virus rGEEH1N1-HA1; the infectious clone pGETV-GX vector is prepared from the Geta virus with a deposit number of CCTCC NO: V 202069; the H1N1 subtype swine influenza virus is the H1N1 subtype swine influenza virus CZ7 strain.

3. The method for constructing a recombinant Getavirus according to claim 2, characterized in that: The SOE-PCR method was used to fuse part of the GETV genome sequence with the secretory peptide USP, the truncated H1N1 HA1 protein gene, and the Flag tag in the GETV infectious clone. The fusion fragment was then inserted between the E1 and 3'UTR genes using the two restriction enzyme sites, BstbI and MluI, to obtain the recombinant plasmid pGEEH1N1-HA1. The virus was then rescued by transfecting sensitive cell lines to obtain the recombinant Geta virus rGEEH1N1-HA1 that recombinantly expresses the H1N1 subtype swine influenza virus HA protein.

4. The method for constructing a recombinant Getavirus according to claim 3, characterized in that The recombinant plasmid was constructed as follows: first, using amplification primers BstbI-F1 / E1-T2A-R1 and Flag-3'UTR-F3 / Mlu I-R3, GETV full-length infectious clone pGETV-GX was used as a template to amplify PCR product 1 containing the restriction enzyme cutting site BstbI and amplification product 2 containing the restriction enzyme cutting site Mlu IPCR product 2; then, using mutant primers T2A-H1N1-HA1-F2 and H1N1-HA1-Flag-R2, with swine influenza virus plasmid pH1N1-HA as a template, PCR product 3 containing the sequence of H1N1-HA1 protein and the Flag tag sequence was amplified; then, using PCR product 3 and PCR product 2 as templates, primers T2A-H1N1-HA1-F2 and MluI-R3 were used for fusion PCR amplification, and the fused PCR product 4 and PCR product 1 were used as templates, and the outer primers BstbI-F1 and MluI-R3 were used for the last fusion amplification to obtain PCR product 5; finally, the vector pGETV-GX and PCR product fragment 5 were digested with BstbI and MluI, and the PCR product fragment 5 was inserted into pGETV-GX by a one-step cloning method to obtain the recombinant plasmid pGEEH1N1-HA1.

5. The method for constructing a recombinant Getavirus according to claim 3, characterized in that: The amplification primers BstbI-F1, E1-T2A R1, Flag-3'UTR-F3, MluI-R3, T2A-H1N1-HA1-F2, and H1N1-HA1-Flag-R2 respectively have base sequences of SEQ.NO.ID.1-6 in the sequence table; the sensitive cells are BHK-21 cells, PK-15 cells, and MARC-145 cells.

6. Use of the recombinant Geta virus according to claim 1 or the recombinant plasmid according to claim 3 in the preparation of medicines or vaccines.

7. The use according to claim 6, characterized in that: The vaccine is an inactivated vaccine.

8. A method for preparing a recombinant inactivated Geta virus vaccine, characterized in that The recombinant virus of claim 1 or the recombinant virus constructed by the construction method of claim 2 is amplified and then inactivated, and then a vaccine adjuvant is added to obtain the vaccine.

9. The preparation method according to claim 8, characterized in that: The inactivation is followed by neutralization.

10. The preparation method according to claim 9, characterized in that: The method of expanding the virus to a titer of at least 10 6 TCID 50 / mL; the inactivation uses formaldehyde with a final concentration of 0.15% as an inactivator at 37°C for 24 hours; the neutralization uses 5% Na2S203 solution for 30 minutes; the vaccine adjuvant is a commercial aluminum salt adjuvant, which is added in a 1:1 ratio.

Images