Piinan cattle GDF2 gene g.4 site molecular marker, typing primer, kit, detection method and application of Piinan cattle GDF2 gene g.4 site molecular marker

Abstract

The invention relates to the technical field of gene detection, and particularly discloses a molecular marker, a typing primer, a kit, a detection method and application of a Guinan cattle GDF2 gene g.4 site. According to the present invention, the new SNP site existing in the GDF2 gene in the Pinan cattle population is firstly found, the correlation between the polymorphism of the site and the growth traits of the Pinan cattle is found, and then the GDF2 gene SNP g.4 Cgt of the Pinan cattle is used to construct the GDF2 gene SNP g.4 Cgt of the Pinan cattle, and the GDF2 gene SNP g.4 Cgt of the Pinan cattle; three detection primers are designed in a T site area, and the primers are specially modified, so that the SNP g.4 Cgt can be specifically distinguished; the T site has three genotypes; meanwhile, by combining the characteristic that animal whole blood can be directly subjected to PCR as a template and utilizing the advantages that a test strip is high in detection sensitivity and specificity, easy to operate, short in time consumption, low in detection cost and easy to popularize, the constructed kit capable of being used for screening the SNP sites and the detection method can be used for Pinan cattle SNP g.4 Cgt; t different genotypes are rapidly detected, and varieties are bred.

Description

Technical Field

[0001] The invention belongs to the technical field of gene detection, and specifically relates to a Pinan cattle GDF2 gene SNP molecular marker, a primer for detecting the Pinan cattle GDF2 gene g.4 site SNP, a kit, a detection method and applications thereof. Background Art

[0002] Pinan cattle are a cross between Piedmontese cattle and Nanyang cattle, with 75% Piedmontese bloodline and 25% Nanyang bloodline. They retain the advantages of Nanyang cattle in terms of good adaptability and tolerance to roughage, while inheriting the characteristics of Piedmontese cattle in terms of fast growth and high lean meat rate. However, in the process of breeding the new Pinan cattle, there are still problems such as insufficient number of core groups, low uniformity, and insufficient application of molecular breeding technology.

[0003] Growth differentiation factor 2 (GDF2) is a bone morphogenetic protein specifically secreted by hepatic stellate cells. It is a potent osteogenic factor that plays an important role in regulating glucose and lipid metabolism and hematopoietic cell function, inducing chondrocyte differentiation, etc. Studies have found that the GDF2 gene, as a candidate gene for mammalian growth traits, has attracted extensive attention in SNP research, and candidate functional SNPs that can be used for subsequent breeding have been obtained in multiple species.

[0004] Single nucleotide polymorphism (SNP) markers are the most studied and promising molecular markers. Since Jordan first proposed SNP as a new academic term in the journal Human Molecular Genetics in 1994, it has quickly become an emerging third-generation molecular marker technology and has been increasingly widely used in molecular marker-assisted breeding of livestock.

[0005] In livestock and poultry research, it has been found that multiple SNP sites of GDF2 have a significant impact on their body size traits, but this has never been reported in Pinan cattle. Considering that the association analysis between SNP variation of the GDF2 gene and the body size traits of Pinan cattle is crucial, in order to accelerate the breeding process of Pinan cattle in my country, it is necessary to provide a GDF2 gene SNP detection method related to the body size traits of Pinan cattle.

[0006] At present, there are many SNP detection methods, about more than 20, which can be divided into two categories. One is the SNP detection method based on gel electrophoresis, including single-strand conformation polymorphism (PCR-SSCP), denaturing gradient gel electrophoresis (DGGE), enzyme-amplified polymorphic sequence (CAPS), allele-specific PCR (AS-PCR), etc. The other is a high-throughput, highly automated SNP detection method, including direct sequencing, DNA chips, denaturing high-performance liquid chromatography (DHPLC, mass spectrometry, high-resolution melting curve (HRM), etc. The products of the first method need to be separated and identified by agarose gel electrophoresis or polyacrylamide gel electrophoresis, and sometimes ethidium bromide nucleic acid indicators are needed. This indicator is carcinogenic and has a certain impact on the health of the tester when observed under ultraviolet light. In addition, restriction endonucleases are sometimes needed, which are also relatively expensive; the second method is more complicated to operate, has high technical requirements, and expensive instruments and equipment, which largely limits the application of SNP detection typing in ordinary breeding units.

[0007] At present, the visualization detection method mainly uses nucleic acid test strip detection technology, and is mainly used for rapid detection of pathogens, viruses and meat source components, and pays more attention to the differences in DNA sequences of interspecies differential genes. It is rare to use it for detection of single bases. Therefore, it is particularly important to develop a SNP detection method that is simple to operate, has low technical requirements and is visualized. Summary of the invention

[0008] In view of the problems existing in the current technology, the present invention provides a molecular marker and typing primer for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle, a kit, a detection method and application thereof.

[0009] The solution adopted by the present invention to solve the technical problem is: a method for detecting SNP molecular markers related to the body size traits of southern cattle, comprising the following steps:

[0010] S1. Select several Pinan cattle, measure their body size data and record their relationship by number, collect venous whole blood from each Pinan cattle, extract individual genomic DNA, test its concentration and purity, and select qualified DNA;

[0011] S2, selecting DNA from 5 distantly related Pinan cattle individuals and mixing them to obtain a tube of mixed pool DNA template;

[0012] S3, designing and synthesizing amplification primer pair P1, wherein the nucleotide sequences of the amplification primer pair are shown in SEQ ID NOs. 1 and 2;

[0013] S4. Using the mixed pool DNA as a template, PCR amplification reaction is performed with primer pair P1 to obtain the PCR amplification product of primer P1; S5. Sequencing the amplification product to obtain the sequencing gene sequence and peak graph; comparing the sequencing results with the peak graph to determine that the mutation site g.4 is a C>T base mutation.

[0014] The present invention also provides a primer for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle, and the sequence of the detection primer is:

[0015] GDF2-4-FC:GGGCGAGAGCATACCAAGATGGGCC;

[0016] GDF2-4-FT:GGGCGAGAGCATACCAAGATGGGTC;

[0017] GDF2-R: TGCGGTGGCTCGGCTCGGGTTCTGT.

[0018] The primers for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle are designed based on the nucleotide sequence of the bovine GDF2 gene sequence GenBank Accession No. NC_037355.1: 42263200-42267306 published in the NCBI database.

[0019] The above-mentioned primers for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle have two upstream primers with BIOTIN modification at the 5' end and LNA modification at the 3' end; and the downstream primer with FITC modification at the 5' end.

[0020] The present invention also provides a kit for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle, and the kit comprises any one of the primers described above.

[0021] The above-mentioned kit for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle also includes 2×Marathon Buffer, dNTP, Marathon DNA polymerase and ddH2O.

[0022] The present invention also provides a method for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle, the method comprising the following steps:

[0023] (1) Take the sample to be tested and use GDF2-4-F-C + GDF2-R primers to perform PCR amplification reaction; at the same time, use GDF2-4-F-T + GDF2-R primers to perform PCR reaction;

[0024] (2) After the reaction is completed, open the PCR reaction tube, insert the binding pad end of the test strip into the PCR reaction tube, wait for the reading area to be completely soaked, lay the test strip flat for 1 minute, wait for the test strip to develop color, and judge the result based on the color development of the test strip; the judgment standard for the color development of the test strip is:

[0025] When the GDF2-4-FT primer was negative and the GDF2-4-FC primer was positive, the genotype was CC;

[0026] When the GDF2-4-FT primer was positive and the GDF2-4-FC primer was positive, the genotype was CT;

[0027] When the GDF2-4-FT primer is positive and the GDF2-4-FC primer is negative, the genotype is TT.

[0028] In the above-mentioned method for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle, the reaction system in step (1) is:

[0029]

[0030] In the above method for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle, the sample to be tested is bovine whole blood or bovine DNA.

[0031] In the above method for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle, the reaction conditions in step (1) are: pre-denaturation at 94°C for 3 minutes; denaturation at 98°C for 20 seconds, annealing temperature 62-74°C, reaction time 30 seconds, extension at 72°C for 20 seconds, a total of 29 cycles, extension at 72°C for 10 minutes, and storage at 4°C.

[0032] In the above method for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle, the annealing temperature is 72°C.

[0033] The molecular marker, the marker primer for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle, the kit and the detection method of the present invention are used in the genotyping and identification of Pinan cattle.

[0034] The molecular marker, the marker primer for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle, the kit and the detection method of the invention are used in identifying the body size trait of Pinan cattle.

[0035] Compared with the prior art, the present invention has the following beneficial effects:

[0036] 1. The present invention discovers and provides for the first time a new SNP site in the GDF2 gene in the Pinan cattle population, and finds that the polymorphism of this site is correlated with the growth traits of Pinan cattle, which can provide a theoretical basis for the breeding of Pinan cattle.

[0037] 2. The present invention associates the single nucleotide polymorphism at the g.4 position of the bovine GDF2 gene with the body size traits of Pinan cattle and finds that the TT genotype has a significant effect on the weight, chest circumference and abdominal circumference of Pinan cattle (P < 0.05). The SNP typing results of the g.4 site of the GDF2 gene can be used in the auxiliary breeding of Pinan cattle, thereby promoting the variety breeding process of Pinan cattle.

[0038] 3. The present invention designs amplification primers for the mutation site of SNP g.4C>T, the 3' end of the forward primer or the reverse primer in the amplification primer corresponds to the SNP site to be tested, and the nucleotides at the 3' end of the SNP site to be tested are modified by LNA, which can significantly improve the specificity of binding between the PCR amplification primer and the template DNA chain, so that it can completely and correctly follow the base pairing principle for PCR amplification, so as to achieve the purpose of judging the nucleotide type of the target site by detecting the presence or absence of the amplification product, and realize the genotyping of the SNP site to be tested.

[0039] 4. The GDF2 gene g.4 site SNP rapid detection method constructed by the present invention can still obtain accurate typing results after the amplified PCR product is diluted 5000-10000 times, and has high sensitivity.

[0040] 5. The GDF2 gene g.4 site SNP rapid detection method constructed by the present invention can visualize its genotyping results, and the results can be observed within 1-3 minutes. The sensitivity is several levels higher than that of agarose gel, and the CC, CT, and TT genotypes of the g.4C>T site can be accurately detected.

[0041] 6. The GDF2 gene g.4 site SNP rapid detection method constructed by the present invention can directly detect bovine whole blood, is simple to operate, short in time, low in cost, high in accuracy, and significantly improves the detection efficiency.

[0042] 7. The GDF2 gene g.4 site SNP rapid detection method constructed by the present invention can effectively improve the specificity of primers and templates, reduce primer dimers, and avoid false positives by controlling primer sequences, reaction systems, and reaction conditions.

[0043] 8. The present invention can directly observe through the test strip without the need to use an agarose gel system for detection, is easy to operate, and can quickly obtain test results.

[0044] 9. The test strip of the present invention has high accuracy, and can not only accurately and quickly perform Pinan cattle genotyping detection, but also has lower cost than direct sequencing, has a wide range of applications, and is conducive to promotion. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1This is the electrophoresis diagram of PCR amplification of the first exon of the GDF2 gene in Pinan cattle.

[0046] Figure 2 It is the peak diagram of sequencing of mixed pool DNA template.

[0047] Figure 3 It is the verification result of the concentration of the SNP marker primer of the present invention; M is DL2000 DNA Marker; Lane 1-2 is the target band amplified by 10× diluted primers, and Lane 3-4 is the target band amplified by 100× diluted primers.

[0048] Figure 4 The PCR amplification results of the SNP marker primers of the present invention at different annealing temperatures; Note: M is DL2000DNAMarker; the annealing temperatures of lanes 1-6 are 62°C, 65.3°C, 67.0°C, 69.4°C, 71.8°C, and 74.0°C, respectively; the amplification primer is GDF2-4-FC, and the amplification template is the wild homozygous CC individual DNA.

[0049] Figure 5 It is the accuracy test result of the SNP marker primer of the present invention; Note: M is DL2000 DNA Marker; Lanes 1-2 are the result bands amplified by the marker upstream primer GDF2-4-FC and the universal downstream primer GDF2-R; Lanes 3-4 are the target bands amplified by the marker upstream primer GDF2-4-FT and the universal downstream primer GDF2-R; Lanes 1 and 3 used TT genotype templates for amplification, and lanes 2 and 4 used CC genotype templates for amplification.

[0050] Figure 6 It is the PCR amplification result of the SNP marker primers of the present invention for the blood sample; Note: M is DL2000 DNAMarker; Lanes 1-3 are the target bands amplified by the upstream primer GDF2-4-FC and the downstream primer GDF2-R, and the template used is the blood sample of the CC genotype Pinan cattle; Lanes 4-6 are the target bands amplified by the upstream primer GDF2-4-FT and the downstream primer GDF2-R, and the template is the blood sample of the TT genotype Pinan cattle.

[0051] Figure 7 It is the PCR amplification result of the SNP marker primer of the present invention under the condition of mismatch; Note: M is DL2000 DNAMarker; Lanes 1-3 are the target bands amplified by the upstream primer GDF2-4-FT and the downstream primer GDF2-R, and the template used is the blood sample of the CC genotype Pinan cattle; Lanes 4-6 are the target bands amplified by the upstream primer GDF2-4-FC and the downstream primer GDF2-R, and the template is the blood sample of the TT genotype Pinan cattle.

[0052] Figure 8 This is a schematic diagram of the detection principle of the SNP typing visualization test strip for blood samples of the present invention.

[0053] Fig. 9 The present invention provides a test strip structure and interpretation standard in the kit.

[0054] Fig.10 10-A is the test strip sensitivity test result of the present invention; 10-A is the test strip test result of the PCR product diluted 2000 times, 5000 times, 8000 times and 10000 times with ultrapure water respectively; 10-B is the test strip test result of the CC and TT genotype individual blood after the PCR product was diluted 5000 times.

[0055] Fig.11 The results of electrophoresis test of SNP sites in blood samples of 10 Pi Nan cattle; Note: The primers of upstream primers in lanes 1, 3, 5, 7, 9, 11, 13, 15, 17, and 19 are GDF2-4-FT, and the primers of upstream primers in lanes 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 are GDF2-4-FC; Lanes 1 to 2 are the test results of Pi Nan cattle with ear number S1320057, lanes 3 to 4 are the test results of Pi Nan cattle with ear number S2120065, lanes 5 to 6 are the test results of Pi Nan cattle with ear number S2520069, Lanes 7 to 8 are the test results of Pinan cattle with cow ear number S2820072, lanes 9 to 10 are the test results of Pinan cattle with cow ear number S3620080, lanes 11 to 12 are the test results of Pinan cattle with cow ear number S1720061, lanes 13 to 14 are the test results of Pinan cattle with cow ear number S4120085, lanes 15 to 16 are the test results of Pinan cattle with cow ear number S2920073, lanes 17 to 18 are the test results of Pinan cattle with cow ear number S3120075, and lanes 19 to 20 are the test results of Pinan cattle with cow ear number S2320067.

[0056] Fig.12The results of SNP test strips on blood samples from 10 Pi Nan cattle; Note: The primers of test strips 1, 3, 5, 7, 9, 11, 13, 15, 17, and 19 are GDF2-4-FT, and the primers of test strips 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 are GDF2-4-FC; test strips 1 to 2 are the test results of Pi Nan cattle with ear number S1320057, test strips 3 to 4 are the test results of Pi Nan cattle with ear number S2120065, test strips 5 to 6 are the test results of Pi Nan cattle with ear number S2520069, and test strips 7 to 8 are the test results of Pi Nan cattle with ear number S2620069. The first and second test strips are the test results of Pinan cattle with ear number S2820072, test strips 9 to 10 are the test results of Pinan cattle with ear number S3620080, test strips 11 to 12 are the test results of Pinan cattle with ear number S1720061, test strips 13 to 14 are the test results of Pinan cattle with ear number S4120085, test strips 15 to 16 are the test results of Pinan cattle with ear number S2920073, test strips 17 to 18 are the test results of Pinan cattle with ear number S3120075, and test strips 19 to 20 are the test results of Pinan cattle with ear number S2320067.

[0057] Fig.13 It is the electrophoresis diagram of the primers digested with enzymes.

[0058] Fig.14 The results of restriction enzyme typing of genomic DNA of 10 Pi Nan cattle; Note: The complete amplification of the 280bp fragment is the CC genotype, the amplification of three bands of 280bp, 259bp and 21bp is the CT genotype; the amplification of two bands of 259bp and 21bp is the TT genotype. DETAILED DESCRIPTION

[0059] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0060] Example 1: This example provides a Pinan cattle GDF2 gene SNP site and detection method, which mainly includes the following contents.

[0061] 1. Materials and methods

[0062] The experimental animals were all from the G4 generation of the core group of the new Pinan cattle group selected and bred by the research team at the Nanyang Pinan cattle farm. The feeding and management were carried out in accordance with the standard feeding and management methods for Pinan cattle. The body size data of each individual to be tested was measured. At the same time, the tail vein blood sample of each individual to be tested was collected and placed in an EDTA-K2 vacuum blood collection tube. 10 ml of tail vein blood was collected from each individual to be tested and stored at -20℃ for future use. The handling of animals complies with the rules and requirements of the Animal Welfare Committee of Henan Institute of Science and Technology.

[0063] The extraction of genomic DNA from the blood of Pinan cattle was performed using the BioTeke whole blood genomic DNA extraction kit (centrifugal column type) according to the operating instructions of the kit. The concentration and purity of the extracted DNA were tested. The qualified requirements were that the DNA yield of 1ml fresh whole blood reached 15-30μg and the OD260 / 280 ratio was in the range of 1.7-1.9. The qualified genomic DNA was placed in a -20℃ refrigerator for future use.

[0064] 2. Primer design

[0065] Using the bovine GDF2 gene sequence (GenBank Accession No. NC_037355.1: 42263200-42267306) published in the NCBI database (http: / / www.ncbi.nlm.gov / ) as a reference, a specific primer P1 was designed for the first exon of the GDF2 gene using the tool Primer Premier 5 to amplify a partial fragment of the bovine GDF2 gene. The primers were synthesized by Shanghai Shenggong Biotechnology Co., Ltd.

[0066] GDF2Exon1F: 5′-TTAGCCCTGTGCGTTTGTCA-3′ (SEQ ID NO. 1);

[0067] GDF2Exon1R: 5'-GTGTTAATGTGGTGCTGGGC-3' (SEQ ID NO. 2).

[0068] Preparation of mixed template: Select DNA samples of 5 distantly related Pi Nan cattle, draw 5 μL of each DNA sample, and mix them into 25 μL of mixed DNA template.

[0069] Use the synthetic primer pair P1 and the mixed DNA as a template to perform PCR amplification reaction to obtain PCR products. Figure 1 As shown, the length of the amplified product is 916 bp.

[0070] The results of primer pair P1 amplification using mixed DNA as template are as follows:

[0071] TTAGCCCTGTGCGTTTGTCAGATGTTTATAGAGCCTTCATTAACAGAGAGCCCCCTTAGATAAGAGGCCTGAACAGCATCAAGGGCCAGATAAGAACAAGTGGAGGGCACTTCGGGGACAGCAGAAGGGTGAGCCTGTGAACTGGCCCGGGTGCGCTGTACAGAGCTGTGCAGGACAATGCAGGCCGGCTCCTTCCGGGCTCCTCCCAGCACCCGCTAACACACCGCGGCTGCCGCAGTCTCTAGACCCGGGCGAGAGCATACCAAGATGGGCCGTGGGGCGCTCTGGGTGGCCCTGCCTGTGCTCTGCCTGCTGGCCTGCTCCGCCCTAGGGAAGCCACTGGAGAACCGGGGGCGGCCGTCCACTGGGGCAGATGCCCACGGCCTGCTAGGGGGGCCCGGCGGTGAGCAGGAGGGGGTCACCTTCGACCTGAGGATGTTCCTGGAGAACATGAAAGTGGATTTTCTGCGCAACCTCAACCTGAGTGGGGTCCCTTCTCAGGACAGAACCCGAGCCGAGCCACCGCAGTACATGATCGATCTATACAACAGATATACCACCGACAAGACGTCCACCCCTGCGTCAAACATTGTGCGCAGCTTCAGCGTGGAAGGTAGAGTCGGCTCCACGGGGCGCCCCGGGTGGGGGCGGGGGGCTCAGCGGTCGGCTCACGGCTGCGCTGCCCAATATGGTGGCCACTGGAGACGTGGGACTCTTTGTTTCAATTTAGGTTAATCTAAATGAAATAAAATTAATAATTTAGTTTCAGTAGCTTGGGTGCAAGTGCTCAGCAATCACGCCTAGCTACCCTATAGGAAATGGAGACTGTAGAACAATTCCATCATTGCGTAAAGTTCTACCAGACAGCTCTGCTCTAGAAAATTCTCCCTCTCTGGGCCCAGCACCACATTAACAC(SEQ ID NO.3).

[0072] The PCR reaction system is shown in Table 1 below.

[0073] Table 1 PCR reaction system

[0074]

[0075] The PCR reaction program is:

[0076]

[0077] The PCR products after mixed pool amplification using primer pair P1 were sequenced by Shanghai Shenggong Biotechnology Co., Ltd. The peak graphs of the sequencing results were compared using SeqMan in the DNAStar tool, as shown in Figure 1. Figure 2 As shown, there is a C / T mutation at position g.4 of the gene.

[0078] Example 2: Based on Example 1, this example designs a marker primer for the SNP at the g.4 site of the GDF2 gene of Pinan cattle, which mainly includes the following contents.

[0079] 1. Materials and methods

[0080] The experimental animals were all from the G5 generation of the core group of the new Pinan cattle group selected and bred by the research team at the Nanyang Pinan cattle farm. The feeding and management were carried out in accordance with the standard feeding and management methods for Pinan cattle. 10 mL of tail vein blood was collected from each individual, placed in EDTA anticoagulant tubes, numbered, and stored at -20°C. The handling of animals complied with the rules and requirements of the Animal Welfare Committee of Henan Institute of Science and Technology.

[0081] 2. Design of primers for SNP site markers

[0082] According to the nucleotide sequence of the bovine GDF2 gene sequence GenBank Accession No.NC_037355.1 published in the NCBI database, after alignment by DNAMAN (8.0), amplification primers were designed according to the nucleotide sequence shown in positions 42263200-42267306 of the sequence. The design principles are: the annealing temperature of the upstream and downstream primers is kept consistent, and the size of the amplified product is between 200 and 300 bp; the 3' end of the upstream primer or the downstream primer is the SNP site to be tested, specifically the penultimate or second to last position at the 3' end; the 5' end of the upstream primer is modified with biotin and the 3' end is modified with LNA; the 5' end of the downstream primer is modified with fluorescein isothiocyanate (FITC); the primer sequences shown in Table 2 below were obtained and synthesized by Anhui General Biological Co., Ltd.

[0083] Table 2 Primers for detecting 4 loci of GDF2 gene

[0084]

[0085] Note: The penultimate italic base at the 3' end of the two upstream primers was LNA modified.

[0086] 3. Establishment of primer concentration

[0087] After the modified primers are synthesized, the dry powder is diluted to the storage concentration (100 μM) using DEPC water, and then the stored primers are diluted 10-fold and 100-fold to determine the optimal primer working concentration. After the primers are diluted, they are placed in an ice box for later use.

[0088] The genomic DNA of Pinan cattle extracted earlier in the laboratory was used as a template, and PCR reactions were performed with 10× and 100× primer concentrations, respectively. The reaction system and reaction procedure are shown in Tables 3 and 4 below. In order to avoid false positive results in subsequent experiments, a higher annealing temperature was directly selected.

[0089] Table 3 Labeled primer amplification system

[0090]

[0091] Table 4 Labeled primer PCR reaction system

[0092]

[0093] After the reaction program was completed, the PCR product was identified by agarose gel electrophoresis. Figure 3 , Figure 3 Lanes 1-4 are the target bands; Lanes 1-2 are the target bands amplified by 10× diluted primers, and Lanes 3-4 are the target bands amplified by 100× diluted primers; M is DL2000 DNA Marker. Select the most appropriate primer concentration based on the identification results.

[0094] Depend on Figure 3 It can be seen that lanes 1-4 are bright and single, with dimers present below lane 1-2, and lanes 3-4 are bright and clean. It can be verified here that when the labeled primer is diluted 100×, the conditions that meet the requirements for continuing the subsequent experiments are met.

[0095] At the same time, a gradient annealing temperature exploration was performed, and the PCR amplification annealing temperature was 62°C, 65.3°C, 67.0°C, 69.4°C, 71.8°C, and 74.0°C. The temperature exploration electrophoresis was as follows Figure 4 As shown, Figure 4 The temperatures of middle lanes 1-6 were 62°C, 65.3°C, 67.0°C, 69.4°C, 71.8°C, and 74.0°C, respectively.

[0096] Depend on Figure 4 It can be seen that the color is brightest at 71.8°C, and the optimal annealing temperature is determined to be 72°C.

[0097] 4. Primer accuracy test

[0098] In order to test whether the designed marker primers can accurately identify the marker of the SNP at the g.4 site of the GDF2 gene and thus achieve accurate amplification, primer cross-validation was then performed, that is, PCR amplification was performed using the genomic DNA of the homozygous TT individual with the GDF2 g.4C>T site mutation and the wild homozygous CC individual as templates, and the corresponding genotype groups were set.

[0099] The specific operation is that the upstream primer GDF2-4-FC and the universal downstream primer GDF2-R are used as a set to react with the wild homozygous CC individual genomic DNA template; the upstream primer GDF2-4-FT and the universal downstream primer GDF2-R are used as a set to react with the mutant homozygous TT individual genomic DNA template;

[0100] At the same time, the mismatch genotype group was set, that is, the upstream primer GDF2-4-FC and the universal downstream primer GDF2-R were set as a group to react with the genomic DNA template of the homozygous TT individual; the upstream primer GDF2-4-FT and the universal downstream primer GDF2-R were set as a group to react with the genomic DNA template of the homozygous CC individual. The reaction procedure and amplification system were consistent with Tables 3 and 4.

[0101] After the reaction is completed, take 4 μL of the target product of PCR amplification, add 2 μL of 6× Loading Buffer, mix by pipetting, and spot on 1.0% agarose gel for identification. The results are shown in Figure 5 ; Figure 5 Lanes 1-2 are the result bands amplified by the labeled upstream primer GDF2-4-FC and the universal downstream primer GDF2-R; lanes 3-4 are the target bands amplified by the labeled upstream primer GDF2-4-FT and the universal downstream primer GDF2-R; lanes 1 and 3 used TT genotype templates for amplification, and lanes 2 and 4 used CC genotype templates for amplification.

[0102] Depend on Figure 5 It can be seen that in lane 1-2 amplified by the upstream primer GDF2-4-FC, PCR can accurately amplify the CC genotype fragment, while the TT genotype cannot be amplified; the 3-4 lane GDF2-4-FT primer can accurately identify the TT genotype in the DNA genome during the PCR process, while the CC genotype cannot be amplified. The results show that the locked nucleic acid marker in the primer can accurately identify the T / C allele in the genomic DNA.

[0103] Example 3: Based on Example 2, this example provides a method for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle, specifically using blood instead of genomic DNA as a template. The main contents are as follows.

[0104] In Example 2, it has been successfully verified that the labeled primer can successfully identify the C / T allele in the genomic DNA. Therefore, this example uses the extraction-free lysis solution to treat whole blood method instead of genomic DNA, and directly uses blood as a template for amplification to verify whether the labeled primer can also show excellent amplification efficiency. When using the labeled primer to amplify blood as a template, considering that some components in the blood will inhibit the amplification reaction of PCR, we choose a DNA polymerase that can tolerate the inhibitory function of blood on the PCR reaction, and can directly amplify the target sequence from the blood sample. The polymerase is provided by Tiosbio (Beijing) Company, the blood PCR reaction procedure is consistent with Table 4, and the amplification system is shown in Table 5 below (the polymerase used in this system needs to be completely thawed and dissolved when used. The polymerase is in a liquid state below -20°C and may freeze above this temperature, so Marathon DNA polymerase is added at the end of the operation).

[0105] Table 5 Blood PCR amplification system

[0106]

[0107] After the PCR amplification process was completed, the PCR products were identified by agarose gel electrophoresis. The electrophoresis was run using 1% agarose gel at 150V for 30 minutes and then observed under a gel imager. The results are as follows Figure 6 As shown, Figure 6 Lanes 1-3 are the target bands amplified by the upstream primer GDF2-4-FC and the downstream primer GDF2-R, and the template used is the blood sample of the CC genotype Pinan cattle; lanes 4-6 are the target bands amplified by the upstream primer GDF2-4-FT and the downstream primer GDF2-R, and the template used is the blood sample of the TT genotype Pinan cattle.

[0108] Depend on Figure 6 It can be seen that the labeled modified primers can directly amplify the desired target fragment from the blood.

[0109] At the same time, in order to verify whether the locked nucleic acid (LNA) modification of the labeled primer can accurately identify the T / C allele in the blood genome, this example performs cross-validation, that is, the upstream primer GDF2-4-FT and the downstream primer GDF2-R are used to perform PCR amplification using the blood sample of the CC genotype of Pinan cattle as a template. Similarly, another upstream primer GDF2-4-FC and the downstream primer GDF2-R are used to perform PCR amplification using the blood sample of the TT genotype of Pinan cattle as a template. After amplification, electrophoresis identification is performed, and the identification results are as follows Figure 7 shown.

[0110] Depend on Figure 7 It can be seen that no target bands appeared on the gel, indicating that during the PCR reaction, the locked nucleic acid modification on the labeled primer can accurately identify the T / C allele in the blood genome.

[0111] Example 4: This example constructs a rapid visual detection kit based on Example 3, specifically using a test strip to measure the PCR product to perform visual detection of the SNP typing of the Pinan cattle GDF2 gene. The specific detection method is as follows:

[0112] GDF2-4-F-C + GDF2-R primers are used for PCR amplification reaction, and individual blood samples or individual genomic DNA samples can be selected as templates; in order to verify the judgment criteria of the test strip, this embodiment specifically selects wild homozygous CC individual blood or wild homozygous CC individual genomic DNA, mutant homozygous TT individual blood or mutant homozygous TT individual genomic DNA as templates for PCR amplification reaction. Figure 8 The supernatant was extracted and PCR amplified after treatment with the non-extraction lysis buffer, and the DNA sample was directly PCR amplified. At the same time, GDF2-4-F-T+GDF2-R primers were used for PCR amplification reaction; the reaction conditions and reaction system are shown in Table 3 and Table 4 respectively.

[0113] After the reaction is completed, open the PCR reaction tube, insert the conjugate pad end of the test strip into the PCR reaction tube, wait for the judgment area to be completely soaked, lay the test strip flat for 1 minute, wait for the quality control line (C line) to develop color, then take out the test strip and read the test result directly according to the color development of the test strip. The structure of the test strip and the judgment standard are as follows: Fig. 9 shown.

[0114] The results showed that for samples with CC genotype, the amplification product of GDF2-4-FT primer was negative, and the amplification product of GDF2-4-FC primer was positive; for samples with TT genotype, the amplification product of GDF2-4-FT primer was positive, and the amplification product of GDF2-4-FC primer was negative; if the GDF2-4-FT primer was positive and the GDF2-4-FC primer was positive, the genotype was CT.

[0115] Example 5: Kit performance determination and application

[0116] 1. Sensitivity test

[0117] In order to verify the sensitivity of the kit of the present invention, the upstream primer GDF2-4-FC and the universal downstream primer GDF2-R were used for the reaction in this example, and the template was selected from the homozygous individuals of CC genotype. After the PCR reaction was completed, the PCR products were diluted 2000 times, 5000 times, 8000 times and 10000 times with ultrapure water, respectively, and the diluted products were placed in new EP tubes and numbered 1-4 (see Fig.10 -A).

[0118] Insert the binding pad end of the test strip (Tiosbio, Beijing) into the EP reaction tube respectively. The reaction solution should not exceed the top of the binding pad. After standing, the reading area of ​​the test strip slowly moistens from bottom to top, and the reading area is completely soaked. After the quality control line (C line) develops color, take out the test strip and observe the result within 10 minutes. Read the test result directly according to the color development of the test strip to determine the most appropriate concentration of the reaction solution. Next, use the upstream primer GDF2-4-FC and the universal downstream primer GDF2-R to amplify the blood samples of individuals with CC genotype and individuals with TT as templates. According to the previous operation process, the diluted PCR product is identified with the test strip to verify the sensitivity and accuracy of the test strip. The results Fig.10 -B, Figure 1-2 shows the test results of blood of individuals with CC and TT genotypes after 5000-fold dilution.

[0119] Read the test results directly according to the color development of the test strip to determine the most appropriate concentration of the reaction solution. Next, to prevent the generation of false positives, use the upstream primer GDF2-4-FC and the universal downstream primer GDF2-R to amplify the blood samples of individuals with CC genotype and individuals with TT as templates. According to the previous operation process, the diluted PCR products are identified with the test strip to verify the sensitivity and accuracy of the test strip.

[0120] Depend on Fig.10-A It can be seen that the test strips with dilution times of 2000 times, 5000 times, 8000 times and 10000 times have blue quality control lines (C lines) and red detection lines (T lines). Labels 1-4 can detect the nucleic acid content in the PCR reaction solution. When the reaction solution is diluted to 10000 times, it can still be identified, and a light pink band appears, which is positive, indicating that the test strip has high sensitivity.

[0121] Depend on Fig.10 -B shows that test strip No. 1 has a red detection line and a blue quality control line, while test strip No. 2 has no detection line but only a single blue quality control line, indicating that under the conditions of 100-fold dilution of primers and 5000-fold dilution of PCR products, the test strip can accurately identify the T / C allele in the blood PCR reaction product, and determine 5000-fold dilution as the most appropriate concentration for the test strip.

[0122] 2. Accuracy experiment

[0123] 10 Pi Nan cattle were randomly selected, and the ear numbers were S1320057, S2120065, S2520069, S2820072, S3620080, S1720061, S4120085, S2920073, S3120075, and S2320067. The upstream primer GDF2-4-FC and the upstream primer GDF2-4-FT were used in combination with the universal downstream primers. The blood samples of the 10 Pi Nan cattle were used as templates for blood PCR amplification, that is, the blood template of one Pi Nan cattle was amplified with two pairs of primers GDF2-4-F-C+GDF2-R and GDF2-4-F-T+GDF2-R. After the amplification, 4 μL of PCR product was taken for agarose gel electrophoresis detection. The detection results are as follows Fig.11 shown.

[0124] Depend on Fig.11 It can be seen that the labeled primers can accurately identify the locked nucleic acid modification and amplify the sequence correctly.

[0125] The PCR product was diluted 5000 times and numbered 1-20, where the odd-numbered test strips were GDF2-4-F-T+GDF2-R primers and the even-numbered test strips were GDF2-4-F-C+GDF2-R. The PCR product was tested using the test strips, and the test results are as follows Fig.12 shown.

[0126] Depend on Fig.12 It can be seen that according to the judgment criteria determined in Example 6, the genotypes of the 10 cows are judged to be: CC, CC, CC, CT, CT, TT, CC, CC, CC, CC.

[0127] In order to verify the accuracy of the test results of the test strip of the present invention, the restriction primer P2 was designed using the dCAPSFinder2.0 tool and the Primer Premier 5 software for the polymorphism of the g.4 site, as shown below:

[0128] Upstream F: 5'-CCGGGCGAGAGCATACCAAGACGCG-3' (SEQ ID NO. 7);

[0129] Downstream R: 5'-TGCGGTGGCTCGGCTCGGGTTCTGT-3' (SEQ ID NO. 8).

[0130] The design principle of enzyme primers is to have a suitable fast-cutting enzyme recognition site at the end of the upstream primer, so that a fast-cutting enzyme recognition sequence can be created in the absence of a suitable natural fast-cutting enzyme recognition sequence.

[0131] In principle, a maximum of two base changes are allowed when creating restriction sites.

[0132] When designing primers, ensure that the first position after the primer sequence is the mutation site.

[0133] When creating a suitable restriction endonuclease recognition sequence, ensure that there is no naturally occurring restriction endonuclease recognition sequence elsewhere in the sequence.

[0134] PCR amplification and agarose gel electrophoresis were performed using primer pair P2 and genomic DNA of a single Pinan cattle as template.

[0135] The P2 primer PCR reaction system is shown in the table below.

[0136] Table 6 P2 primer PCR reaction system

[0137]

[0138]

[0139] The PCR reaction procedure for the P2 primer is:

[0140]

[0141] The P2 primer pair amplifies the following sequence:

[0142] CCGGGCGAGAGCATACCAAGATGGGCCGTGGGGCGCTCTGGGTGGCCCTGCCT

[0143] GTGCTCTGCCTGCTGGCCTGCTCCGCCCTAGGGAAGCCACTGGAGAACCGGGGGCG

[0144] GCCGTCCACTGGGGCAGATGCCCACGGCCTGCTAGGGGGGCCCGGCGGTGAGCAGG

[0145] AGGGGGTCACCTTCGACCTGAGGATGTTCCTGGAGAACATGAAAGTGGATTTTCTGC

[0146] GCAACCTCAACCTGAGTGGGGTCCCTTCTCAGGACAGAACCCGAGCCGAGCCACCG

[0147] CA (SEQ ID NO. 9).

[0148] The PCR product amplified by P2 primer was subjected to agarose gel electrophoresis. The gel quality used was 1% agarose gel. The electrophoresis results were as follows: Fig.13 As shown, the result is a product of 280 bp in length.

[0149] The PCR product of the P2 primer was digested with restriction endonuclease Mlu I. The digestion system is shown in Table 7 below.

[0150] Table 7 Enzyme digestion system of PCR product of primer P2 using Mlu I for single digestion

[0151]

[0152]

[0153] The digestion conditions of the PCR product of primer P2 are 37°C for 30-60 min.

[0154] The product after enzyme digestion was subjected to agarose gel electrophoresis test. The gel mass used was 2% agarose gel. After the gel was prepared, the sample was spotted and electrophoresed at a voltage of 120V for 1-1.5 hours.

[0155] After electrophoresis, take out the gel and put it under a gel imager to check the typing results. Fig.14 shown.

[0156] The results show that when no mutation occurs, the recognition site of Mlu I cannot be formed and cannot be cut, and the 280bp fragment is completely amplified, which is the CC genotype; when one DNA chain mutates, it contains a recognition site of Mlu I and can be cut into three bands of 280bp, 259bp and 21bp, which is the TC genotype; when both DNA chains mutate, they can be cut into two bands of 259bp and 21bp, which is the TT genotype. Since the 21bp band is too small, it is not easy to be observed in the agarose gel, so the results presented on the gel are a band of 280bp for the CC genotype, two bands of 280bp and 259bp for the TC genotype, and a band of 259bp for the TT genotype.

[0157] The genotyping results were compared with the test strip results and the results are shown in Table 8 below.

[0158] Table 8 Comparison results between enzyme typing method and test strip detection method

[0159]

[0160] Note: Test strip 1-2 means the first and second test strips, and so on.

[0161] It can be seen from Table 8 that the enzyme typing results are consistent with the test strip results, indicating that the marker primer GDF2-4-FC can accurately identify the C allele in the blood genome without interference from the T allele; similarly, the marker primer GDF2-4-FT can accurately identify the T allele in the blood genome without interference from the C allele. This shows that the kit constructed by the present invention can visually and accurately screen the SNP sites and can correctly perform typing.

[0162] Example 6: In order to further analyze the polymorphism of single nucleotide of GDF2 gene of Pinan cattle, the present example conducts statistical analysis of genotype frequency of SNP at g.4 site of GDF2 gene of Pinan cattle. The statistical analysis of g.4C>T site of GDF2 gene is shown in Table 9.

[0163] Table 9 Statistical analysis of GDF2 gene g.4C>T site

[0164]

[0165] As shown in Table 9, P>0.05 indicates that the population genes are in genetic balance, and the SNP conforms to the Hardy-Weinberg equilibrium law of population genetics.

[0166] Example 7: In order to verify the relationship between the polymorphism of the GDF2 gene g.4 locus and body size traits, this example analyzed the body size trait indicators of different genotypes. The results are shown in Table 10 below.

[0167] Table 10 Weight, chest circumference and abdominal circumference of different genotypes of Pinan cattle

[0168]

[0169] Note: The same letters in the superscript of the values ​​in the table indicate no significant difference (P>0.05), while different letters indicate significant difference (P<0.05).

[0170] As can be seen from Table 10, there is a correlation between the single nucleotide polymorphism of the GDF2 gene of Pinan cattle and the growth traits of Pinan cattle. In Pinan cattle, the weight, chest circumference and abdominal circumference of individuals with the TT genotype at the g.4 locus are significantly higher than those with the CC and CT genotypes, indicating that TT is an excellent allele. In breeding practice, individuals containing this allele should be retained to speed up the selection and breeding of Pinan cattle.

[0171] The above description is only a preferred embodiment of the present invention and does not limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for detecting SNP molecular markers related to body size traits of southern cattle, characterized by: The following steps are involved: S1. Select several Pinan cattle, measure their body size data and record their relationship by number, collect venous whole blood from each Pinan cattle, extract individual genomic DNA, test its concentration and purity, and select qualified DNA; S2, selecting DNA from 5 distantly related Pinan cattle individuals and mixing them to obtain a tube of mixed pool DNA template; S3, designing and synthesizing amplification primer pair P1, wherein the nucleotide sequences of the amplification primer pair are shown in SEQ ID NOs. 1 and 2; S4, using the mixed pool DNA as a template, and performing PCR amplification reaction with primer pair P1 to obtain the PCR amplification product of primer P1; S5. Sequence the amplified product to obtain the sequenced gene sequence and peak graph; compare the sequencing results with the peak graph to determine that the mutation site g.4 is a C>T base mutation.

2. A primer for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle, characterized in that: The sequences of the detection primers are: GDF2-4-FC: GGGCGAGAGCATACCAAGATGGGCC; GDF2-4-FT:GGGCGAGAGCATACCAAGATGGGTC; GDF2-R: TGCGGTGGCTCGGCTCGGGTTCTGT.

3. The primer for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle as claimed in claim 2, characterized in that: The 5' ends of the two upstream primers were modified with BIOTIN and the 3' ends were modified with LNA; the 5' end of the downstream primer was modified with FITC.

4. A kit for detecting SNP at the g.4 site of the GDF2 gene of Pinan cattle, characterized in that: The kit comprises the primers according to any one of claims 2 to 3.

5. The kit for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle as claimed in claim 4, characterized in that: Also included are 2× Marathon Buffer, dNTPs, Marathon DNA polymerase, and ddH2O.

6. A method for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle, characterized in that: The method comprises the following steps: (1) Take the sample to be tested and use GDF2-4-F-C + GDF2-R primers to perform PCR amplification reaction; at the same time, use GDF2-4-F-T + GDF2-R primers to perform PCR reaction; (2) After the reaction is completed, open the PCR reaction tube, insert the binding pad end of the test strip into the PCR reaction tube, wait for the reading area to be completely soaked, lay the test strip flat for 1 minute, wait for the test strip to develop color, and judge the result based on the color development of the test strip; the judgment standard for the color development of the test strip is: When the GDF2-4-FT primer was negative and the GDF2-4-FC primer was positive, the genotype was CC; When the GDF2-4-FT primer was positive and the GDF2-4-FC primer was negative, the genotype was TT; When the GDF2-4-FT primer is positive and the GDF2-4-FC primer is positive, the genotype is CT.

7. The method for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle as claimed in claim 6, characterized in that: The reaction system in step (1) is:

8. The method for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle as claimed in claim 6, characterized in that: The reaction conditions in step (1) are: pre-denaturation at 94°C for 3 min; denaturation at 98°C for 20 s, annealing temperature 62-74°C, reaction time 30 s, extension at 72°C for 20 s, a total of 29 cycles, extension at 72°C for 10 min, and storage at 4°C.

9. The method for detecting the SNP at the g.4 site of the GDF2 gene of Pinan cattle as claimed in claim 8, characterized in that: The annealing temperature is 72°C.

10. Use of the kit according to any one of claims 4 to 5 and the method according to any one of claims 6 to 9 in genotyping and identification of Pinan cattle.

Images