Detection method and detection reagent for chondrogenic differentiation potential of mesenchymal stem cells

Abstract

The invention provides a detection method and a detection reagent for chondrogenic differentiation potential of mesenchymal stem cells, and belongs to the technical field of cell culture. According to the present invention, the mRNA relative expression quantity of the type II collagen (Collagen II) gene is adopted as the detection purpose, the qPCR technology is adopted to detect at the certain stage of the cell induction culture so as to accurately evaluate the chondrogenic differentiation potential of the to-be-detected mesenchymal stem cell, the time required by the whole detection is substantially shortened, the larger the relative expression quantity is, the higher the chondrogenic differentiation ability is, and the detection result shows that the chondrogenic differentiation potential of the to-be-detected mesenchymal stem cell can be accurately evaluated, such that the chondrogenic differentiation potential of the to-be-detected mesenchymal stem cell can be accurately evaluated; quantitative detection of the chondrogenic differentiation capacity of the mesenchymal stem cells can be realized to a certain extent, and the method has great popularization and application values.

Description

Technical Field

[0001] The invention belongs to the technical field of cell culture, and in particular relates to a method and a reagent for detecting the chondrogenic differentiation potential of mesenchymal stem cells. Background Art

[0002] Mesenchymal stem cells (MSCs) are adult stem cells with high self-renewal ability and multidirectional differentiation potential. Under specific conditions, they can be induced to differentiate into various tissues such as fat, bone and cartilage. Stem cell adipogenic differentiation culture is usually carried out in vitro. Due to the complexity of stem cell differentiation, the culture medium required for in vitro directional differentiation culture is much more expensive than traditional ordinary cell culture medium.

[0003] In the induction culture of mesenchymal stem cells for chondrogenic differentiation, the culture cycle is relatively long, and the staining identification results are qualitative analysis, which is easily affected by different operators and different batches of dyes, resulting in huge differences in the conclusions. This undoubtedly greatly increases the cost of induction culture of mesenchymal stem cells. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a detection reagent for the chondrogenic differentiation potential of mesenchymal stem cells, taking type II collagen gene (Collagen II) as the detection object, and using qPCR to complete the detection of the chondrogenic differentiation potential of mesenchymal stem cells at 7 to 14 days of induction culture, and the detection result is accurate and fast.

[0005] The present invention provides a detection reagent for the cartilage differentiation potential of mesenchymal stem cells, including type II collagen gene qPCR detection primers;

[0006] The type II collagen gene qPCR detection primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO: 1 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 2.

[0007] The invention provides a kit for detecting the chondrogenic differentiation potential of mesenchymal stem cells, comprising the detection reagent, internal reference gene primers and qPCR detection premix.

[0008] Preferably, the qPCR detection premix includes 2×TsingKe*Master qPCR Mix-SYBR (+UDG).

[0009] The present invention provides a method for detecting the chondrogenic differentiation potential of mesenchymal stem cells, comprising the following steps:

[0010] Mesenchymal stem cells were inoculated into chondrogenic differentiation medium for adipogenic differentiation. On the 7th to 14th day of culture, differentiated cells were collected, total RNA was extracted, and reverse transcription was performed to obtain cDNA, which was recorded as differentiation group cDNA.

[0011] Total RNA was directly extracted from the same batch of mesenchymal stem cells as the differentiation group, and reverse transcribed to obtain cDNA, which was recorded as the control group cDNA;

[0012] The cDNA of the differentiation group and the cDNA of the control group were used as templates, and the type II collagen gene primers in the detection preparation were used for qPCR detection. The chondrogenic differentiation potential of mesenchymal stem cells was determined based on the calculated relative expression of the type II collagen gene:

[0013] When the relative expression amount of type II collagen gene is ≥2, the mesenchymal stem cells have chondrogenic potential, and the relative expression amount is proportional to the chondrogenic potential;

[0014] When the relative expression level of type II collagen gene is less than 2, the chondrogenic differentiation potential of the mesenchymal stem cells is low.

[0015] Preferably, the calculation formula for the relative expression amount of the type II collagen gene is shown in Formula 1:

[0016] 分化 mRNA relative expression = 2 -{(分化组CollagenIICT均值-分化组内参基因CT均值)-(对照组CollagenIICT均值-对照组内参基因CT均值)} Formula I;

[0017] Preferably, in the differentiation group, the mesenchymal stem cells are cultured to a cell confluence of 60% to 70% before undergoing chondrogenic differentiation culture;

[0018] During the chondrogenic differentiation culture, the inoculation amount of the mesenchymal stem cells was 1.0×10 5 ~10×10 5 cells / well.

[0019] Preferably, the chondrogenic differentiation medium is a chondrogenic differentiation basal medium containing 9.5% to 10.5% by weight of chondrogenic differentiation factor additives.

[0020] Preferably, during the chondrogenic differentiation culture, the chondrogenic differentiation medium is replaced every 3 to 4 days.

[0021] Preferably, the reaction system of the qPCR detection is 10 μL, specifically including the following reagents: 2×TsingKe*MasterqPCRMix-SYBR (+UDG) 5.0 μL, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL and cDNA 4.0 μL;

[0022] The reaction procedure of the qPCR detection is 50°C×2min; 95°C×2min; 95°C×15sec, 55°C×30sec, 72°C×30sec, and cycled 45 times; the temperature of the single-point fluorescence detection is 72°C.

[0023] Preferably, the mesenchymal stem cells include umbilical cord-derived mesenchymal stem cells and / or amnion-derived mesenchymal stem cells.

[0024] The present invention provides a detection reagent for the chondrogenic differentiation potential of mesenchymal stem cells, including type II collagen gene qPCR detection primers, and the nucleotide sequences are shown in SEQ ID NO: 1 to SEQ ID NO: 2. The detection reagent developed by the present invention is based on the differential expression of the relative expression of type II collagen gene in mesenchymal stem cells and chondrogenic differentiation cells to achieve the detection purpose. The detection reagent developed based on qPCR detection technology can achieve the purpose of rapid, accurate and quantitative detection of chondrogenic potential, which solves the influence of non-objective factors that require empirical judgment in the prior art, and can be detected at 7 to 14 days of induction culture, which greatly shortens the culture time and reduces the culture cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The results of detecting MSCs using the traditional Alcian blue staining method 1;

[0026] Figure 2 The results of detecting MSCs using the traditional Alisin blue staining method 2. DETAILED DESCRIPTION

[0027] The present invention provides a detection reagent for the chondrogenic differentiation potential of mesenchymal stem cells, comprising type II collagen gene qPCR detection primers; the type II collagen gene qPCR detection primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO:1 (GCTCCCAGAACATCACCTACC) and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:2 (TGAACCTGCTATTGCCCTCT).

[0028] The present invention has no special restrictions on the preparation method of the detection reagent, and it can be obtained by primer synthesis known in the art. In the embodiment of the present invention, the source of the primer in the detection reagent is preferably commissioned to Beijing Qingke Biotechnology Co., Ltd. for synthesis.

[0029] The invention provides a detection kit for the chondrogenic differentiation potential of mesenchymal stem cells, comprising the detection kit, internal reference gene primers and qPCR detection premix.

[0030] The present invention does not impose any special restrictions on the type of qPCR detection premix, and qPCR detection reagents well known in the art can be used. In an embodiment of the present invention, the qPCR detection premix preferably includes 2×TsingKe*Master qPCRMix-SYBR(+UDG), which is preferably purchased from Beijing Qingke Biotechnology Co., Ltd. The internal reference gene primer includes a β-actin primer. The β-actin primer includes a forward primer having a nucleotide sequence as shown in SEQ ID NO:3 (GTCACCTTCACCGTTCCAGTTTT) and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:4 (CTTAGTTGCGTTACACCCTTTCTT). The source of the internal reference gene primer is preferably commissioned to be synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0031] The present invention provides a method for detecting the chondrogenic differentiation potential of mesenchymal stem cells, comprising the following steps:

[0032] Mesenchymal stem cells were inoculated into chondrogenic differentiation medium for adipogenic differentiation. On the 7th to 14th day of culture, differentiated cells were collected, total RNA was extracted, and reverse transcription was performed to obtain cDNA, which was recorded as differentiation group cDNA.

[0033] Total RNA was directly extracted from the same batch of mesenchymal stem cells as the differentiation group, and reverse transcribed to obtain cDNA, which was recorded as the control group cDNA;

[0034] The cDNA of the differentiation group and the cDNA of the control group were used as templates, and the type II collagen gene primers in the detection preparation were used for qPCR detection. The chondrogenic differentiation potential of mesenchymal stem cells was determined based on the calculated relative expression of the type II collagen gene:

[0035] When the relative expression amount of type II collagen gene is ≥2, the mesenchymal stem cells have chondrogenic potential, and the relative expression amount is proportional to the chondrogenic potential;

[0036] When the relative expression level of type II collagen gene is less than 2, the chondrogenic differentiation potential of the mesenchymal stem cells is low.

[0037] The present invention performs chondrogenic differentiation culture on mesenchymal stem cells in a chondrogenic differentiation medium, collects differentiated cells on the 7th to 14th day, extracts total RNA, performs reverse transcription, obtains cDNA, and records it as differentiation group cDNA.

[0038] In the present invention, the mesenchymal stem cells preferably include umbilical cord-derived mesenchymal stem cells and / or amniotic membrane-derived mesenchymal stem cells. The mesenchymal stem cells are preferably cultured to a cell confluence of 60% to 70% for chondrogenic differentiation, and the cell confluence is preferably 65%. During the culture, the inoculation amount of the mesenchymal stem cells is preferably 1.0×10 5 ~10×10 5 cells / well. During the culture, the culture medium used is preferably a complete culture medium. During the culture, it is preferred to add an appropriate amount of D-PBS washing solution to the wells surrounding the identification wells where the mesenchymal stem cells are added to prevent the evaporation of the culture medium in the identification wells during the culture process. The culture temperature is preferably 36 to 37°C, more preferably 37°C. The culture conditions are preferably 5% CO2. During the chondrogenic differentiation culture, the chondrogenic differentiation culture medium is replaced every 3 to 4 days.

[0039] In the present invention, the chondrogenic differentiation medium is preferably a chondrogenic differentiation basal medium containing 9.5% to 10.5% by weight of a chondrogenic differentiation factor additive. The mass percentage of the chondrogenic differentiation factor is preferably 10%. The chondrogenic differentiation factor additive is purchased from Gibco, with the item number A1006401. The chondrogenic differentiation basal medium is purchased from Gibco, with the item number A1006901. The present invention does not impose any particular restrictions on the method for collecting differentiated cells, and a collection method well known in the art, such as centrifugation, can be used. Mesenchymal stem cells are cultured for chondrogenic differentiation to obtain differentiated cells, which are recorded as a differentiation group.

[0040] In the present invention, in order to accurately evaluate the relative expression of the mRNA of type II collagen gene in differentiated cells after chondrogenic differentiation culture relative to that in mesenchymal stem cells, a mesenchymal stem cell group that has not been cultured for chondrogenic differentiation is also set up, which is recorded as a control group. The control group is a group in which the same batch and number of mesenchymal stem cells as the differentiation group are inoculated into the detection wells of complete culture medium and cultured under the same culture conditions as the differentiation group.

[0041] The present invention has no particular limitation on the method for extracting total RNA from the differentiated cells or mesenchymal stem cells, and any extraction method known in the art can be used, such as a commercial RNA extraction kit. The reverse transcription method is preferably performed using a reverse transcription kit.

[0042] After obtaining the cDNA of the differentiation group and the cDNA of the control group, the present invention uses the two groups of cDNA as templates, respectively, and uses the detection reagents described in the above technical scheme to perform qPCR detection, and judges the chondrogenic differentiation potential of mesenchymal stem cells based on the calculated relative expression of type II collagen gene:

[0043] When the relative expression amount of type II collagen gene is ≥2, the mesenchymal stem cells have chondrogenic potential, and the relative expression amount is proportional to the chondrogenic potential;

[0044] When the relative expression level of type II collagen gene is less than 2, the chondrogenic differentiation potential of the mesenchymal stem cells is low.

[0045] In the present invention, the reaction system of the qPCR detection is preferably 10 μL, specifically including the following reagents: 2×TsingKe*Master qPCRMix-SYBR(+UDG) 5.0 μL, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL and cDNA 4.0 μL. The reaction procedure of the qPCR detection is preferably 50°C×2min; 95°C×2min; 95°C×15sec, 55°C×30sec, 72°C×30sec, 45 cycles; the temperature of the single-point fluorescence detection is 72°C. The calculation method of the relative expression of the type II collagen gene adopts the classic 2 -(△(△CT)) Calculation, see formula I for details.

[0046] mRNA relative expression = 2 -{(分化组CollagenIICT均值-分化组内参基因CT均值)-(对照组CollagenIICT均值-对照组内参基因CT均值)} Formula I;

[0047] In the present invention, the detection method also preferably includes using a traditional Alcian blue staining method for detection verification. Experiments show that for the detection of the same batch of mesenchymal stem cells, the results of Alcian blue staining show that they have chondrogenic differentiation ability. At the same time, the detection method developed by the present invention also obtains that the mesenchymal stem cells have good chondrogenic differentiation ability, and the greater the relative expression amount result, the higher the chondrogenic differentiation potential.

[0048] The following is a detailed description of a method and reagent for detecting the chondrogenic differentiation potential of mesenchymal stem cells provided by the present invention in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0049] Example 1

[0050] A kit for detecting the cartilage differentiation potential of mesenchymal stem cells, comprising the following components:

[0051] 1. Detection Primers

[0052] Type II collagen gene (GenBank: X16468.1) was used as the target gene, and primer design software was used to design qPCR detection primers. The designed primer sequences are as follows:

[0053] Type II collagen primer: F: 5′-GCTCCCAGAACATCACCTACC-3′ (SEQ ID NO: 1);

[0054] R:5'-TGAACCTGCTATTGCCCTCT-3'(SEQ ID NO:2);

[0055] Internal reference β-actin primer: F: 5′-GTCACCTTCACCGTTCCAGTTTT-3′ (SEQ ID NO: 3);

[0056] R: 5'-CTTAGTTGCGTTACACCCTTTCTT-3' (SEQ ID NO: 4).

[0057] The above detection primers were commissioned to be synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0058] 2.qPCR detection reagents

[0059] 2×TsingKe*Master qPCR Mix-SYBR(+UDG).

[0060] Example 2

[0061] A method for detecting the chondrogenic differentiation potential of mesenchymal stem cells

[0062] 1. Pre-culture of Mesenchymal Stem Cells

[0063] Prepare a 15 ml centrifuge tube, mark it, and take 3.0 × 10 5 10 mesenchymal stem cells were placed in a centrifuge tube, and complete culture medium was pipetted to 6 ml, and mixed by blowing 10 times; after counting, 2 ml cell suspension of mesenchymal stem cells was pipetted respectively with a pipette, and 1.0×10 5 Inoculate a certain number of cells into each identification well (including experimental wells and control wells); use a pipette to draw an appropriate amount of D-PBS washing solution into the wells around the identification wells to prevent the evaporation of the culture medium in the identification wells; shake the cells well and transfer them to a 37°C, 5% CO2 incubator.

[0064] 2. Chondrogenic Differentiation of Mesenchymal Stem Cells

[0065] Prepare the chondrogenic differentiation medium in advance with 90% chondrogenic differentiation basal medium + 10% chondrogenic differentiation factor supplement (purchased from Gibco), mix thoroughly, and store at 4° C. Add the chondrogenic differentiation medium to the experimental wells and add the complete medium to the control wells.

[0066] When the confluence of the above-cultured mesenchymal cells reaches 60% to 70%, start chondrogenic differentiation induction culture. Use a pipette to aspirate the supernatant in each experimental well into a waste bottle; use a pipette to aspirate 2 ml of culture medium respectively, and carefully transfer it to each experimental well and control well; transfer the cells to a 37°C, 5% CO2 incubator. Replace the fresh complete culture medium and differentiation medium every 3 days. Collect the cell pellets on Day 7 and Day 14 of chondrogenic differentiation.

[0067] 3. Total RNA Extraction from Differentiated Cells

[0068] Add 350μl lysis buffer RLA and 10μl proteinase K to the differentiated cells, vortex and centrifuge at 12,000rpm for 4min, and take the supernatant. Add the obtained supernatant to the genomic DNA removal column, centrifuge at 12,000rpm for 30sec, and retain the filtrate. Slowly add 70% ethanol of 1 times the volume of the supernatant to the above filtrate, mix and transfer to the RNase-Free adsorption column CR4 (the adsorption column is placed in the collection tube), centrifuge at 12,000rpm for 30sec, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube. Add 700μl deproteinization solution RW3 to the RNase-Free adsorption column CR4, centrifuge at 12,000rpm for 30sec, and discard the waste liquid. Add 500μl rinsing solution RW with ethanol to the RNase-Free adsorption column CR4, let stand at room temperature for 2min, centrifuge at 12,000rpm for 50sec, and discard the waste liquid. Add 500μl of rinsing solution RW with ethanol to the RNase-Free adsorption column CR4, let stand at room temperature for 2min, centrifuge at 12,000rpm for 50sec, and discard the waste liquid. Centrifuge at 12,000rpm (~13,400×g) for 2min, and discard the waste liquid. Leave the RNase-Free adsorption column CR4 at room temperature for 2min. Transfer the RNase-Free adsorption column CR4 to a new RNase-Free centrifuge tube, add 180μl RNase-Free ddH2O to the middle part of the adsorption membrane, let stand at room temperature for 2min, centrifuge at 12,000rpm for 2min, and obtain RNA solution. Use a micro-spectrophotometer to determine the RNA concentration of the sample to be tested, and take 1μg RNA for subsequent detection. The total RNA of the mesenchymal stem cells in the control group was extracted in the same way.

[0069] 4. Reverse Transcription Reaction

[0070] According to the number of reaction tubes, 1 μL of gDNA remover, 1 μL of 10×gDNAremover Buffer, RNase-free water (replenished to 10 μL) and 1 μg RNA in the reverse transcription kit were gently mixed for a few seconds, and then centrifuged for use; incubated at 42°C for 2 min, then incubated at 60°C for 5 min, the mixture was quickly cooled on ice, and after a short centrifugation, 1 μL of dNTP Mix, Goldenstar TM Randomer 1 μL, 5× Goldenstar TM Buffer 4μL, DTT 1μL, Goldenstar TM RT61μL, RNase-free water 2μL, mix gently for a few seconds, centrifuge instantly, and perform reverse transcription reaction according to the preset program. Dilute the reverse transcription product 4 times, and process type II collagen gene and β-actin genome respectively. According to the number of reaction tubes, take 2×TsingKe*MasterqPCR Mix-SYBR(+UDG)5μL, 10μM forward primer 0.5μL, 10μM reverse primer 0.5μL, and template 4.0μL, mix gently for a few seconds, remove bubbles and cover the tube, centrifuge instantly, and follow the program 50℃×2min; 95℃×2min; then 95℃×15sec→55℃×30sec→72℃×30sec, cycle 45 times; perform PCR amplification reaction, and single-point fluorescence detection at 72℃.

[0071] The CT values ​​of the internal reference β-actin gene and type II collagen group were substituted into formula I to obtain the relative mRNA expression level of type II collagen.

[0072] 分化 mRNA relative expression = 2 -{(分化组CollagenIICT均值-分化组内参基因CT均值)-(对照组CollagenIICT均值-对照组内参基因CT均值)} Formula I.

[0073] Example 3

[0074] Detection of chondrogenic differentiation ability of amniotic membrane-derived mesenchymal stem cells

[0075] The amniotic membrane-derived mesenchymal stem cells with batch number DA0 produced by the applicant were induced to differentiate according to the method of Example 2 for 7 and 14 days, and then the cell pellets were collected. The relative expression level of type II collagen mRNA was determined using β-actin as an internal reference.

[0076] The test results are shown in Table 1. The relative mRNA expression of type II collagen gene was 463 and 496 on the 7th and 14th days, both higher than 2. The results showed that the amniotic membrane-derived mesenchymal stem cells with batch number DA0 had good chondrogenic differentiation ability.

[0077] Table 1 Detection results of relative expression of type II collagen gene

[0078]

[0079] Example 4

[0080] Mesenchymal stem cells with batch numbers DA1 (amniotic membrane MSC), DB1-DB3 (umbilical cord MSC) and DD1 (chorionic membrane MSC) produced by the applicant were induced to differentiate according to the method of Example 2. After 7 and 14 days, the cell pellets were collected and the relative mRNA expression of type II collagen gene was determined using β-actin as an internal reference.

[0081] The results are shown in Table 2.

[0082] Table 2 Relative expression detection results of type II collagen gene

[0083]

[0084] From the data in Table 2 above, it can be seen that the chondrogenic differentiation potential of MSCs from different sources (amnion, umbilical cord and chorion) is significantly different. Taking the data on the seventh day as an example, the chondrogenic differentiation potential of umbilical cord MSCs (DB1 batch) is stronger, followed by amnion MSCs (DA1 batch), and chorion MSCs (DD1 batch) are the worst. In addition, MSCs from the same source but different batches, such as three different batches of umbilical cord MSCs (DB1, DB2 and DB3), also have different chondrogenic differentiation abilities.

[0085] Comparative Example 1

[0086] The amniotic mesenchymal stem cells with production batch number DA0 were cultured using the culture method of Example 2, and the cells were stained and identified after 14 days of induction and culture. The specific experimental operation is as follows: use a pipette to aspirate the fixing solution in the identification well to a waste liquid bottle; then use a pipette to aspirate 0.5 ml of ultrapure water to the identification well, wash once; use a pipette to aspirate 0.5 ml of Alcian blue acidification solution to the identification well, soak for 5 min; use a pipette to aspirate 0.5 ml of Alcian blue dye solution to the identification well, dye for 30 min; use a pipette to aspirate the dye solution in the identification well to a waste liquid bottle; then use a pipette to aspirate 0.5 ml of ultrapure water to the identification well, wash twice; use a pipette to aspirate 0.5 ml of ultrapure water to the identification well, observe under a microscope and take pictures.

[0087] The photographic results of different regions of amniotic mesenchymal stem cells are shown in Figure 1 and Figure 2 The results show that the amniotic mesenchymal stem cells with production batch number DA0 have the ability to form cartilage, which indirectly reflects that the detection method provided by the present invention is authentic and reliable.

[0088] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A reagent for detecting the chondrogenic differentiation potential of mesenchymal stem cells, characterized in that: Includes type II collagen gene qPCR detection primers; The type II collagen gene qPCR detection primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO: 1 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:

2.

2. A kit for detecting the chondrogenic differentiation potential of mesenchymal stem cells, characterized in that: It comprises the detection reagent according to claim 1, internal reference gene primers and qPCR detection premix.

3. The detection kit for the chondrogenic differentiation potential of mesenchymal stem cells according to claim 2, characterized in that: The qPCR detection premix includes 2×TsingKe*MasterqPCRMix-SYBR(+UDG).

4. A method for detecting the chondrogenic differentiation potential of mesenchymal stem cells, characterized in that: The following steps are involved: Mesenchymal stem cells were inoculated into chondrogenic differentiation medium for adipogenic differentiation. On the 7th to 14th day of culture, differentiated cells were collected, total RNA was extracted, and reverse transcription was performed to obtain cDNA, which was recorded as differentiation group cDNA. Total RNA was directly extracted from the same batch of mesenchymal stem cells as the differentiation group, and reverse transcribed to obtain cDNA, which was recorded as the control group cDNA; The cDNA of the differentiation group and the cDNA of the control group are used as templates respectively, and the type II collagen gene primers in the detection preparation of claim 1 are used for qPCR detection, and the chondrogenic differentiation potential of mesenchymal stem cells is judged according to the calculated relative expression of the type II collagen gene: When the relative expression amount of type II collagen gene is ≥2, the mesenchymal stem cells have chondrogenic potential, and the relative expression amount is proportional to the chondrogenic potential; When the relative expression level of type II collagen gene is less than 2, the chondrogenic differentiation potential of the mesenchymal stem cells is low.

5. The detection method according to claim 4, characterized in that: The calculation formula of the relative expression amount of the type II collagen gene is shown in Formula 1:

6. The detection method according to claim 4, characterized in that: In the differentiation group, the mesenchymal stem cells are cultured to a cell confluence of 60% to 70% and then subjected to chondrogenic differentiation culture; During the chondrogenic differentiation culture, the inoculation amount of the mesenchymal stem cells was 1.0×10 5 ~10×10 5 cells / well.

7. The detection method according to claim 4, characterized in that: The chondrogenic differentiation culture medium is a chondrogenic differentiation basic culture medium containing 9.5% to 10.5% by mass of chondrogenic differentiation factor additives.

8. The detection method according to claim 7, characterized in that: During the chondrogenic differentiation culture, the chondrogenic differentiation medium is replaced every 3 to 4 days.

9. The detection method according to claim 4, characterized in that: The reaction system of the qPCR detection is 10 μL, specifically including the following reagents: 2×TsingKe*Master qPCR Mix-SYBR (+UDG) 5.0 μL, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL and cDNA 4.0 μL; The reaction procedure of the qPCR detection is 50°C×2min; 95°C×2min; 95°C×15sec, 55°C×30sec, 72°C×30sec, and cycled 45 times; the temperature of the single-point fluorescence detection is 72°C.

10. The detection method according to any one of claims 4 to 9, characterized in that: The mesenchymal stem cells include umbilical cord-derived mesenchymal stem cells and / or amnion-derived mesenchymal stem cells.

Images