Development and application of linked molecular marker of corn kernel dehydration major QTL (Quantitative Trait Loci)

Abstract

The invention discloses development and application of a linked molecular marker of a corn kernel dehydration major QTL (Quantitative Trait Loci). The invention belongs to the field of plant molecular genetic breeding, and relates to development and application of a linked molecular marker of a corn kernel dehydration major QTL (Quantitative Trait Loci). The method comprises the steps that the polymorphism or genotype (allele) of an SNP site in a corn genome to be detected is detected, the water content and the dehydration rate of corn kernels are identified or identified in an auxiliary mode according to the genotype of the SNP site, the SNP site is a site on a corn chromosome 3 and is the 21st nucleotide of a sequence 4 in a sequence table, and the nucleotide type is A or G. The method can be used for predicting the water content and / or the dehydration rate of the corn kernels for corn breeding. The substance for detecting the polymorphism and the genotype of the SNP site can be combined with other substances for detecting the genotype of the molecular marker related to the water content and the dehydration rate of the corn kernels to prepare a product for identifying the low water content and the high dehydration rate of the corn kernels.

Description

Technical Field

[0001] The invention belongs to the field of plant molecular genetic breeding, and relates to the development of linked molecular markers of a major effect QTL of corn kernel dehydration and its application. Background Art

[0002] Corn is one of the most important food crops in the world, and full mechanization has gradually become the most common production method. However, most corn varieties in China have not yet reached the standard for mechanized harvesting, which seriously hinders the development of full mechanization. The most important limiting factor is the high moisture content of the kernels during harvesting. When the kernel moisture content is too high, mechanized harvesting will cause excessively high breakage and impurity rates, increase harvesting costs, reduce economic benefits and affect seed quality. According to previous studies, 15%-25% kernel moisture content is the optimal level for mechanized harvesting. However, the kernel moisture content of corn grown in the Huanghuaihai region of China is between 21.5% and 33.1%, and the average kernel moisture content of summer corn is 27.8%. Therefore, genetic improvement of corn kernel moisture content and the exploration and application of new corn germplasm with fast kernel dehydration rate and low kernel moisture content are of great significance to the realization of full mechanization of corn.

[0003] At present, only two genes related to maize kernel dehydration have been reported, including GRMZM5G805627 (ZmGAR2) and GRMZM2G366532 (ZmHSP5). Kernel dehydration is a complex quantitative trait, and the two cloned genes are far from sufficient to explain all the genetic variation of this trait. In addition, the two reported genes have not yet been applied to production practice. Therefore, in the future, it is necessary to locate more QTLs related to kernel dehydration, further clone genes through map-based cloning and other methods, and develop corresponding molecular markers for application in production practice.

[0004] KASP (Kompetitive Allele Specific PCR) can accurately identify SNPs or InDels that are widely present in genomic DNA. It is a high-throughput, economical and effective SNP typing technology. The development of KASP markers related to grain dehydration will help accelerate the field breeding of new corn varieties with fast dehydration rates.

[0005] At present, most corn varieties in China have not yet reached the standard for mechanized harvesting of grains. There are relatively few genetic studies related to grain dehydration. The genes that have been discovered are not sufficient to explain all genetic variations, and the corresponding molecular markers have not yet been developed and successfully applied in production. Therefore, more genes and molecular markers related to grain dehydration need to be introduced in production to breed new corn varieties suitable for mechanized harvesting, in order to accelerate the process of mechanized harvesting of corn. Summary of the invention

[0006] The problem to be solved by the present invention is how to identify the moisture content and / or dehydration rate of corn kernels in a high-throughput manner or to assist in the identification.

[0007] In order to solve the above technical problems, the present invention first provides the use of a substance for detecting the polymorphism or genotype of KASP in the corn genome in any of the following:

[0008] (1) Identify or assist in identifying the moisture content and / or dehydration rate of corn kernels;

[0009] (2) Corn breeding;

[0010] (3) preparing products for identifying or assisting in identifying the moisture content and / or dehydration rate of corn kernels;

[0011] (4) preparing corn breeding products;

[0012] The SNP site is a site on chromosome 3 of maize, the nucleotide type of which is A or G, and is the 21st nucleotide of sequence 4 in the sequence list.

[0013] The genome sequence of corn variety B73 (RefGen_v3) is used as the reference genome, and the SNP site is at 204,549,490 bp on chromosome 3 of corn (specifically, the 21st nucleotide of sequence 4 in the sequence list).

[0014] The present invention also provides a method for identifying or assisting in identifying the moisture content and / or dehydration rate of corn kernels, comprising detecting the genotype of the SNP site in the genome of the corn to be tested, and identifying or assisting in identifying the moisture content and / or dehydration rate of the corn kernels according to the genotype, wherein the genotype of the SNP site is AA or AG or GG, wherein the AA is the homozygous type of the SNP site being A, and the GG is the homozygous type of the SNP site being G; and the AG is the heterozygous type of the SNP site being A and G, and the kernel moisture content of the corn to be tested whose genotype is GG at the SNP site is lower and / or the dehydration rate is faster than that of the corn to be tested whose genotype at the SNP site is AA or / and AG.

[0015] As an embodiment, the method for identifying or assisting in identifying the moisture content and dehydration rate of corn kernels may include the following steps:

[0016] (1) Using the genomic DNA of the corn to be tested as a template, a primer combination is used to perform KASP amplification; the primer combination consists of primer A, primer B and primer C;

[0017] The primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 42nd position of sequence 1 in the sequence list;

[0018] The primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-42 in sequence 2 in the sequence list;

[0019] The primer C is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence list;

[0020] (2) After completing step (1), performing fluorescence detection to determine the genotype of the SNP of the corn to be tested;

[0021] (3) Identifying the kernel moisture content and / or dehydration rate of the tested corn according to the genotype results: the kernel moisture content and / or dehydration rate of the tested corn whose genotype at the SNP site is GG is lower than that of the tested corn whose genotype at the SNP site is AA.

[0022] The application of the above method in corn breeding also falls within the protection scope of the present invention.

[0023] The invention also provides a corn breeding method.

[0024] The corn breeding method provided by the present invention comprises detecting the genotype of the SNP site in the corn genome, selecting corn with the genotype GG of the SNP site as a parent for breeding, and the genotype GG is the homozygous type of the SNP site being G.

[0025] In the present invention, the purpose of corn breeding is to select and cultivate corn with fast grain dehydration.

[0026] As an implementation method, the method for corn breeding may include the following steps:

[0027] (1) Using the genomic DNA of the corn to be tested as a template, the above primer set was used to amplify KASP;

[0028] (2) After completing step (1), performing fluorescence detection to determine the genotype of the SNP site of the corn to be tested;

[0029] (3) Select corn germplasm with GG genotype for breeding of corn with advantages in grain moisture content and / or dehydration rate.

[0030] In the above method, the primer dissolution and preparation method can be: first dilute the three primers to 100mM with ddH2O respectively, and then prepare the primer working solution as follows: primer A 12μL, primer B 12μL, primer C 30μL, ddH2O 46μL, as the KASP-labeled primer working solution, and store it at -20°C for future use.

[0031] In the above method, the PCR reaction system can be: 2×KASP Mastermix with a volume of 2 μL, primer mix with a volume of 0.056 μL, genomic DNA concentration of about 100 ng / μL with a volume of 1 μL, and ultrapure water to make up to 4 μL.

[0032] In the above method, PCR amplification can be performed on a high-throughput PCR instrument.

[0033] In the above method, the reaction procedure of PCR can be:

[0034] Step 1: pre-denaturation at 94°C for 15 min;

[0035] Step 2: 94°C denaturation for 20 s, annealing for 20 s (the first annealing temperature was 61°C, and the temperature was lowered by 0.6°C each cycle) for a total of 10 cycles; 94°C denaturation for 20 s, 55°C annealing for 1 min for a total of 32 cycles;

[0036] In the above method, the method for determining the genotype of the SNP of the corn to be tested can be: after the PCR reaction is completed, the fluorescence signal is converted into an analyzable value using a fluorescence signal reader and a fluorescence detection system to read the fluorescence data of the reaction product (the data reading temperature is below 40°C). The fluorescence scanning results are genotyped using KlusterCaller software, and the A base type carries FAM fluorescence, which is distributed near the Y axis; the G base type carries HEX fluorescence, which is distributed near the X axis; and samples without detection signals are distributed near the origin.

[0037] The invention also provides a product for detecting the polymorphism or genotype of a SNP site in a corn genome.

[0038] The product for detecting the polymorphism or genotype of the SNP site in the corn genome provided by the present invention contains the above-mentioned substance for detecting the polymorphism or genotype of the SNP site in the corn genome, and the product is any one of:

[0039] C1) Products for detecting single nucleotide polymorphisms or genotypes related to corn kernel moisture content and / or dehydration rate;

[0040] C2) Products that identify or assist in identifying the moisture content and / or dehydration rate of corn kernels;

[0041] C3) Products for corn breeding.

[0042] In the above applications, methods and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein DNA binding reaction, and a chip based on fluorescent molecule DNA binding reaction.

[0043] Optionally, the substance is the following D1), D2) or D3):

[0044] D1) the substance is a primer composition for amplifying a corn genomic DNA fragment including the SNP site;

[0045] D2) the substance is a PCR reagent containing the primer combination described in D1);

[0046] D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0047] Optionally, the amplification may be PCR amplification. The primer composition consists of the primer A, the primer B and the primer C.

[0048] D3) The kit may further include KASP Master Mix.

[0049] In the above-mentioned applications, methods and products, the primer composition may be labeled or not labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be connected to a nucleic acid. Markers include but are not limited to dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or move the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The marker can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence containing the marker is detectable. In some embodiments, the nucleic acid is directly detected (e.g., directly read the sequence) without a marker. For example, the primer composition may be a primer composition composed of a single-stranded DNA having a nucleotide sequence of the 22nd to 42nd positions of sequence 1 in the sequence list, a single-stranded DNA having a nucleotide sequence of the 22nd to 42nd positions of sequence 2 in the sequence list, and a single-stranded DNA having a nucleotide sequence of sequence 3 in the sequence list. The primer composition may also be a primer set composed of a single-stranded DNA shown in sequence 1 in the sequence list, a single-stranded DNA shown in sequence 2 in the sequence list, and a single-stranded DNA shown in sequence 3 in the sequence list. Sequence 1 in the sequence list consists of 42 nucleotides, nucleotides at positions 1 to 21 are FAM sequences (as markers), and nucleotides at positions 22 to 42 are specific sequences; sequence 2 in the sequence list consists of 42 nucleotides, nucleotides at positions 1 to 21 are HEX sequences (as markers), and nucleotides at positions 22 to 42 are specific sequences.

[0050] The present invention also provides a DNA molecule, the nucleotide sequence of which is shown in Sequence 4 of the sequence table.

[0051] The application of the above-mentioned DNA molecules also falls within the scope of protection of the present invention. The application is specifically any of the following:

[0052] (1) Identify or assist in identifying the moisture content and / or dehydration rate of corn kernels;

[0053] (2) Corn breeding;

[0054] (3) preparing products for identifying or assisting in identifying the moisture content and / or dehydration rate of corn kernels;

[0055] (4) Prepare corn breeding products.

[0056] Optionally, in the above application, the DNA molecule is used as a detection target.

[0057] The substances for detecting the polymorphism and genotype of the SNP site can be combined with other substances (such as substances for detecting single nucleotide polymorphism or genotype of other molecular markers related to corn kernel moisture content and / or dehydration rate) to prepare a product for identifying corn varieties with corn kernel moisture content and / or dehydration rate.

[0058] Herein, the breeding objective may include breeding corn with low moisture content in corn kernels and / or fast dehydration rate. The corn may be pure line or inbred line.

[0059] The present invention provides a primer composition, and also provides a method for identifying or assisting in identifying the moisture content and / or dehydration rate of corn kernels using the primer composition. The method established by the present invention can be used to predict the moisture content and / or dehydration rate of corn kernels, can be used for early screening of corn to be screened, can be used for corn molecular marker-assisted breeding, and has important application value in the research of exploring corn germplasm resources with low corn kernel moisture content and fast dehydration rate and breeding corn varieties with low corn kernel moisture content and fast dehydration rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 These are the grain moisture content phenotypes of the fast dehydration parent KA105 and the slow dehydration parent KB020.

[0061] Figure 2 This is the distribution diagram of grain moisture content in the recombinant inbred line population.

[0062] Figure 3 This is the distribution diagram of grain dehydration rate of recombinant inbred line population.

[0063] Figure 4 QTL location map of the major effect QTLqKMC3.

[0064] Figure 5 This is the typing diagram and phenotypic T test results of KASP marker KASP_KMC3 in the recombinant inbred line population (RIL population).

[0065] Figure 6 This is the phenotypic diagram and phenotypic T test results of the KASP marker KASP_KMC3 in the associated population. DETAILED DESCRIPTION

[0066] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0067] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0068] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0069] The maize inbred lines KB020 and KA105 in the following embodiments were bred by the Key Laboratory of Maize Biology and Genetic Breeding, College of Agriculture, Northwest A&F University, and have been recorded in: Zhao Z, He K, Feng Z, et al. Evaluation of Yield-Based Low Nitrogen Tolerance Indices for Screening Maize (Zea mays L.) Inbred Lines [J]. Agronomy, 2019, 9(5): 240. DOI: 10.3390 / agronomy9050240. The public can obtain the biological material from the applicant, and the biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0070] The KA105×KB020 recombinant inbred line population in the following examples was obtained by single seed descent.

[0071] The 152 maize inbred lines in the related population in the following embodiment have been recorded in: Qu J, Xu S, Gou X, Zhang H, Cheng Q, Wang X, Ma C, Xue J. 2022. Time-resolved multiomics analysis of the genetic regulation of maize kernel moisture. The Crop Journal. The public can obtain the biological material from the applicant. The biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0072] The following examples used EXCEL software to process the data, and the experimental results were expressed as mean ± standard deviation. T-test was used to distinguish the differences between independent samples. P < 0.05 (*) indicated a significant difference, P < 0.01 (**) indicated a very significant difference, and P < 0.001 (***) indicated a very significant difference.

[0073] Example 1. Obtaining the SNP marker chip site Affx-159065432 and KASP marker primer set related to corn kernel moisture content and dehydration rate

[0074] 1. Determination of moisture content and dehydration rate of corn kernels

[0075] In May 2021, KA105, KB020 and their recombinant inbred line populations (a total of 208 families) were sown at the Guancun Corn Experimental Base of Northwest Agriculture and Forestry University in Yangling, Shaanxi; each family was planted with 2 rows, 5m long, with two replicates, for a total of 840 rows, for genetic analysis and gene positioning of grain dehydration.

[0076] Field management was carried out normally, all individual plants were self-pollinated and the pollination date was recorded. The grain moisture content was measured by needle puncture method at 35 days, 42 days, 49 days and 56 days after pollination, and the grain dehydration rate was measured by AUDDC method. The formula for calculating the grain dehydration rate is as follows:

[0077]

[0078] Where: i represents the number of measurements, t i Represents the corresponding pollination date

[0079] The results are as follows Figure 1 As shown: the grain moisture content of the fast dehydration inbred line KA105 was significantly lower than that of KB020. Its average grain moisture content was 38.9%, 37.7%, 35.7% and 31.0% (35 days, 42 days, 49 days and 56 days), while the average grain moisture content of KB020 was 42.2%, 41.2%, 36.9% and 34.0% (35 days, 42 days, 49 days and 56 days).

[0080] 2. QTL location related to corn grain moisture content and dehydration rate and discovery of chip locus Affx-159065432

[0081] 1) 208 materials were planted in the culture room, and 200 seedling materials were obtained. Leaves were taken for DNA extraction at the three-leaf to one-new stage, and a total of 200 inbred lines were extracted.

[0082] The results are as follows Figure 2 , Figure 3 As shown: the recombinant inbred line population (RIL population for short) of KA105×KB020 showed a normal distribution in the distribution diagram of grain moisture content and dehydration rate, which was consistent with the separation of quantitative traits, indicating that the trait was controlled by multiple genes.

[0083] 2) Based on the SNP data obtained from the maize 6H60K chip and the phenotypic data measured in the field, the molecular marker genotype data of the RIL population were linked to the QTLIciMapping software to construct a molecular marker genetic linkage map. Based on the map and the phenotypic data of 208 RIL populations under three environments, QTL detection was performed. A major QTL locus was detected on maize chromosome 3, located between the SNP molecular markers Affx-159168009 and Affx-88984967, with a physical distance of about 3.3 Mb. The contribution rate of this QTL was 6.20-11.53%, and the additive effect was -0.28--0.74 ( Figure 4 ), and the rapid dehydration gene originated from the parent KA105, and the QTL was named qKMC3.

[0084] 3. Linkage analysis of KASP marker KASP_KMC3

[0085] The CTAB method was used to extract DNA from the recombinant inbred line population of KA105×KB020 and the two parents for marker identification. First, the SNP markers were mined in the QTL interval in combination with the measured maize 60K SNP marker information, and then the online platform primer3 website (https: / / bioinfo.ut.ee / primer3-0.4.0 / ) was used to design KASP marker primers for the SNP markers. The primers were then mixed with KASP Mix for PCR amplification, and the amplification results were analyzed using KlusterCaller software. The analysis found that the SNP site Affx-159065432 was linked to the QTL site qKMC3, which was named KASP_KMC3 for molecular marker-assisted selection breeding. The SNP site Affx-159065432 is the 21st position of sequence 4, and its nucleotide type is A or G. The r in sequence 4 in the sequence table represents a or g.

[0086] 4. Obtaining the primer set for KASP marker KASP_KMC

[0087] A primer set for detecting KASP marker KASP_KMC3 based on KASP technology was designed, referred to as KASP primer set. The KASP primer set consists of two upstream primers (primer A and primer B) and one downstream primer (primer C). The specific KASP primer set sequence is as follows:

[0088] Primer A: 5'- GAAGGTGACCAAGTTCATGCT AAACATGGTTATTGCGTCCGA-3' (SEQ ID NO: 1)

[0089] Primer B: 5'- GAAGGTCGGAGTCAACGGATT AAACATGGTTATTGCGTCCGG-3' (SEQ ID NO: 2)

[0090] Primer C: 5'-AAATAGTGTTTGGTTTATTGCATTGG-3' (SEQ ID NO: 3)

[0091] PCR product: 5'-AAACATGGTTATTGCGTCCGrCCGCCAATGCAATAAACCAAACACTATTT-3' (SEQ ID NO: 4), wherein r represents a or g.

[0092] Primer A is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the fragment with SNP site Affx-159065432 as A. The fluorescent signal of the FAM group can be read by a fluorescent signal reader;

[0093] Primer B is a primer with a HEX fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the fragment with SNP site Affx-159065432 as G. The fluorescent signal of the HEX group can be read by a fluorescent signal reader.

[0094] The above primers were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0095] The above-mentioned KASP Master Mix was purchased from Beijing Jiacheng Biotechnology Co., Ltd.

[0096] Example 2: Establishment of a method for detecting the genotype of SNP marker Affx-159065432 using KASP markers

[0097] The KASP marker KASP_KMC3 was used to detect different allele types of corn kernel moisture content and dehydration rate at the physical position 204549490 (SNP site Affx-159065432) on corn chromosome 3.

[0098] 1. PCR amplification system and procedure

[0099] The genomic DNA of common corn leaves was extracted by CTAB method and dissolved in 100 μL ddH2O. The DNA was tested for quality by 1% agarose gel electrophoresis. The extracted DNA was required to have no obvious impurities, clear bands, and no degradation. After the DNA concentration was measured, it was uniformly diluted to 100 ng / μL, and PCR amplification was performed using the diluted corn genomic DNA as a template.

[0100] Prepare primer mix: 12 mM each of primer A and primer B (see Example 1 for specific sequence), and 30 mM of primer C (see Example 1 for specific sequence).

[0101] PCR amplification reaction system (4 μL): PCR reagent composition: 2×KASP Mastermix, volume 2 μL, primer mix, volume 0.056 μL, genomic DNA concentration of about 100 ng / μL, volume 1 μL, ultrapure water to 4 μL.

[0102] The PCR reaction program was a touchdown reaction program: pre-denaturation at 94°C for 15 min, denaturation at 94°C for 20 s; annealing at 61°C for 60 s, decreasing 0.6°C per cycle, for 10 cycles; denaturation at 94°C for 20 s, annealing at 55°C for 60 s, for 32 cycles.

[0103] 2. Genotyping

[0104] After the PCR reaction is completed, the terminal fluorescence reading is read in the microplate reader FLUOstar Omega, and then the data is imported into the KlusterCaller software for genotyping. If the typing is not obvious, it is generally necessary to add 3 cycles for typing.

[0105] The excitation wavelength of FAM is 485nm, and the emission wavelength is 520nm. The excitation wavelength of HEX is 535nm, and the emission wavelength is 556nm. The excitation wavelength of the system reference fluorescence ROX is 575nm, and the emission wavelength is 610nm.

[0106] The results are as follows Figure 5 As shown, if only the fluorescence signal of the FAM group (blue fluorescence) is displayed, the Affx-159065432 genotype of the corn to be tested is AA (i.e., the SNP site Affx-159065432 in the corn genome is a homozygous type of A); if only the fluorescence signal of the HEX group is displayed (red fluorescence), the Affx-159065432 genotype of the corn to be tested is GG (i.e., the SNP site Affx-159065432 in the corn genome is a homozygous type of G); if a green fluorescence signal is displayed, the Affx-159065432 genotype of the corn to be tested is AG (i.e., the SNP site Affx-159065432 in the corn genome is a heterozygous type of A and G); if yellow is displayed, it is a material that failed typing.

[0107] Example 3: Application of KASP_KMC3 in assisting identification of corn kernel moisture content and dehydration rate and corn breeding

[0108] In 2018 and 2019, 152 inbred lines of related populations were phenotypically identified at the Guancun corn experimental base of Northwest Agriculture and Forestry University in Yangling District, Xianyang City, Shaanxi Province. A completely randomized block design was used with a row length of 4.5 m, a row spacing of 0.6 cm, and a plant spacing of 20 cm. Field management was carried out normally, all plants were self-pollinated and the pollination date was recorded. The grain moisture content was measured by the oven method at 35 days, 42 days, 49 days, and 56 days after pollination, and the grain dehydration rate was measured by the AUDDC method. Grain moisture content (%) = [(W1-W2) / W1] × 100%.

[0109] Determination method: Select evenly growing ears 35 days, 42 days, 49 days, and 56 days after pollination, thresh immediately after sampling, take 100 intact kernels and measure the fresh weight (W1) with an electronic balance (unit 0.0001g), fix them in a 105℃ oven for 30 minutes, and dry them in an 85℃ oven to constant weight (measure three times in a row, the value remains unchanged), measure the dry weight (W2) and record it. Substitute the weight into the above formula to calculate the moisture content of the kernels.

[0110] At the same time, sampling was carried out at the seedling stage, and total DNA of corn leaves was extracted. The KASP_KMC3 marker genotype detection method was referred to Example 2. The results are shown in Table 1. AA indicates that the genotype of the SNP site Affx-159065432 of the corn material is AA, GG indicates that the genotype of the SNP site Affx-159065432 of the corn material is GG, and AG indicates that the genotype of the SNP site Affx-159065432 of the corn material is AG.

[0111] Table 1. Genotypes of KASP_KMC3 markers and phenotypic information of corn kernel moisture content and dehydration rate in 152 inbred lines of the associated population

[0112]

[0113]

[0114]

[0115]

[0116]

[0117] Note: Bad means typing failed, NA means no phenotypic data was collected

[0118] The molecular marker KASP_KMC3 was used to determine the qKMC3 genotype and obtain the genotype of each individual plant. The results showed that (Table 1 and Figure 6): KASP marker detection showed that among the 152 inbred lines of the associated population, 62 inbred lines were of QTL qKMC3 allele type AA (i.e., the genotype of SNP site Affx-159065432 was AA), with grain moisture content of 40.36±3.82 (42 days after pollination), 35.48±4.51 (49 days after pollination), and grain dehydration rate of 265.10±27.52 (42-49 days after pollination); 68 inbred lines were QTL The qKMC3 allele type was GG (the genotype of SNP site Affx-159065432 was GG), the grain moisture content was 38.58±3.42 (42 days after pollination) and 33.43±4.05 (49 days after pollination), and the grain dehydration rate was 252.30±23.94 (42-49 days after pollination); 8 inbred lines were of QTL qKMC3 allele type AG (the genotype of SNP site Affx-159065432 was AG), the grain moisture content was 39.56±4.07 (42 days after pollination) and 36.10±3.83 (49 days after pollination), and the grain dehydration rate was 264.83±26.37 (42-49 days after pollination).

[0119] In addition, T test was conducted by combining the grain moisture content and dehydration rate phenotypes of each cross line. The results showed that ( Figure 6 ): The grain moisture content of the inbred lines carrying the GG genotype was significantly lower than that of the inbred lines carrying the AA genotype (p value less than 0.01), and the grain dehydration rate was significantly faster than that of the inbred lines carrying the AA genotype (p value less than 0.01) ( Figure 6 There was no significant difference in the grain moisture content and grain dehydration rate between the inbred lines carrying the AG genotype and the inbred lines carrying the AA genotype (p value greater than 0.05) ( Figure 6 ). There was no significant difference in the grain moisture content and grain dehydration rate between the inbred lines carrying the AG genotype and the inbred lines carrying the GG genotype (p value greater than 0.05). The above results show that the use of this molecular marker can eliminate inbred lines with slow dehydration in the field, which not only saves production costs, but also greatly improves the selection efficiency, and then quickly screens out inbred lines with fast grain dehydration for subsequent breeding.

[0120] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application of a substance for detecting polymorphism or genotype of a SNP site in a corn genome in any of the following: (1) Identify or assist in identifying the moisture content and / or dehydration rate of corn kernels; (2) Corn breeding; (3) preparing products for identifying or assisting in identifying the moisture content and / or dehydration rate of corn kernels; (4) preparing corn breeding products; The SNP site is a site on chromosome 3 of maize, the nucleotide type of which is A or G, and is the 21st nucleotide of sequence 4 in the sequence list.

2. A method for identifying or assisting in identifying the moisture content and / or dehydration rate of corn kernels, characterized in that: The method comprises detecting the genotype of a SNP site in the genome of corn to be tested, and identifying or assisting in identifying the moisture content and / or dehydration rate of corn kernels according to the genotype, wherein the SNP site is a site on chromosome 3 of corn, and its nucleotide type is A or G, which is the 21st nucleotide of sequence 4 in the sequence list.

3. The use according to claim 1 or the method according to claim 2, characterized in that: The genotype of the SNP site is AA or AG or GG, wherein AA is the homozygous type of the SNP site being A, and GG is the homozygous type of the SNP site being G; AG is the heterozygous type of the SNP site being A and G, and the grain moisture content of the corn to be tested whose genotype of the SNP site is GG is lower than that of the corn to be tested whose genotype of the SNP site is AA and / or AG, and / or the dehydration rate is faster than that of the corn to be tested whose genotype of the SNP site is AA and / or AG.

4. Application of the method according to claim 2 or 3 in corn breeding.

5. A method for corn breeding, characterized in that: The method comprises detecting the genotype of the SNP site in claim 1 in the corn genome, and selecting corn with a genotype of GG at the SNP site as a parent for breeding, wherein GG is a homozygous type of G at the SNP site.

6. The product is characterized by: The product contains the substance described in claim 1, and the product is any one of: C1) Products for detecting single nucleotide polymorphisms or genotypes related to corn kernel moisture content and / or dehydration rate; C2) Products that identify or assist in identifying the moisture content and / or dehydration rate of corn kernels; C3) Products for corn breeding.

7. The use according to claim 1 or the product according to claim 6, characterized in that: The substance is the following D1), D2) or D3): D1) the substance is a primer composition for amplifying a corn genomic DNA fragment including the SNP site; D2) the substance is a PCR reagent containing the primer combination described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

8. The use or product according to claim 7, characterized in that: The primer composition consists of primer A, primer B and primer C; The primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 42nd position of sequence 1 in the sequence list; The primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-42 in sequence 2 in the sequence list; The nucleotide sequence of primer C is a single-stranded DNA molecule of sequence 3 in the sequence list.

9. A DNA molecule, characterized in that: The nucleotide sequence of the DNA molecule is sequence 4 in the sequence listing.

10. Use of the DNA molecule according to claim 9 in any of the following: (1) Identify or assist in identifying the moisture content and / or dehydration rate of corn kernels; (2) Corn breeding; (3) preparing products for identifying or assisting in identifying the moisture content and / or dehydration rate of corn kernels; (4) Prepare corn breeding products.

Images