Mecdysone receptor gene LvECR and application thereof

Abstract

The invention belongs to the field of gene engineering, and particularly relates to an ecdysone receptor gene LvECR and application thereof. The base sequence of the ecdysone receptor gene LvECR is as shown in SEQ ID NO: 1. The amino acid sequence of the protein encoded by the LvECR gene is as shown in SEQ ID NO: 2. The invention also discloses an application of the ecdysone receptor gene LvECR in inhibition of pathogenic vibrio infection. It is verified for the first time that the prawn ecdysone receptor gene LvECR plays an important role in prawn acute hepatopancreatic necrosis, disease occurrence can be aggravated by inhibiting expression of the coding gene of the prawn ecdysone receptor gene LvECR, disease symptoms can be reduced by injecting in-vitro recombinant protein of the factor, and the huge application potential of the prawn ecdysone receptor gene LvECR in disease prevention and control is shown.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and specifically relates to an ecdysone receptor gene LvECR and an application thereof. Background Art

[0002] Vannamei shrimp is the main shrimp species in my country, but diseases have seriously affected the production of shrimp in my country. Among them, acute hepatopancreatic necrosis disease (AHPND) is caused by pathogenic Vibrio carrying PirAB toxins (VP AHPND ) is a shrimp disease with rapid onset and high mortality. Since it was first reported in 2009, it has become a serious threat to shrimp farming. Currently, the disease is mainly prevented and controlled by comprehensive management measures such as strict control of seed pathogens, improvement of water quality, and introduction of probiotics. There is still a lack of effective disease prevention and control strategies.

[0003] Shrimp infected with AHPND showed symptoms such as empty stomach and jejunum, whitening and atrophy of the hepatopancreas. As the main target organ of AHPND infection, the hepatopancreas of shrimp has strong regeneration and self-replication capabilities, but it is not enough to produce an effective repair response to AHPND infection. Comparative transcriptome analysis showed that in susceptible VP AHPNDIn shrimp, signal transduction and immune system pathways were significantly enriched (Q. Zhang, Y. Yu, Z. Luo, J. Xiang, F. Li, Comparison of gene expression between resistant and susceptible Families against VPAHPND and identification of biomarkers used for resistance evaluation in Litopenaeus vannamei, Front. Genet. 12 (2021), https: / / doi.org / 10.3389 / fgene.2021.772442.). Metabolomic analysis also showed that AHPND infection causes high energy requirements in shrimp, manifested by increased metabolic rate, tricarboxylic acid cycle (TCA cycle) and gluconeoactivity in infected shrimp (TV Nguyen, A. Alfaro, BB Arroyo, JA R Leon, S. Sonnenholzner, Metabolic responses of penaeid shrimp to acute hepatopancreatic necrosis disease caused by Vibrio parahaemolyticus, Aquaculture 533 (2021), https: / / doi.org / 10.1016 / j.aquaculture.2020.736174.).

[0004] The above research results show that the energy metabolism and immune process are seriously disturbed during the infection of hepatopancreatic necrosis in shrimp. However, how to lock the key regulatory factors in shrimp as targets for disease prevention and control and achieve effective disease prevention and control is still an urgent problem to be solved.

[0005] Patent CN202210222837.5 discloses a binding protein of pathogenic Vibrio PirB protein and its application. The patent discloses a binding protein of PirB toxin, LvFABP. As a binding protein of PirB toxin, the protein can achieve its disease prevention and control function by shielding the binding between LvFABP and PirB. The method of silencing LvFABP with dsLvPABP can effectively improve the survival rate of shrimp. After silencing LvFABP, the survival rate of shrimp attacked by pathogenic Vibrio can still reach more than 60% after 168 hours.

[0006] However, up to now, whether it is the use of antibiotics, probiotics, water quality improvement, or the application of LvFABP-PirB combined interference technology, the disease prevention and control effect is still difficult to meet production needs. This technology discloses a transcriptional regulatory factor that plays an important role in the occurrence of acute hepatopancreatic necrosis. Inhibiting the expression of its encoding gene can aggravate the occurrence of the disease. Injecting the in vitro recombinant protein of this factor can reduce the symptoms of the disease, demonstrating its application potential in disease prevention and control. Summary of the invention

[0007] The present invention aims to provide an ecdysone receptor gene LvECR and application thereof in the prevention and control of acute hepatopancreatic necrosis of shrimp.

[0008] To achieve the above purpose, the present invention adopts the following technical solution:

[0009] A ecdysone receptor gene LvECR, the base sequence of the ecdysone receptor gene LvECR is shown in SEQ ID NO:1.

[0010] The amino acid sequence of the protein encoded by the LvECR gene is shown in SEQ ID NO:2.

[0011] An application of the ecdysone receptor gene LvECR, and an application of the ecdysone receptor gene LvECR in inhibiting pathogenic Vibrio infection.

[0012] The invention discloses an application of enhancing the expression of the ecdysone receptor gene LvECR in inhibiting the infection of acute hepatopancreatic necrosis disease of shrimp.

[0013] A preparation for inhibiting pathogenic Vibrio infection, the preparation contains the protein encoded by the ecdysone receptor LvECR gene.

[0014] The preparation is used in preparing a drug for inhibiting infection of acute hepatopancreatic necrosis of shrimp.

[0015] The advantages of the present invention are:

[0016] The present invention verifies for the first time that the shrimp ecdysone receptor gene LvECR plays an important role in acute hepatopancreatic necrosis of shrimp, inhibiting the expression of its encoding gene can aggravate the occurrence of the disease, and injecting the in vitro recombinant protein of this factor can reduce the symptoms of the disease, showing its great application potential in disease prevention and control. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 These are the differentially expressed genes related to bile acid metabolism after shrimp were infected with acute hepatopancreatic necrosis disease, among which the expression of LvECR gene was significantly downregulated.

[0018] Figure 2This is a diagram showing the effect of LvECR gene silencing on the survival rate of shrimp and aggravating the occurrence of acute hepatopancreatic necrosis provided by an embodiment of the present invention.

[0019] Figure 3 This is a diagram showing that silencing LvECR can increase the number of pathogenic Vibrio colonizing in the hepatopancreas of shrimp provided by an embodiment of the present invention.

[0020] Figure 4 LvECR silencing aggravation Vp provided by the embodiment of the present invention AHPND The effect diagram of infection-induced apoptosis of shrimp hepatopancreatic cells; A is a microscopic image of TUNEL staining of shrimp hepatopancreatic cells, B is the apoptotic cell ratio calculated based on the TUNEL staining image, and green fluorescence shows TUNEL staining positivity. DETAILED DESCRIPTION

[0021] The specific implementation modes of the present invention are further described below in conjunction with examples. It should be noted that the specific implementation modes described here are only for illustrating and explaining the present invention, and are not limited to the present invention.

[0022] Example 1

[0023] The shrimp were challenged with pathogenic Vibrio carrying Pir toxins for acute hepatopancreatic necrosis and non-pathogenic Vibrio not carrying Pir toxins. The hepatopancreatic tissue of shrimp was taken 48 hours after the challenge for transcriptome and non-targeted metabolome analysis. The transcriptome analysis steps are as follows: total hepatopancreatic RNA was extracted using TRIzol reagent, rRNA was removed using the Ribo-Zero TM Magnetic Kit (Epicentre) to enrich mRNA, which was fragmented into short fragments using fragmentation buffer and reverse transcribed into cDNA using random primers. The second-strand cDNA was synthesized using RNase H, DNA polymerase I, dNTPs and buffer, and the cDNA fragments were purified using the QiaQuickPCR extraction kit, the ends were repaired, poly(A) was added, and finally connected to the Illumina sequencing adapter. Illumina HiSeq was used. TM The 4000 platform was used for sequencing. Unigenes were annotated using the BLASTx program (http: / / www.ncbi.nlm.nih.gov / BLAST / ). The edgeR package (http: / / www.r-project.org / ) was used to identify differentially expressed genes (DEGs) in the samples. Genes with a fold change of ≥2 and a false discovery rate (FDR) <0.05 in the comparison were considered as significantly differentially expressed genes.

[0024] The steps of metabolome analysis were as follows: hepatopancreas samples (25 mg) were added to 500 μL methanol:acetonitrile:water (2:2:1) plus isotope standards, ground at 35 Hz for 4 min, sonicated on ice for 5 min, placed at -40 °C for 1 h, centrifuged at 13800 × g at 4 °C for 15 min, and an equal volume of supernatant was mixed with quality control (QC) samples for machine inspection. Metabolite analysis was performed using a Vanquish ultra-high performance liquid chromatography (UHPLC) system combined with an Orbitrap Q ExactiveTM HF-X mass spectrometer. The raw data were converted into mzXML format in ProteoWizard software, and peak identification, peak extraction, peak alignment and integration were performed using a self-compiled R package (XCMS core), and matched with the self-built secondary mass spectrometry BiotreeDB (V2.1) database for material annotation, with a cutoff algorithm score of 0.3. Qualitative and quantitative results were obtained after LC-MS analysis and data preprocessing. Orthogonal partial least squares discriminant analysis (OPLS-DA) was used to identify significantly differential metabolites (SDM) between groups based on t-test (p < 0.05) and projected variable importance (VIP) value (> 1). SDM was then mapped to the KEGG database for pathway analysis.

[0025] The results of metabolomics analysis showed that pathogenic Vibrio caused a decrease in amino acid levels and an increase in glycerophospholipids, fatty acids, and bile acid levels in the hepatopancreas of shrimp. Transcriptomics analysis showed that pathogenic Vibrio significantly altered various lipid metabolic pathways, such as fatty acid metabolism, glycerophospholipid metabolism, and taurine and hypotaurine metabolic pathways in the hepatopancreas of shrimp. Among the differentially expressed genes, LvECR, as an important regulator of fatty acid and taurine metabolic pathways, had a significantly decreased expression level during infection with AHPND (see Figure 1 ), comprehensive analysis of transcriptome and metabolome results showed that LvECR, as an important transcriptional regulatory factor, played an important role in the process of shrimp infection with AHPND. The corresponding LvECR gene sequence in the transcriptome sequencing data was searched, and the full length of its cDNA coding sequence was obtained as shown in SEQ ID NO:1, and the protein sequence translated from its cDNA sequence was shown in SEQ ID NO:2.

[0026] SEQ ID NO:1 Ecdysone receptor gene LvECR gene sequence

[0027] ATGACGAAAGTCGTTACCTCGGGTGGCCGAGGTGGCATGTACGTGCT

[0028] GGGCCCTGGCGGCGTCACCCTCACCCTCTCCGCCATGGACGACGAGA

[0029] GCTGCTCCGAGGTGTCCAGCTCCTCGCCGCTCACCACCCCCGGAGCC

[0030] GTGTCCCCCCAGGCCTTCGTCAGCGTGGGCGTGGAGATGAGTCCGCC

[0031] GATGACACTGGCACTCACTGACATCGGGGAGGTTGACCTTAACTTTTG

[0032] GGACCTTGACCTTAACTCCCACAGTCCGCCGCACAGTGCTGTCGCCTC

[0033] CACAACGTCCATGCTGAGCCAACGCAGCGTCGCGGCGCCCTCTGAAT

[0034] CCTCGCTCTCAGGTCGAGAGGATATGTCCTCGCCGTCCTCCTACAACG

[0035] GCTACGGCACCGAGTCCAGCGATTACAAGAAGAAGAAGGGTCCCGTA

[0036] CCTCGCCAGCAGGAGGAGCTCTGCCTCGTGTGCGGGGACAGGGCGTC

[0037] TGGATACCACTACAATGCTCTCACGTGCGAGGGATGCAAAGGCTTCTT

[0038] CCGGCGATCAATCACCAAAAATGCAGTGTACCAGTGTAAATACGGTCA

[0039] CAACTGTGAGATGGACATGTACATGCGCCGGAAGTGTCAGGAATGTC

[0040] GTCTCAAGAAGTGTCTGAACGTGGGCATGCGACCAGAATGTGTGGTA

[0041] CCGGAGTCCCAGTGTCAGGTCAAACGAGAGCAGAAGAAGGCGAGAG

[0042] GGAAGGACAAAAAGGAATACCCTCCCGTCGGCTCGCCCATCGCCGAG

[0043] GAGAAGTTCCCGGCTGTCAGTCCTTGTAATACCATGGGACCAAGTGA

[0044] GCAAAGGACCTCAACCAGTACATATTACAATAAGCTTTATGCTGGATG

[0045] CATAAGCTTGAACTTAAGTCCTGTGCCACAACCCATAAAGCCAAATAT

[0046] GCCTGTGCCACCTATGACCAGTGACCAAGAGGAACTCATAAGTGCTCT

[0047] AGTACATTCCAAGAAGAATTTGAACAGCCATCAGAAGCAGATATCAA

[0048] AAGAATACAGGAAATTGGAATAACTGACGACGACTCTGAAGATCCCA

[0049] AGTTCGAACACATCACTAAGATGACCATCTTGACAGTAGAACTGATCA

[0050] TAGAGTTCTCCAAGCGCCTGACTGGGTTTGGTGACCTTCTCAGGGAG

[0051] GACCAGATTACACTCCTCAAGGCATGTTCATCAGAAGTTATGATGCTT

[0052] CGAGCTGCGCGTCGTTATGACGCAAAGACCAATTCTATCGTGTTTGGA

[0053] AACAGCTACCCTTACACAGAATCTGAGTATGAAACGGCAGGCTTGGG

[0054] ATTCTCAGCTCCAATGCTCTTTCGCTTCTGTCGTAATATGTGTCGAATG

[0055] AAAGTGGATAATGCTGAGTATGCCCTGCTAGCAGCTATGTCCATCTTCT

[0056] CAGCTGACAGACCATTCCTCCGTGAGGCTTACAAGGTGCAAAAGCTT

[0057] CAAGAAATATACCTGAATGCACTGAGTGCGTATGTGGCAAACAAACGT

[0058] GCTATGAACTCATTCTCAATAATGATAGGAAAGTTGTTAAATGTTCTTA

[0059] CAGAACTACGAACCCTAGGGAATCTGAACTCAGAGATGTGCTACCGTA

[0060] TTCAATTAACAGACAAGAGGCTTCCAGACCTCTTGAATGAGATATGGGACGTCACACCTAAATAA。

[0061] SEQ ID NO:2 Amino acid sequence of the ecdysone receptor gene LvECR.

[0062] Example 2

[0063] LvECR silencing can aggravate the severity of AHPND infection in Penaeus vannamei

[0064] The small molecule dsRNA synthesized by LvECR was injected into farmed shrimp to achieve gene silencing of LvECR. The synthesis process of dsLvECR is as follows: According to the conserved domain of the ecdysone receptor gene LvECR gene sequence of SEQ ID NO:1, the conserved domain of the gene was synthesized, and the LvECR plasmid was prepared. A dsLvECR of about 600bp was designed based on the ORF of the above LvECR gene. At the same time, a dsEGFP of about 500bp was designed as a control. Primers (the underline in the primer is T7 promoter) were designed to amplify it, and the specific primer sequences were: T7-EcRcom-f1: TAATACGACTCACTATAGGGAG AGCCATCAGAAGCAGATATC(SEQ IDNO:3),T7-EcRcom-r2: TAATACGACTCACTATAGGGAGA ACGGTAGCACATCTCTGA (SEQ ID NO:4).

[0065] T7-EGFP-F: TAATACGACTCACTATAGGGGCGAGGGCGATGCCACCTAC(SEQ ID NO:5) ,

[0066] T7-EGFP-R: TAATACGACTCACTATAGGGGACCGCTGCCGTCCTCGATGT(SEQ ID NO:6) .

[0067] dsRNA was synthesized in vitro using the Transcriptaid T7 High Yield in vitro transcription kit (Thermo Fisher Scientific, Waltham, MA, USA) by the following steps.

[0068] Acquisition of double-stranded RNA in vitro transcription template: LvECR plasmid was used as a template to amplify the DNA template for dsRNA synthesis. The PCR reaction system is shown in Table 1:

[0069] Table 1 PCR reaction system

[0070]

[0071] The PCR reaction procedure was as follows: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 1 min, 35 cycles, and 72°C extension for 10 min. 15 μL of the obtained PCR product was taken and tested by 1% agarose gel electrophoresis to confirm that there were no impurities, and the remaining product was purified using a DNA fragment purification kit (Tiangen Biochemical Technology, Beijing).

[0072] Using the purified DNA fragment as a template, dsLvECR was transcribed in vitro. The transcription system is shown in Table 2:

[0073] Table 2 Transcription system

[0074]

[0075] The system was mixed thoroughly and reacted in a metal bath at 42° C. for 4 h. DNase I was added to remove the DNA template and ssRNA, and dsLvECR for RNA interference was obtained after phenol / chloroform purification.

[0076] SEQ ID NO:7 dsLvECR sequence is as follows:

[0077] AGCCATCAGAAGCAGATATCAAAAGAATACAGGAAATTGGAATA

[0078] ACTGACGACGACTCTGAAGATCCCAAGTTCGAACACATCACTAAGAT

[0079] GACCATCTTGACAGTAGAACTGATCATAGAGTTCTCCAAGCGCCTGAC

[0080] TGGGTTTGGTGACCTTCTCAGGGAGGACCAGATTACACTCCTCAAGG

[0081] CATGTTCATCAGAAGTTATGATGCTTCGAGCTGCGCGTCGTTATGACGC

[0082] AAAGACCAATTCTATCGTGTTTGGAAACAGCTACCCTTACACAGAATC

[0083] TGAGTATGAAACGGCAGGCTTGGGATTCTCAGCTCCAATGCTCTTTCG

[0084] CTTCTGTCGTAATATGTGTCGAATGAAAGTGGATAATGCTGAGTATGCC

[0085] CTGCTAGCAGCTATGTCCATCTTCTCAGCTGACAGACCATTCCTCCGT

[0086] GAGGCTTACAAGGTGCAAAAGCTTCAAGAAATATACCTGAATGCACT

[0087] GAGTGCGTATGTGGCAAACAAACGTGCTATGAACTCATTCTCAATAAT

[0088] GATAGGAAAGTTGTTAAATGTTCTTACAGAACTACGAACCCTAGGGAA

[0089] TCTGAACTCAGAGATGTGCTACCGT

[0090] SEQ ID NO:8dsEGFP

[0091] GCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGC

[0092] CCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCC

[0093] CGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCC

[0094] CACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCG

[0095] ACACCCTGGTGAACCGCATCGAGCTGAAGGGCCAAGGAGGACGGCAACATCCTGGGCACAAG

[0096] CTGGAGTACAACTACAACAGCCACAAATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAAC

[0097] TTCAAGATCCGCCACAACATCGAGGACCGGCAGCGTC

[0098] Subsequently, the LvECR gene-silenced shrimp was subjected to a pathogenic Vibrio challenge experiment. The experiment was divided into three groups: the experimental group was injected with dsLvECR (0.4 micrograms / gram of shrimp body weight), and the control group was injected with PBS or dsEGFP (0.4 micrograms / gram of shrimp body weight). 600 shrimp were injected in each group, and the injection was carried out three times, with an interval of three days each time. After each injection, three shrimps were randomly selected for sampling, total RNA was extracted and cDNA was synthesized, and qRT-PCR was used to detect the relative expression of LvECR to evaluate the knockdown effect of the gene. 48 hours after the last gene knockdown injection, the number of surviving shrimps in each group was counted, and the surviving shrimps were evenly divided into two parts for different treatments. Specifically, the LvECR interference group was divided into two parts, with 296 shrimps in each part; the EGFP interference group and the PBS group were divided into 300 each. VP was added to part of the shrimp breeding barrels. AHPND The bacterial solution was used for immersion attack (attack concentration 10 7 CFU / ml), and the other part was treated with 2216E liquid culture medium equal to the challenge bacterial solution as a control to eliminate the influence of nonspecific factors. AHPND Preparation of bacterial solution: Pathogenic Vibrio VP AHPND The streak culture was performed on TCBS medium. After culturing at 28°C for 24 hours, a single colony was picked and inoculated into 100 ml 2216E liquid medium and shaken for 20 hours. Then 10 ml of the culture solution was inoculated into 500 ml 2216E liquid medium and shaken for 20 hours. The culture solution was used for the challenge experiment. The specific groups of the challenge experiment are as follows: Challenge treatment: LvECR interference group + VPAHPND Bath challenge, EGFP interference group + VP AHPND Bath challenge, PBS group + VP AHPND Immersion challenge; control treatment: LvECR interference group + 2216E liquid culture medium; EGFP interference group + 2216E liquid culture medium; PBS group + 2216E liquid culture medium.

[0099] After treatment, 100 shrimps from each group were used for survival observation, and the remaining shrimps were used for sample collection. At multiple time points of 0, 12, 24, 48, 72, 96, 120, 144, 168, 192, 216 and 240 hours after treatment, the survival status of the shrimps in each group was observed and recorded to calculate the survival rate (see Figure 2 The experimental results showed that the death of shrimp in the LvECR silencing group was significantly earlier than that in the PBS and dsEGFP control groups. AHPND After 6 hours of infection, shrimps in the LvECR silencing group began to die, while those in the PBS and dsEGFP groups began to die after 12 hours. Although all groups continued to die after infection, the shrimps in the control group did not reach 100% mortality until 240 hours, while all shrimps in the LvECR silencing group had died at 144 hours. The results showed that LvECR silencing not only directly affected the basic survival rate of shrimps, but also accelerated the VP AHPND The death process after infection shows that LvECR plays a key role in shrimp survival and resistance to AHPND infection.

[0100] Example 3

[0101] LvECR silencing increases the number of pathogenic Vibrio colonizing the hepatopancreas of shrimp

[0102] After LvECR gene silencing, VP AHPND The challenge, gene silencing and challenge experiments were the same as above. vp The number of copies of VP AHPND qRT-PCR was used to absolutely quantify the PirA expression in the LvECR gene silencing group (dsLvECR group) and the control group (dsEGFP group and PBS group). vp Gene copy number. vp Gene as VP AHPND Virulence factor markers that reflect VP AHPNDColonization in the hepatopancreas. This experiment was based on the method reported by Han et al. (2015) (JE Han, KFJ Tang, CR Pantoja, BL White, DV Lightner, qPCR assay for detecting and quantifying a virulence plasmid in acute hepatopancreatic necrosis disease (AHPND) due to pathogenic Vibrio parahaemolyticus, Aquaculture 442 (2015) 12-15, https: / / doi.org / 10.1016 / j.aquaculture.), using a standard curve for absolute quantification, and the regression equation was Ct = -3.235lg (N) + 37.555, where Ct is the cycle threshold and N is PirA vp Table 3 lists the primers and probes used in the experiment.

[0103] Table 3 Primers and probes used in the experiments

[0104]

[0105] The specific operation steps are as follows: The hepatopancreas of three shrimps was randomly selected as a sampling unit in each group, and three replicates were collected in each group. The samples were stored at -80°C for subsequent DNA extraction and absolute quantification experiments. During the qPCR test, BlasTaq 2×qPCR MasterMix was used, and 0.1μM of each primer and 0.1μM of TaqMan probe were added to make the final reaction system 10μL. The qPCR program was: 95°C pre-denaturation for 3 minutes; 95°C, 15s, 60°C, 1min; 40 cycles. Each sample was tested three times to ensure the accuracy of the data.

[0106] The results showed that from the beginning of infection, the pirA vp In the early stage of infection (6-12 hours), the copy number of pirAvp was at a low level in both the control group (PBS or dsEGFP group) and the dsLvECR silencing group, indicating that VP AHPND Colonization of the hepatopancreas was weak. However, after 24 h of infection, pirA vp The copy number increases rapidly, indicating VP AHPND Colonization in the hepatopancreas increased significantly. At this time, the pirA vpThe copy number differences began to become significant. Specifically, at 24 h, the pirA vp The copy number is 10 3 , while pirA vp The copy number was significantly higher than that of the control group, reaching 3.6 times that of the control group. vp The copy number was 4.8 times that of the control group; at 72 hours, the copy number of the dsLvECR silencing group increased further, reaching 6 times that of the control group (see Figure 3 These results suggest that silencing of LvECR significantly enhances VP AHPND The colonization ability of LvECR in the hepatopancreas of shrimp shows that it can inhibit VP AHPND Role of species colonization in the hepatopancreas of shrimp.

[0107] Example 4

[0108] LvECR silencing enhances hepatopancreatic cell apoptosis in shrimp infected with AHPND

[0109] TUNEL (TdT-mediated dUTP Nick-End Labeling) staining was used to detect apoptosis of cells infected with AHPND after LvECR silencing in hepatopancreatic tissue. The experiment was divided into two treatment groups: LvECR gene silencing group (dsLvECR) and control group (PBS or dsEGFP). Each group was subjected to VP after gene knockdown injection or control injection. AHPND The shrimp were challenged with the virus, and samples were taken at different time points after infection and before infection to detect apoptosis of hepatopancreatic cells. The specific operation was as follows: the hepatopancreatic tissue of shrimp was fixed, dehydrated, embedded in paraffin, and cut into 4 μm thick sections. After the tissue sections were dewaxed in xylene and hydrated in gradient ethanol, they were stained according to the steps in the TUNEL kit instructions. The specific operation included: first, the samples were rinsed in PBS, and then treated with proteinase K to enhance the accessibility of DNA. Subsequently, the labeling reagent was added to the TdT reaction buffer, and the samples were incubated at 37°C for 1 hour. After the reaction, the sections were washed with PBS, and DAPI (4′,6-diamidino-2-phenylindole) was used to counterstain the nucleus to distinguish between apoptotic and normal cells. TUNEL-positive cells (apoptotic cells) and DAPI-stained nuclei were observed under a fluorescence microscope at a specific wavelength. Multiple fields of view were randomly selected, and the ratio of TUNEL-positive cells in each field of view was calculated to quantify the level of apoptosis of hepatopancreatic cells.

[0110] TUNEL staining results showed that in VP AHPNDAfter infection, apoptosis in the hepatopancreas was aggravated. The TUNEL-positive cell ratio increased significantly in both the control group and the LvECR silencing group, indicating that AHPND infection induced a significant apoptotic response. Moreover, the positive cell ratio in the LvECR silencing group was significantly higher than that in the control group (see Figure 4 ), these results indicate that the loss of LvECR exacerbates the cell damage and apoptosis caused by AHPND infection, and that LvECR in shrimp cells protects against acute hepatopancreatic necrosis disease infection by inhibiting apoptosis.

[0111] Example 5

[0112] Recombinant expression of LvECR in vitro can prevent and treat acute hepatopancreatic necrosis

[0113] Design specific primers to amplify the open reading frame (ORF) of the LvECR gene. The primer sequence is: F1: 5'-GCA GGATCC ATGACGAAAGTCGTTACCTCG-3'(SEQ ID NO:12),R1:5'-ACG GAGCTC TTATTTAGGTGTGACGTCCC-3' (SEQ ID NO: 13). According to the multi-cloning site of the pET-30 (a) vector, a BamH I restriction site was added to the 5' end of the upstream primer F1, and a Xho I restriction site was added to the 5' end of the downstream primer R1.

[0114] The coding region fragment of LvECR shown in SEQ ID NO:1 was amplified, and the cDNA of Penaeus vannamei was used as a template, and the primers designed above were used for amplification. The PCR reaction conditions were: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, 57℃ annealing for 45s, 72℃ extension for 30s, repeated for 30 cycles; 72℃ extension for 10min. The PCR product was recovered using an agarose gel purification kit, and the recovered PCR product was purified and recovered after being digested with BamH I and Xho I, and ligated with the pET-30(a) vector linearized by double digestion of BamH I and Xho I to construct the recombinant expression vector LvECR+pET-30(a), and the reading frame was sequenced to identify that it was accurate for subsequent expression.

[0115] The sequenced recombinant expression vector LvECR+pET-30(a) was transformed into E.coli BL21(DE3) competent cells and induced with IPTG. The recombinant expressed protein was purified using Ni-NTA His Tag Kit.

[0116] The recombinant protein LvECR obtained by the above purification was used for shrimp injection and acute hepatopancreatic necrosis infection test. 100 μL of purified LvECR (0.6 mg / mL) was injected intramuscularly into four groups of shrimp. The shrimp injected with LvECR / PBS were treated with VP AHPND (10 7 CFU / mL) were used for the treatment of poison, and the untreated shrimps were used as controls. There were 30 shrimps in each bucket, and 3 replicates were set in each group. Within 10 days after the treatment, the mortality of four groups of 30 shrimps was monitored every day, and the mortality of Penaeus vannamei was statistically analyzed (Table 4). The results showed that the injection of in vitro recombinant LvECR can effectively delay the occurrence of acute hepatopancreatic necrosis of shrimp and reduce the mortality rate.

[0117] Table 4 Protective effect of in vitro recombinantly expressed LvECR against acute hepatopancreatic necrosis in Litopenaeus vannamei

[0118]

[0119] In summary, it can be seen that the ecdysone receptor gene LvECR of the present invention plays an important role in acute hepatopancreatic necrosis of shrimp, and inhibiting its expression can aggravate the symptoms of acute hepatopancreatic necrosis. Increasing the LvECR content in shrimp by using in vitro recombinantly expressed LvECR protein can effectively protect shrimp from the occurrence of acute hepatopancreatic necrosis. With the development of shrimp genetic engineering technology, the corresponding gene manipulation technology is applied to enhance the expression of the gene, which can effectively inhibit the occurrence of acute hepatopancreatic necrosis of shrimp.

Claims

1. An ecdysone receptor gene LvECR, characterized in that: The base sequence of the ecdysone receptor gene LvECR is shown in SEQ ID NO:

1.

2. The ecdysone receptor gene LvECR according to claim 1, characterized in that: The amino acid sequence of the protein encoded by the LvECR gene is shown in SEQ ID NO:

2.

3. An application of the ecdysone receptor gene LvECR according to claim 1, characterized in that: The application of the ecdysone receptor gene LvECR in inhibiting pathogenic Vibrio infection.

4. The use of the ecdysone receptor gene LvECR according to claim 3, characterized in that: Application of enhancing the expression of ecdysone receptor gene LvECR in inhibiting acute hepatopancreatic necrosis infection in shrimp.

5. A preparation for inhibiting pathogenic Vibrio infection, characterized in that: The preparation contains the protein encoded by the ecdysone receptor LvECR gene according to claim 1.

6. The use of the preparation according to claim 5, characterized in that: The preparation is used in preparing a drug for inhibiting infection of acute hepatopancreatic necrosis of shrimp.

Images