High-activity S-sulfo-L-cysteine synthetase mutant and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a high-activity S-sulfo-L-cysteine synthetase mutant and application thereof. The optimized SSC03 enzyme is screened through clustering analysis and phylogenetic analysis, mutation design is further performed on the optimized SSC03 enzyme, the conversion rate of the finally obtained SSC03-S256P delta CT after 24-hour reaction is 56%, 84 mM of S-sulfo-L-cysteine is generated, and it is indicated that the SSC03-S256P delta CT can be used for further purification process development.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a highly active S-sulfo-L-cysteine ​​synthetase mutant and application thereof. Background Art

[0002] Mammalian cell cultures such as Chinese hamster ovary cells (CHO) and human embryonic kidney cells (HEK293) are widely used for the recombinant expression of therapeutic proteins and monoclonal antibodies. In order to grow cells to a higher density to increase the yield of recombinant proteins, nutrients need to be fed during the fermentation process. Because L-tyrosine and L-cysteine ​​require high pH to dissolve, the classic feeding method includes an alkaline feed containing L-tyrosine and L-cysteine ​​alone, which poses a challenge to the scale-up of the fermentation process. The new modified amino acids phospho-L-tyrosine disodium salt and S-sulfo-L-cysteine ​​sodium salt have high solubility at neutral pH and can replace L-tyrosine and L-cysteine ​​to produce high-concentration neutral feeds, which can prevent cell damage caused by local alkaline environment and acid-base neutralization exothermicity, and reduce the complexity of feed preparation and fed-batch process (Zimmer, A., Mueller, R., Wehsling, M., Schnellbaecher, A., & Von Hagen, J. (2014). Improvement and simplification of fed-batch bioprocesses with a highly soluble phosphotyrosine sodium salt. Journal of Biotechnology, 186, 110–118. https: / / doi.org / 10.1016 / j.jbiotec.2014.06.026; Hecklau, C., Pering, S., Seibel, R., Schnellbaecher, A., Wehsling, M., Eichhorn, T., Hagen, JV, & Zimmer, A. (2016). S-Sulfocysteine simplifies fed-batch processes and increases the CHO specific productivity via anti-oxidant activity. Journal of Biotechnology, 218, 53–63. https: / / doi.org / 10.1016 / j.jbiotec.2015.11.022).

[0003] S-sulfo-L-cysteine ​​sodium salt has a complicated chemical synthesis process and a market price of up to 9,000 yuan / kg, which hinders its application in the field of cell culture media. In 2010, researchers from the Institute of Plant Biochemistry and Photosynthesis in Spain discovered that S-sulfo-L-cysteine ​​synthase atCS26 in Arabidopsis thaliana synthesizes S-sulfo-L-cysteine ​​using O-acetylserine (OAS) and thiosulfate as substrates (Bermúdez, MA, Páez-Ochoa, MA, Gotor, C., & Romero, LC (2010). Arabidopsis S-Sulfocysteine ​​Synthase Activity Is Essential for Chloroplast Function and Long-Day Light-Dependent Redox Control. The Plant Cell, 22(2), 403–416. https: / / doi.org / 10.1105 / tpc.109.071985), but O-acetylserine is not easy to obtain. In 2014, researchers at the Karolinska Institute in Sweden discovered the S-sulfo-L-cysteine ​​synthetase mtCysK2 (Steiner, EM, D., P., Vilaplana, F., Schnell, R., & Schneider, G. (2014). CysK2 from Mycobacterium tuberculosis Is an O-Phospho-l-Serine-Dependent S-Sulfocysteine ​​Synthase. Journal of Bacteriology, 196(19), 3410–3420. https: / / doi.org / 10.1128 / JB.01851-14). Figure 1 shown.

[0004] The mtCysK2 enzyme from Mycobacterium tuberculosis is the only reported S-sulfo-L-cysteine ​​synthetase that uses O-phosphoserine as a substrate, but its enzyme kinetic parameter K cat / K m (OPS)=0.84mM -1 s -1The efficiency is relatively low and cannot meet the requirements of industrial catalysis (Steiner et al., 2014). Summary of the invention

[0005] In view of this, the present invention provides a highly active S-sulfo-L-cysteine ​​synthetase mutant and its application, aiming to screen and transform a highly active S-sulfo-L-cysteine ​​synthetase for synthesizing S-sulfo-L-cysteine ​​(SSC).

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a mutant of S-sulfo-L-cysteine ​​synthetase having:

[0008] (1), the amino acid sequence shown in SEQ ID NO:9, SEQ ID NO:11 or SEQ ID NO:13; or

[0009] (2) an amino acid sequence obtained by substituting, deleting or adding one or more residues of the amino acid sequence shown in (1), and having the same or similar function as (1); or

[0010] (3) an amino acid sequence having at least 90% homology to the amino acid sequence shown in (1) or (2);

[0011] The plurality is 2 to 5.

[0012] The present invention also provides a nucleic acid molecule encoding the mutant.

[0013] In some specific embodiments of the present invention, the above-mentioned nucleic acid molecule has:

[0014] (4) the nucleotide sequence shown in SEQ ID NO: 10, SEQ ID NO: 12 or SEQ ID NO: 14; or

[0015] (5) A nucleotide sequence obtained by replacing, deleting or adding one or more bases to the nucleotide sequence shown in (4), and having the same or similar function as (4); or

[0016] (6) a nucleotide sequence having at least 90% homology to the nucleotide sequence shown in (4) or (5);

[0017] The several number is 2 to 15.

[0018] The present invention also provides an expression vector, which includes the above nucleic acid molecule.

[0019] In some specific embodiments of the present invention, the backbone of the above-mentioned expression vector is a prokaryotic expression vector or a eukaryotic expression vector;

[0020] The prokaryotic expression vector may be an Escherichia coli expression vector.

[0021] The present invention also provides a host cell, which comprises the above nucleic acid molecule or the above expression vector.

[0022] In some specific embodiments of the present invention, the host cell may be a prokaryotic organism or a eukaryotic organism;

[0023] The prokaryotic organism may be Escherichia coli.

[0024] The present invention also provides the use of S-sulfo-L-cysteine ​​synthetase with UniProt ID A0A7U5MJ26 in preparing S-sulfo-L-cysteine.

[0025] In some specific embodiments of the present invention, the nucleotide sequence encoding the S-sulfo-L-cysteine ​​synthetase is:

[0026] (10), the nucleotide sequence shown in SEQ ID NO: 3; or

[0027] (11) A nucleotide sequence obtained by replacing, deleting or adding one or more bases to the nucleotide sequence shown in (10), and having the same or similar function as (10); or

[0028] (12) A nucleotide sequence having at least 90% homology to the nucleotide sequence shown in (10) or (11);

[0029] The number is 2 to 15.

[0030] The present invention also provides the use of the mutant in preparing S-sulfo-L-cysteine.

[0031] The present invention also provides the use of the nucleic acid molecule in preparing S-sulfo-L-cysteine.

[0032] The present invention also provides application of the expression vector in preparing S-sulfo-L-cysteine.

[0033] The present invention also provides the use of the host cell in preparing S-sulfo-L-cysteine.

[0034] The present invention also provides a method for preparing S-sulfo-L-cysteine, which comprises: mixing a substrate with the mutant, reacting, and obtaining S-sulfo-L-cysteine.

[0035] The present invention also provides a method for preparing S-sulfo-L-cysteine, which comprises: expressing the above nucleic acid molecule to obtain an expression product, mixing the expression product with a substrate, reacting, and obtaining S-sulfo-L-cysteine.

[0036] The present invention also provides a method for preparing S-sulfo-L-cysteine, which comprises: expressing the above expression vector, mixing the expression product with a substrate, reacting, and obtaining S-sulfo-L-cysteine.

[0037] The present invention also provides a method for preparing S-sulfo-L-cysteine, which comprises: culturing the above host cell, mixing the culture product with a substrate, reacting, and obtaining S-sulfo-L-cysteine.

[0038] The present invention also provides a method for preparing S-sulfo-L-cysteine, which comprises: mixing a substrate with the S-sulfo-L-cysteine ​​synthetase in the application, reacting, and obtaining S-sulfo-L-cysteine.

[0039] In some specific embodiments of the present invention, the substrate of the above method comprises O-phosphoserine and / or sodium thiosulfate.

[0040] The highly active S-sulfo-L-cysteine ​​synthetase mutant of the present invention and its application have the following effects:

[0041] The present invention screened out S-sulfo-L-cysteine ​​synthetase with better effect through cluster analysis and phylogenetic analysis. Unexpectedly, the SSC03 enzyme had a significantly higher 7h product concentration. In order to better meet the requirements of industrial production, further mutation design and construction were performed on it. The SSC03-S256PΔCT reaction finally obtained had a 24h conversion rate of 56%, and generated 84mM of S-sulfo-L-cysteine, which can be used for further purification process development. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0043] Figure 1 The reaction formula of S-sulfo-L-cysteine ​​synthetase CS26 and CysK2 is shown;

[0044] Figure 2 Threshold 10 -152 Sequence similarity network diagram (yellow is mtCysK2 enzyme);

[0045] Figure 3 Threshold 10 -151 Sequence similarity network diagram (yellow is mtCysK2 enzyme);

[0046] Figure 4 The consistency is >70%, the threshold is 10 -151 Sequence similarity network diagram (yellow is mtCysK2 enzyme);

[0047] Figure 5 The phylogenetic tree diagram beautified by iTOL tool is shown;

[0048] Figure 6 The expression results of candidate enzymes are shown;

[0049] Figure 7 The activity screening results of the candidate enzymes are shown;

[0050] Figure 8 The molecular docking model of SSC03 enzyme and its product S-sulfo-L-cysteine ​​is shown (green is the flexible loop region);

[0051] Fig. 9 Shows the multiple sequence alignment results of the flexible loop region of the candidate enzyme;

[0052] Fig.10 Shown is the comparison of the responses of SSC03 mutants;

[0053] Fig.11 Shows laboratory amplification of an enzyme reaction. DETAILED DESCRIPTION

[0054] The present invention discloses a highly active S-sulfo-L-cysteine ​​synthetase mutant and its application. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0055] The present invention provides a method for screening and modifying a highly active S-sulfo-L-cysteine ​​synthetase for synthesizing S-sulfo-L-cysteine, and the undisclosed sequence information involved is as follows:

[0056] SSC01 DNA sequence:

[0057] 1);

[0059] SSC02 DNA sequence:

[0060]

[0061] SSC03 DNA sequence:

[0062]

[0063] SSC04 DNA sequence:

[0064]

[0065] SSC05 DNA sequence:

[0066]

[0067] SSC06 DNA sequence:

[0068]

[0069] SSC07 DNA sequence:

[0070]

[0071] mtCysK2 DNA sequence:

[0072]

[0073] SSC03-S256P protein sequence:

[0074] MTHVLSIDTPRISRDHHTSCRYPVGAERFRPAPQQCRHAPDRYRRVGAMVGNTPVLWVGEPFGRGERGFWAKLEGTNPGGMKDRPAMHMVERAGLRGELLPGARIVESTSGTLGLGLALAGQVYRHPVTLVTDPGMEPIIRHMLAAYGARVDLVSQPHPVGGWQQARKDRVAELLAAEPDAWCPDQYSNPDNIDAYRPLALELLDQLGDIDVLVCSVGTGGHSAGVARVLRQHNPELELIGVDTIGSTIFGQPAGPRLMRGLGSSIYPRNVDYSAFTEVHWVAPAEAVWAARTLAATYYTSGGWSVGAVALVAGWAARTYPRGTRIAAVFPDGPQRYFDTIYNDDYCRDHHLLDTNPPSDPEEISTPTQAVVNRWTRCTTVVDPTATTTQPAEDHRSQLKIPTGKDGEHQIPA(SEQ ID NO:9);

[0075] SSC03-S256P DNA sequence:

[0076]

[0077] SSC03-S256PΔCT protein sequence:

[0078] MTHVLSIDTPRISRDHHTSCRYPVGAERFRPAPQQCRHAPDRYRRVGAMVGNTPVLWVGEPFGRGERGFWAKLEGTNPGGMKDRPAMHMVERAGLRGELLPGARIVESTSGTLGLGLALAGQVYRHPVTLVTDPGMEPIIRHMLAAYGARVDLVSQPHPVGGWQQARKDRVAELLAAEPDAWCPDQYSNPDNIDAYRPLALELLDQLGDIDVLVCSVGTGGHSAGVARVLRQHNPELELIGVDTIGSTIFGQPAGPRLMRGLGSSIYPRNVDYSAFTEVHWVAPAEAVWAARTLAATYYTSGGWSVGAVALVAGWAARTYPRGTRIAAVFPDGPQRYFDTIYNDDYCRDHHLLDTNPPSDPEEISTPTQAVVNRWTRCTTVVDPTATTT(SEQ ID NO:11);

[0079] SSC03-S256PΔCT DNA sequence:

[0080]

[0081] SSC03ΔCT protein sequence:

[0082] MTHVLSIDTPRISRDHHTSCRYPVGAERFRPAPQQCRHAPDRYRRVGAMVGNTPVLWVGEPFGRGERGFWAKLEGTNPGGMKDRPAMHMVERAGLRGELLPGARIVESTSGTLGLGLALAGQVYRHPVTLVTDPGMEPIIRHMLAAYGARVDLVSQPHPVGGWQQARKDRVAELLAAEPDAWCPDQYSNPDNIDAYRPLALELLDQLGDIDVLVCSVGTGGHSAGVARVLRQHNPELELIGVDTIGSTIFGQPAGSRLMRGLGSSIYPRNVDYSAFTEVHWVAPAEAVWAARTLAATYYTSGGWSVGAVALVAGWAARTYPRGTRIAAVFPDGPQRYFDTIYNDDYCRDHHLLDTNPPSDPEEISTPTQAVVNRWTRCTTVVDPTATTT(SEQ ID NO:13);

[0083] SSC03ΔCT DNA sequence:

[0084]

[0085] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0086] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0087] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the application is still operable. In addition, two or more steps or actions can be performed simultaneously.

[0088] The use of any and all examples or exemplary language such as "for example" or "including" herein is intended only to better illustrate the present application and is not intended to limit the scope of the present application. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the present application.

[0089] In addition, the numerical ranges and parameters used to define the present application are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0090] Unless otherwise specified, the raw materials, reagents, consumables and instruments involved in the present invention are all common commercial products and can be purchased from the market.

[0091] The present invention will be further described below in conjunction with the embodiments.

[0092] Example 1: Enzyme acquisition

[0093] 1. Cluster analysis and phylogenetic analysis of enzymes

[0094] The protein sequence of mtCysK2 enzyme was input into the local alignment search tool (Blastp) of the National Center for Biotechnology Information (NCBI) of the United States to retrieve homologous sequences, and the first 1000 results were taken to generate a sequence similarity network (SSN) using the enzyme similarity tool (EFI-EST). -152When the mtCysK2 enzyme was classified into a medium-sized cluster of all mycobacteria, the identity of its 49 sequences was >73%, indicating that the threshold was set too high and it was difficult to screen for enzymes with significant differences in this cluster ( Figure 2 ). When the threshold is lowered to 10 -151 , the mtCysK2 enzyme was just classified into the first large cluster containing 603 sequences. Too many sequences are also not conducive to enzyme screening ( Figure 3 ). Try to merge sequences with identity > 70% into one macro node, with a threshold of 10 -151 In the sequence similarity network of , the mtCysK2 enzyme was classified in the second largest cluster containing 69 nodes ( Figure 4 ).

[0095] The representative results of these 69 nodes were extracted in the network visualization analysis software Cytoscape, and the sequences were extracted using the ID mapping tool of UniProt. The sequences were processed by the ID Simplify tool of the software TBtool-II, imported into the software MEGA for alignment, and then the Neighbor-Joining phylogenetic tree was constructed ( Figure 5 ). One to three sequences were selected from each of the four groups in the phylogenetic tree for subsequent verification.

[0096] 2. Enzyme expression and activity screening

[0097] The protein sequences of the candidate enzymes in Table 1 were codon optimized using the tool ExpOptimizer based on the expression host E. coli, and the optimized coding nucleic acid sequences were submitted to Beijing Qingke Biotechnology for full gene synthesis, constructed in the pET-28a vector, and transformed into the BL21 (DE3) expression host to make puncture bacteria.

[0098] Table 1

[0099] UniProt accession number Species origin Enzyme name A0A554ULZ9 Skermania sp.ID1734 SSC01 A0A1A0KB32 Nocardia sp.852002-20019_SCH5090214 SSC02 A0A7U5MJ26 Mycobacterium intracellulare subsp. chimaera SSC03 H5X8L3 Saccharomonospora marina XMU15 SSC04 A0A1X1VCX8 Mycobacterium gastri SSC05 A0A1A0V3F6 Mycobacterium sp.852014-52144_SCH5372336 SSC06 A0A1X1YUE3 Mycobacterium nebraskense SSC07 Q79FV4 Mycobacterium tuberculosis mtCysK2

[0100] Dip the delivered puncture bacteria and streak them on the LB plate (Kan) and culture them in a 37℃ incubator overnight. Then pick two single colonies of appropriate size from each plate and culture them in 5mL LB liquid culture medium (Kan) at 37℃200rpm for 6-8h until turbidity. Take 1.5mL from it to prepare glycerol bacteria for preservation, add 5mL fresh LB liquid culture medium (Kan) to the rest, and add 0.1mMIPTG to induce expression at 16℃200rpm for 16-20h. Collect the bacteria by centrifugation, add the breaking buffer (20mM Na2HPO4 / NaH2PO4, 100mM NaCl, pH 7.6), ultrasonically break them, and centrifuge them at high speed. Sample the supernatant and precipitate separately for protein electrophoresis to detect the expression.

[0101] SSC06 and SSC07 were expressed in the precipitate, SSC03, SSC05, and mtCysK2 were expressed in the supernatant, SSC04 was expressed in both the supernatant and the precipitate, and SSC01 and SSC02 were expressed at low levels ( Figure 6 ).

[0102] 100 μL of each glycerol stock was transferred to 10 mL LB liquid medium (Kan) and cultured at 37°C 200 rpm overnight. Then all of them were transferred to 400 mL LB liquid medium (Kan) and cultured at 37°C 200 rpm for 2-3 h until OD 600 =0.6-1.0, add 0.1 mM IPTG and transfer to 16℃200rpm to induce expression for 16-20h. Centrifuge at 4℃7000rpm for 8min to collect the bacterial sludge and weigh it, add the disruption buffer according to the weight-to-volume ratio of 1:4 (g / ml) to resuspend and then ultrasonically disrupt.

[0103] Take 5 mL of the broken liquid and add it to 45 mL of the reaction solution (10 mM O-phosphoserine, 15 mM sodium thiosulfate, pH 7.0), shake the reaction in a 25°C water bath and monitor the pH. Sampling was performed at 15 min, 1 h, and 6 h, and the formation of the product S-sulfo-L-cysteine ​​was detected by high performance liquid chromatography (HPLC).

[0104] The optimal SSC03 enzyme produced S-sulfo-L-cysteine ​​at a concentration of 8.28 mM at 7 h of reaction, which is twice that of mtCysK2 ( Figure 7 ).

[0105] 3. Design and construction of mutations to improve activity

[0106] The AlphaFold2 predicted structure of SSC03 was molecularly docked with the product S-sulfo-L-cysteine ​​using the tool HDOCK. In the top ten models, the products of seven were distributed around the flexible loop region of Ile245-Asp272. The catalytic conserved residue Arg260 showed obvious interaction with the product in one of the models ( Figure 8 ). From the multiple sequence alignment results of the flexible loop region of the candidate enzyme ( Fig. 9 ) It can be seen that the Ser256 residue in SSC03_A0A7U5MJ26 is a rigid Pro in some species, which may reduce the swing of the loop region, accelerate the entry of substrates and the release of products, thereby improving the catalytic activity of the enzyme. From the predicted structure and the overall multiple sequence alignment results, it was found that the C-terminal Gln390-end of SSC03 is a non-conserved disordered region, and truncation may enhance the expression and stability of the protein.

[0107] The reverse primer SSC03-T389-dn of ΔCT (Δ390-end) was designed using the coding nucleic acid sequence of SSC03 as a template. The Ser256Pro mutation primer was designed using the tool PrimerX and submitted to Beijing Qingke Biosynthesis. The primer sequence is:

[0108] SSC03-T389-dn: TTCTCGAGTTAGGTGGTAGTCGCGGTCGGAT (SEQ ID NO: 15);

[0109] SSC03-S256P-up: CAGCCCGGCCGGCCCTCGCCTGATGC (SEQ ID NO: 16);

[0110] SSC03-S256P-dn: GCATCAGGCGAGGGCCGGCCGGCTG (SEQ ID NO: 17).

[0111] After amplifying the up and dn fragments according to the system shown in Table 2 and the procedure shown in Table 3, the fragments were recovered in 30 μL ddH2O using the Magen HiPureGel Pure DNA Mini Kit.

[0112] Table 2

[0113]

[0114] Table 3

[0115] 95℃ 3min 95℃ 15s 1(30cycles) 60℃ 15s 2(30cycles) 72℃ 45s 3(30cycles) 72℃ 5min

[0116] Then, different fusion fragments were amplified according to the system shown in Table 4 and the program shown in Table 5, and recovered in 30 μL ddH2O.

[0117] Table 4

[0118]

[0119] Table 5

[0120] 95℃ 3min 95℃ 15s 1(30cycles) 60℃ 15s 2(30cycles) 72℃ 70s 3(30cycles) 72℃ 5min

[0121] The fragments and vectors were digested with enzymes according to the system shown in Table 6 at 37°C for 2 h and recovered in 30 μL ddH2O.

[0122] Table 6

[0123]

[0124] According to the system shown in Table 7, different fragments were connected to the vector pET-28a. After 10 minutes of connection at room temperature, they were transformed into DH5α plates. The next day, positive clones were screened by colony PCR, and the plasmids were extracted and sent for sequencing and transformed into BL21 (DE3) expression hosts.

[0125] Table 7

[0126]

[0127] Example 2: Comparison of responses of SSC03 mutants

[0128] Plasmids pET28a-SSC03-S256P, pET28a-SSC03-S256PΔCT, and pET28a-SSC03ΔCT were transformed into homemade BL21 (DE3) competent cells, and all the recovered bacterial suspension was transferred to 10 mL LB liquid medium (Kan) and cultured at 37 °C 200 rpm overnight. 1.5 mL was taken from it to prepare glycerol bacteria for storage, and the rest was transferred to 400 mL LB liquid medium (Kan) and cultured at 37 °C 200 rpm for 2-3 h until OD 600 =0.6-1.0, add 0.1 mM IPTG and transfer to 16℃200rpm to induce expression for 16-20h. Centrifuge at 4℃7000rpm for 8min to collect the bacterial sludge and weigh it, add the disruption buffer at a weight-to-volume ratio of 1:4 to resuspend and then disrupt by ultrasonication.

[0129] Take 3 mL of the broken liquid and add it to 27 mL of the reaction solution (100 mM O-phosphoserine, 150 mM sodium thiosulfate, pH 7.0), shake the reaction in a 38°C water bath and monitor the pH. Sampling was performed at 1 h, 2 h, and 4 h, and the formation of the product S-sulfo-L-cysteine ​​was detected by high performance liquid chromatography (HPLC).

[0130] The wild type (WT) of SSC03 only produced 19.69 mM of S-sulfo-L-cysteine ​​in a 100 mM substrate system after 4 h of reaction, which may be caused by factors such as low enzyme activity, high concentration substrate inhibition, or degradation products of the enzyme. In contrast, the optimal SSC03-S256PΔCT mutant produced 47.85 mM ( Fig.10 ).

[0131] Example 3: Laboratory scale-up of enzyme reactions

[0132] Take 100 g of SSC03-S256PΔCT small-tank fermentation sludge, add crushing buffer at a weight-to-volume ratio of 1:4, resuspend, and homogenize twice at 800 bar to obtain a crude enzyme solution for use.

[0133] The reaction solution was prepared according to Table 8. The O-phosphoserine reaction solution was obtained by reacting serine and disodium adenosine triphosphate under the action of serine kinase. The initial concentration of O-phosphoserine was 191 mM, which was diluted to 167 mM before the reaction. Then, sodium thiosulfate was added to dissolve it completely, and the pH was adjusted to 7.0. Then, the SSC03-S256PΔCT crude enzyme solution was added to start the reaction. The reaction control and detection were similar to those in Example 2.

[0134] Table 8

[0135]

[0136] When SSC03-S256PΔCT used fermented bacterial sludge instead of shake flask bacterial sludge and the substrate O-phosphoserine was homemade, the conversion rate was 56% after 24h reaction, and 84mM S-sulfo-L-cysteine ​​was generated ( Fig.11 ), which can be used for further purification process development.

[0137] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A mutant of S-sulfo-L-cysteine ​​synthetase, characterized in that have: (1), the amino acid sequence shown in SEQ ID NO:9, SEQ ID NO:11 or SEQ ID NO:13; or (2) An amino acid sequence obtained by substituting, deleting or adding one or more residues of the amino acid sequence shown in (1), and having the same or similar function as (1); or (3) an amino acid sequence having at least 90% homology to the amino acid sequence shown in (1) or (2); The plurality is 2 to 5.

2. A nucleic acid molecule encoding the mutant according to claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that have: (4) the nucleotide sequence shown in SEQ ID NO: 10, SEQ ID NO: 12 or SEQ ID NO: 14; or (5) A nucleotide sequence obtained by replacing, deleting or adding one or more bases to the nucleotide sequence shown in (4), and having the same or similar function as (4); or (6) a nucleotide sequence having at least 90% homology to the nucleotide sequence shown in (4) or (5); The several number is 2 to 15.

4. An expression vector, characterized in that Comprising the nucleic acid molecule of claim 2 or 3.

5. A host cell, characterized in that It comprises the nucleic acid molecule according to claim 2 or 3 or the expression vector according to claim 2 or 3.

6. Use of S-sulfo-L-cysteine ​​synthetase with UniProt ID A0A7U5MJ26 in the preparation of S-sulfo-L-cysteine.

7. The use according to claim 6, characterized in that The nucleotide sequence encoding the S-sulfo-L-cysteine ​​synthetase is: (10), the nucleotide sequence shown in SEQ ID NO: 3; or (11) A nucleotide sequence obtained by replacing, deleting or adding one or more bases to the nucleotide sequence shown in (10), and having the same or similar function as (10); or (12) A nucleotide sequence having at least 90% homology to the nucleotide sequence shown in (10) or (11); The several number is 2 to 15.

8. Use of any of the following in the preparation of S-sulfo-L-cysteine: (i) The mutant according to claim 1; (ii) a nucleic acid molecule according to claim 2 or 3; (iii) the expression vector according to claim 4; (iv) The host cell according to claim 5.

9. A method for preparing S-sulfo-L-cysteine, characterized in that: include: (I) mixing the substrate with the mutant according to claim 1, reacting to obtain S-sulfo-L-cysteine; (II), expressing the nucleic acid molecule according to claim 2 or 3 to obtain an expression product, mixing the expression product with a substrate, reacting, and obtaining S-sulfo-L-cysteine; (III), expressing the expression vector according to claim 4, mixing the expression product with a substrate, and reacting to obtain S-sulfo-L-cysteine; (IV), culturing the host cell according to claim 5, mixing the culture product with a substrate, reacting, and obtaining S-sulfo-L-cysteine; (V) mixing the substrate with the S-sulfo-L-cysteine ​​synthetase used in the use of claim 6, and reacting them to obtain S-sulfo-L-cysteine.

10. The method according to claim 9, characterized in that The substrates include O-phosphoserine and / or sodium thiosulfate.

Images