Micromonas minuta SirTM gene, primer and application of micromonas minuta SirTM gene in preparation of colorectal cancer diagnosis molecular marker

Abstract

The invention provides a micromonas minuta SirTM gene, a primer and application of the micromonas minuta SirTM gene in preparation of a colorectal cancer diagnosis molecular marker, and belongs to the technical field of colorectal cancer diagnosis. According to the invention, a differential gene SirTM gene is obtained by comparing whole genome sequences of micromonas sp strains with different phenotypic differences; the gene is not transcribed and expressed in a low-toxicity strain and is transcribed and expressed in a high-toxicity strain. The characteristics of the gene are used for detecting the abundance of a micromonas minuta high-virulence strain in a colorectal cancer patient, that is, the expression condition of the excrement transcriptional level SirTM gene is detected, and the colorectal cancer risk is judged according to the expression condition of the SirTM gene; according to the method disclosed by the invention, the specificity and the sensitivity of colorectal cancer diagnosis are enhanced, a better diagnostic marker is provided for early common screening of colorectal cancer, and high-risk colorectal cancer patients can be recognized earlier, so that more targeted further examination and treatment are adopted.

Description

Technical Field

[0001] The present invention belongs to the technical field of colorectal cancer diagnosis, and in particular relates to Micromonas parvus SirTM gene, primers and application thereof in preparing molecular markers for colorectal cancer diagnosis. Background Art

[0002] Colorectal cancer (CRC) is a common malignant tumor in the gastrointestinal tract. Its morbidity and mortality rate are second only to gastric cancer, esophageal cancer and primary liver cancer among malignant tumors of the digestive system. Although surgery, chemotherapy, radiotherapy, targeted therapy and immunotherapy have made great progress in recent years, the early symptoms of colorectal cancer are not obvious, and early diagnosis of colorectal cancer is still based on colonoscopy, and there is no effective means of simple general screening. Studies have shown that specific pathogenic microorganisms, metabolites, and virulence factors in the intestinal flora are closely related to the occurrence and development of colorectal cancer, which provides new methods and approaches for the diagnosis of colorectal cancer. At present, some diagnoses are used to diagnose colorectal cancer by bacterial species abundance, but the specificity is poor. Summary of the invention

[0003] In view of this, the purpose of the present invention is to provide the Micromonas minimus SirTM gene, primers and their use in the preparation of molecular markers for the diagnosis of colorectal cancer. The present invention confirms that the expression of the Micromonas minimus SirTM gene can significantly change the development of colorectal cancer, and the expression level of the SirTM gene in the feces of cancer patients is significantly higher than that of normal people. The present invention diagnoses from the transcription level of specific genes of Micromonas minimus, which is accurate to the strain level, further enhancing the specificity and sensitivity of diagnosing colorectal cancer; it provides better diagnostic markers for early screening of colorectal cancer, which can help identify patients with high risk of colorectal cancer earlier, so as to take more targeted further examinations and treatments.

[0004] The present invention provides the SirTM gene of Micromonas pumila, and the nucleotide sequence of the SirTM gene is shown as SEQ ID No.1.

[0005] The present invention provides a primer pair for amplifying the SirTM gene, the primer pair comprising SirTM-F and SirTM-R; the nucleotide sequence of the SirTM-F is shown in SEQ ID No.2, and the nucleotide sequence of the SirTM-R is shown in SEQ ID No.3.

[0006] The present invention provides an application of the SirTM gene in identifying the toxicity of Micromonas minutis. If Micromonas minutis expresses the SirTM gene shown in SEQ ID No.1, it is a high-toxic strain. If Micromonas minutis does not express the SirTM gene shown in SEQ ID No.1, it is a low-toxic strain.

[0007] The present invention provides the use of the SirTM gene in preparing a molecular marker for colorectal cancer diagnosis. If the expression level of the SirTM gene in the stool sample of the individual to be diagnosed is significantly higher than that of a healthy individual, the individual to be diagnosed has a risk of colorectal cancer.

[0008] The present invention provides a colorectal cancer risk diagnosis kit, comprising the primer pair.

[0009] Preferably, it also includes qPCR amplification reaction solution, positive control substance, and negative control substance; the positive control substance is a plasmid containing the SirTM gene, and the negative control substance is DH5α Escherichia coli DNA nucleic acid.

[0010] The present invention also provides the use of the SirTM gene expression inhibitor in the preparation of a drug for preventing and / or treating colorectal cancer.

[0011] Compared with the prior art, the present invention has the following beneficial effects: the present invention obtains the gene with the greatest difference, SirTM gene, by comparing the whole genome sequences of Micromonas microsporus strains with different phenotypic differences; the gene is not transcribed and expressed in low-virulence strains, and is transcribed and expressed in high-virulence strains. The present invention uses the characteristics of the gene to detect the abundance of high-virulence strains of Micromonas microsporus in patients with colorectal cancer, that is, to detect the expression of SirTM gene at the transcription level in feces, and diagnose the risk of colorectal cancer according to the expression of SirTM gene; the present invention diagnoses from the transcription level of specific genes of Micromonas microsporus, accurately to the strain level, further enhances the specificity and sensitivity of diagnosing colorectal cancer, and provides better diagnostic markers for early screening of colorectal cancer, which can identify patients with high risk of colorectal cancer earlier, so as to take more targeted further examinations and treatments. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 The isolation of Micromonas minima strains and the detection of cytokine content in the supernatant of different Micromonas minima strains and THP-1 cells, where (A) is the flow chart of Micromonas minima isolation, (B) is the detection of IL-1β content in the supernatant of Micromonas minima co-incubated with THP-1 cells, and (C) is the detection of TNF-α content in the supernatant of Micromonas minima co-incubated with THP-1 cells;

[0013] Figure 2 Comparison of genomes and transcriptomes of Micromonas microti strains with different virulence, where (A) is a comparison of SNP differences in whole genome sequencing of high-virulence strains and low-virulence strains; (B) is a comparison of SirTM gene expression in transcriptomes of high-virulence strains and low-virulence strains;

[0014] Figure 3 This is an experiment on the promotion of colorectal cancer development by the Micromonas microsatellites SirTM gene, in which (A) is the detection of the proliferation of HT-29 and LoVo cells stimulated by the SirTM wild-type strain (HVS), knockout strain (HVS-ΔPm-42_1539), complemented strain (HVS-ΔPm-42_1539::Pm-42_1539), low virulence strain (LVS) and PBS blank control; (B) to (D) are tumor-bearing experiments of the SirTM wild-type strain, knockout strain and complemented strain: (B) is a tumor anatomy diagram, (C) is a comparison of tumor volumes, and (D) is a comparison of tumor weights;

[0015] Figure 4 The results of the SirTM wild-type, knockout, complemented and PBS blank control nude mouse tumor-bearing experiments, where (A) to (D) are the SirTM wild-type, knockout, complemented and PBS blank control APC min / + Results of oral administration of mice: (A) is the tumor anatomy, (B) is the tumor volume, (C) is the tumor number, and (D) is the colon length.

[0016] Figure 5 To compare the differences in SirTM gene transcription levels in feces between colorectal cancer patients and healthy people, (A) is the comparison of the differences in SirTM gene transcription levels in feces between colorectal cancer patients and healthy people, and (B) is the ROC curve analysis of SirTM clinical sample expression levels. DETAILED DESCRIPTION

[0017] The present invention provides a SirTM gene of Micromonas pumila, the nucleotide sequence of the SirTM gene is shown in SEQ ID No. 1, the length is 990 bp, and the specific sequence is as follows:

[0018] ATGAAAGAAAATTATAATAAAACAGATGGATACAGAGAAAGTATTC

[0019] AAATGGGACTTAAGGGATTAAAGACTGTTGGGAAAAATATATCTTCTGA

[0020] AAGTGAATTAAATAGAGAAAAGATTGAATTTTTAAAAAATGAAATAGA

[0021] AAATGCAGATGCAATTGTAATAGGTGCTGGAGCGGGGCTTTCAACTTC

[0022] AGCAGGTTGTACTTATAGTGGAGAGAGATTCGAAAAATATTTTTTTGAT

[0023] TTTTCAAAAAAATTTGGAATAGTAATATGTATTCAGGTGGGTTTTATCC

[0024] TTTTCCGGATAGAGAAACACTTTGGGCTTGGTGGGCAAGGCATATATAT

[0025] TTTAATAGATATCGAACCAAATCTGTTTATAGATTTATTTTCT

[0026] ATTGTAAAGGAAAGATATTTTGTTATTACTACAATGTAGATCATCA

[0027] ATTTCAAAGGGCAGGATTTGATAAAAAAAGACTTTTCTATACTCAAGG

[0028] NATIONGNATIONTTATTAGNationGTANCACCAAAATCAAAACATTA

[0029] GATAATGAGAATGGGTTATGAGAGCGATAGAAGTTCAAGGATTAG

[0030] AAAAATGAAGGGGTGTTTTTGATACCCTGAAAATATGGAAAATTCAA

[0031] TGAAAATTCCTACAGATATGATTCCAAAAATGTCCTGATGATGACTTGGA

[0032] TGTAACAATGAATCTTCGTGCTGACAGTTCATTTGTTGAAGATGAAGGT

[0033] TGGCATAAAGCGTCGAAAGAATTATTATTTCCTTGAAAAGTAAG

[0034] ATAAACATATACTCTTTTTAGGTTGGGTGTAGAATAATACTCCTGTT

[0035] ATTATAAAATATCCTTTCTGGCAAATTATCATGGAAAATAAAATTCAAT

[0036] TTATGCCTGTATTAATTATAAAGAAGCATTTTACCCTGAACAAATAAAAG

[0037] ACAGAAGTATTTGCATTGACGGAGATTTGGAGAAATACTAAAGAAAA

[0038] TTATGGAATAA.

[0039] The present invention compares the whole genome sequences of Micromonas microsporus strains with different phenotypes to obtain the SirTM gene with the greatest difference; the gene is not transcribed and expressed in low-virulence strains, and is transcribed and expressed in high-virulence strains. The gene in the low-virulence strain has 33 single nucleotide polymorphisms (SNPs) differences from the high-virulence strain.

[0040] The present invention provides a primer pair for amplifying the SirTM gene, wherein the primer pair comprises SirTM-F and SirTM-R; the nucleotide sequence of the SirTM-F is shown in SEQ ID No.2, and the nucleotide sequence of the SirTM-R is shown in SEQ ID No.3:

[0041] SirTM-F: GTAATAGGTGCTGGAGCGGG (SEQ ID No. 2)

[0042] SirTM-R: CCGGAAAAGGATAAAACCCACC (SEQ ID No. 3).

[0043] Based on this, the present invention provides the application of the SirTM gene in identifying the toxicity of Micromonas minima. If Micromonas minima expresses the SirTM gene shown in SEQ ID No.1, it is a high-toxic strain. If Micromonas minima does not express the SirTM gene shown in SEQ ID No.1, it is a low-toxic strain. The present invention does not specifically limit the reagents and methods for detecting the expression of the SirTM gene in Micromonas minima, and conventional reagents and methods in the art can be used. In the specific implementation of the present invention, the qPCR method is preferably used to amplify the above-mentioned primer pairs to obtain an amplified product, and then the expression of the SirTM gene is judged to determine the toxicity of Micromonas minima.

[0044] The present invention provides the use of the SirTM gene in the preparation of a molecular marker for the diagnosis of colorectal cancer. If the expression level of the SirTM gene in the stool sample of the individual to be diagnosed is significantly higher than that of a healthy individual, the individual to be diagnosed has a risk of colorectal cancer. The present invention confirms through in vivo and in vitro experiments that the SirTM gene of Micromonas microti promotes the development of colorectal cancer, and the SirTM gene can be used as a molecular marker to assist in the diagnosis of colorectal cancer. If the risk of colorectal cancer is determined by the expression level of the SirTM gene, it is necessary to further confirm the diagnosis in combination with clinical means.

[0045] The present invention also provides a colorectal cancer diagnosis kit, comprising the primer pair; preferably, the kit also includes a qPCR amplification reaction solution, a positive control substance, and a negative control substance. The positive control substance is preferably a plasmid containing the SirTM gene, and the negative control substance is preferably a DH5α Escherichia coli DNA nucleic acid.

[0046] The present invention also provides the use of the SirTM gene expression inhibitor in the preparation of a drug for preventing and / or treating colorectal cancer.

[0047] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0048] Example 1

[0049] Isolation of Micromonas parvum strains and detection of their pro-inflammatory ability

[0050] Isolation and culture of Micromonas parvum

[0051] (1) Stool sample collection. A total of 10 stool samples were included in this study, including 9 stool samples from colorectal cancer patients from Beijing Century Memorial Hospital. The inclusion criteria were: 1) patients with pathologically confirmed CRC; 2) no antibiotics or probiotics in the past 2 months; 3) meeting the criteria for surgical treatment. In addition, 1 normal stool sample was included. The inclusion criteria were: 1) no intestinal and digestive tract diseases; 2) no antibiotics or probiotics in the past 2 months.

[0052] (2) Preparation of stool suspension from stool samples: Add 1 g of stool sample to 10 mL of PBS and resuspend thoroughly.

[0053] (3) Pre-culture of fecal samples. Pre-culture is performed by adding sheep blood and rumen fluid to a blood culture bottle. The blood culture bottle is an anaerobic blood culture bottle. Add 10% sheep blood and 10% rumen fluid to a blood culture bottle or conical flask, with a total volume of 50 ml. After the fecal suspension is allowed to stand for 5 minutes, take 0.5 ml of the supernatant and add it to a blood culture bottle or conical flask that has been pre-added with sheep blood and rumen fluid. The culture is carried out for 30 days under anaerobic conditions at 37°C. On days 3, 6, 9, 12, 15, 27, and 30, extract the mixed bacterial solution from the blood culture bottle for the next experiment.

[0054] (4) Dilution and application of mixed bacterial solution. 1 Up to 10 8 Dilution in multiples, dilute and spread each gradient of diluted bacterial solution on solid culture medium, and the solid culture medium is blood agar plate for culture. The culture conditions are anaerobic, 37℃.

[0055] (5) Single clone picking and liquid amplification. According to the size, color and morphology of the single clone, single clones are picked from the cultured solid culture medium and transferred to the liquid culture medium. The liquid culture medium uses TSB + 5% fetal bovine serum. The culture conditions are anaerobic and 37°C.

[0056] (6) Preserved strains and bacterial identification: The liquid-amplified bacteria were divided into three zones on the solid culture medium. The liquid-amplified bacteria were preserved in glycerol. The solid culture medium was cultured under anaerobic conditions at 37°C, and the preserved strains were stored at -80°C. After the solid culture medium was cultured, the single clone was identified by MALDI-TOF mass spectrometry.

[0057] Detection of cytokine content in supernatant of different Micromonas microti strains interacting with THP-1 cells

[0058] (1) Establishment of the whole genome evolutionary tree of different Micromonas microti strains. The 99 strains of Micromonas microti obtained by the above-mentioned isolation and culture were sent to Beijing Novogene Technology Co., Ltd. for whole genome sequencing and evolutionary tree establishment. One strain was randomly selected from each branch of the evolutionary tree as a representative strain for subsequent experiments.

[0059] (2) THP-1 cell plating and cell stimulation. THP-1 cells were added to a 12-well plate at a number of 10 6 Then, 100 ng / mL propylene glycol methyl ether acetate (PMA) was added to each well and incubated for 48 h to stimulate them into macrophages.

[0060] (3) Co-incubation of bacteria and cells. After the strain was revived, the bacterial solution was adjusted to OD = 1, and then subcultured at a ratio of 1:40 and cultured in an anaerobic chamber for 72 hours to the end of the logarithmic phase. The bacterial culture supernatant was diluted 100 times with cell culture medium, and 750 μl of the dilution was added to the well plate. After the two were co-incubated for 3 hours, the cell culture supernatant was collected to detect cytokines.

[0061] (4) Cytokine detection: The collected cell culture supernatant was tested for cytokines using an ELISA kit to detect IL-1β and TNF-α.

[0062] Study Results

[0063] A total of 99 strains of Micromonas parvum were isolated and cultured from 10 stool samples and stored at -80°C. Different strains of Micromonas parvum showed significant differences in the stimulation of THP-1 cells, indicating that the virulence of Micromonas parvum varies at the strain level.

[0064] The experimental results show that from the perspective of the evolutionary tree, Micromonas minima belongs to different branches and has different differences in the genome. The strains on different branches have different stimulations on THP-1 cells. Both IL-1β and TNF-α indicate that the virulence of Micromonas minima is significantly different. Based on the effects on the different virulence of cells, Micromonas minima is divided into high virulence strains (HVS) and low virulence strains (LVS).

[0065] Example 2 Comparison of genomes and transcriptomes of Micromonas microti strains with different virulence

[0066] Comparison of the whole genomes of high-virulence and low-virulence strains of Micromonas parvum

[0067] The assembled genome was annotated using Prokka v1.13 software and the annotation output was used in Panaroo v1.2.8 software to identify gain / loss matrices of the core genome.

[0068] Transcriptome sequencing and analysis of highly virulent and hypovirulent strains of Micromonas parvum

[0069] (1) Strain sequencing: High-virulence strains and low-virulence strains were cultured in TSB + 5% fetal bovine serum medium to the logarithmic phase. Total bacterial RNA was extracted using an RNA extraction kit (PureLink RNAMini Kit). cDNA libraries were constructed at Beijing Novogene Technology Co., Ltd. and sequenced on the Illumina NovaSeq platform.

[0070] (2) Sequencing analysis: Sequencing reads were trimmed using Trimmomatic v0.39 software and mapped to the reference genome (NCBI accession number: SRR17999374) using BWA v0.7.17 software. The number of reads assigned to genes was calculated using featureCounts v2.0.6. Differentially expressed genes and pathway enrichment analysis were performed using the R software package DESeq2 v1.34.0 and ClusterProfiler v4.2.2 software.

[0071] result

[0072] In order to screen the virulence factors of highly virulent strains, the whole genome of 99 strains of Micromonas microsporus was first sequenced, and then the sequences of 10 experimental strains and ATCC33270 strain were compared in core genes and accessory genes. There were 286 single nucleotide polymorphisms (SNPs) in 77 core genes, of which SirTM had the most SNP changes, with 33 SNP differences, 15 synonymous mutations, and 18 non-synonymous mutations. Subsequently, bacterial transcriptome sequencing was performed on two representative strains of highly virulent strains and low virulent strains, and the expression levels of bacterial genes were detected. It can be seen from the transcriptome that although the SirTM gene exists in both high and low virulent strains, strain SirTM is expressed in highly virulent strains but not in low virulent strains.

[0073] It was found that the differential gene between different virulence strains of Micromonas parvus is the SirTM gene. This gene is expressed in high-virulence strains but not in low-virulence strains. It may play an important role in the development of colorectal cancer.

[0074] Example 3 Micromonas parvum SirTM gene promotes the development of colorectal cancer

[0075] Construction of SirTM knockout and complementation strains

[0076] (1) sBHI medium was prepared according to the following formula: 30 g brain heart infusion broth (BHI), 4 g yeast extract, 0.4 g cysteine, 0.008 g heme, and 12 g agar, which were finally dissolved in 1000 mL distilled water. After high-pressure sterilization, antibiotics were added for later use (erythromycin was added to a final concentration of 5 μg / ml for the knockout strain and kanamycin was added to a final concentration of 30 μg / ml for the complemented strain).

[0077] (2) Knockout strain: Using wild strain DNA and a plasmid containing the erythromycin resistance gene (ermb) as templates, the upper and lower homologous arms of the SirTM gene and the erythromycin resistance gene were PCR synthesized, and the three PCR products were fused; complementation strain: Using wild strain DNA and a plasmid containing the chloramphenicol resistance gene (kanr) as templates, the upper and lower homologous arms of the insertion position, the SirTM gene and the kanamycin resistance gene were PCR synthesized, and the four PCR products were fused. The specific primer sequences are shown in Table 1.

[0078] Table 1 Primer sequences used for the construction of SirTM knockout and complementation strains

[0079]

[0080]

[0081] The PCR product synthesis system (50 μL) and procedure are shown in Table 2:

[0082] Table 2 PCR amplification system

[0083]

[0084] The qPCR amplification program is shown in Table 3:

[0085] Table 3 PCR amplification program

[0086]

[0087] PCR fusion system (50 μL) and procedure are shown in Table 4:

[0088] Table 4 PCR fusion system

[0089]

[0090]

[0091] The PCR fusion program is shown in Table 5.

[0092] Table 5 PCR fusion program

[0093]

[0094] (3) Take 10 μL of the fused PCR product and add it to the sBHI medium. After it dries, add OD 600 =1 was overlaid on the PCR product with 10 μL of the wild-type or knockout strain bacterial solution and cultured at 37°C for 3 days under anaerobic conditions.

[0095] (4) Pick out single clones grown on the solid plate for identification of SirTM gene knockout strains or complementation strains.

[0096] Detection of SirTM wild-type, knockout and complemented strains in stimulating proliferation of HT-29 and LoVo cells

[0097] (1) Collect cells in the logarithmic phase, count the cells using a cell counter, add the cell suspension to a 96-well plate at a volume of 180 μL / well, and set the cell number to 2 × 10 4 (That is, the cell concentration is: 1.1×10 5 / mL).

[0098] (2) The 96-well plate was placed in an incubator for incubation for 4 h, and then bacterial solution was added, with an MOI of 10 and a bacterial solution volume of 50 μL. A total of four groups were set up, namely: SirTM wild-type strain, knockout strain, complemented strain, and PBS blank control group.

[0099] (3) At 24, 48, and 72 hours, carefully remove the supernatant cell culture medium, prepare the solution in a volume ratio of cell culture medium to MTT solution of 9:1, add 100 μL of the prepared solution to each well, and add a blank well without cells as a blank control, and continue culturing for 4 hours.

[0100] (4) After incubation for 4 h, carefully aspirate the supernatant in the well plate (try not to touch the cells at the bottom when aspirating), then add 110 μL of Formazan solution to each well. The solution will turn purple and then be placed on a shaker for 10 min.

[0101] (5) The absorbance was measured using an ELISA instrument at a wavelength of λ = 490 nm. Figure 3 As shown in A.

[0102] Nude mouse tumor experiment of SirTM wild-type, knockout and complemented strains

[0103] (1) Purchase 5-week-old female nude mice in advance and allow them to acclimate for 3 to 5 days.

[0104] (2) LoVo and HT-29 cells in the logarithmic phase were digested, blown evenly, and counted using a cell counter. The cell concentration was diluted and then the cell suspension was added to a cell culture flask (T75 specification). 6×10 6 The cells were placed in an incubator for 4 h.

[0105] (3) Then adjust the concentration of bacteria grown to the logarithmic phase, and add bacteria after the cells have been incubated for 4 hours to make the MOI 10. Similarly, a total of four groups were set up, namely: SirTM wild-type strain, knockout strain, complemented strain and PBS blank control group.

[0106] (4) After 24 h of incubation, the cells were digested with trypsin, counted using a cell counter, and diluted to a concentration of 3 × 10 7 Next, each group was mixed with bacteria or a corresponding volume of cell culture medium at an MOI of 1.

[0107] (5) Each nude mouse was injected subcutaneously at the axilla with an injection volume of 0.1 mL, i.e., 3×10 cells were injected into each mouse. 6 indivual.

[0108] (6) Three hours after cell injection, mice were given an intraperitoneal injection of piperacillin antibiotics (150 mg / kg body weight).

[0109] (7) The tumor volume was then measured every two days, and the experiment was terminated by killing the mice on the 24th day.

[0110] SirTM wild-type, knockout, and complemented strains APC min / + Mouse gavage experiment

[0111] (1) Purchase 5-week-old female APCs from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. in advance min / + Mice were allowed to acclimate over a period of 3 to 5 days.

[0112] (2) Before oral gavage, mice were given streptomycin (2 mg / mL) in the drinking water for 3 days to clean the intestines and facilitate the colonization of M. parvum.

[0113] (3) A total of four groups were set up, namely: SirTM wild-type strain, knockout strain, complemented strain and PBS blank control group.

[0114] (4) Then, the patient was given oral administration once a day for 12 weeks, with 10 9 CFU / piece.

[0115] (5) Feces of mice were collected at the beginning and end of oral gavage, and blood was collected at the midpoint and end point.

[0116] Experimental Results

[0117] The wild-type, knockout, and complemented strains of Micromonas microti SirTM were interacted with cells at an MOI of 10, and PBS was used as a blank control group for comparison. The MTT cell proliferation assay was performed at 48 hours, and the results of both LoVo and HT-29 cells showed that the wild-type and complemented strain groups were significantly different from the other two groups.

[0118] The results of nude mouse tumor bearing experiment showed that as time went on, the tumor volume of SirTM wild-type and complemented strain groups gradually increased and was significantly different from the other two groups, while there was no significant difference between the knockout strain and the blank group. In addition, the tumor weight also showed significant difference between SirTM wild-type and complemented strain groups and the other two groups.

[0119] From APC min / + From the mouse gavage experiment, in the comparison of tumor volume, the SirTM wild strain and complemented strain groups were significantly larger than the knockout strain and blank control group. The number of tumors was also significantly larger in the SirTM wild strain and complemented strain groups than in the knockout strain and blank control group. There was no significant difference in colorectal length.

[0120] Both in vivo and in vitro experiments have confirmed that the SirTM gene of Micromonas parvum can promote the development of colorectal cancer.

[0121] Example 4 Comparison of SirTM gene transcription levels in feces of colorectal cancer patients and healthy people

[0122] (1) Stool sample collection. A total of 36 stool samples were included in this study, including 18 stool samples from colorectal cancer patients from Beijing Century Memorial Hospital. The inclusion criteria were: 1) patients with pathologically confirmed CRC; 2) no antibiotics or probiotics in the past 2 months; 3) meeting the criteria for surgical treatment. In addition, 18 normal stool samples were included. The inclusion criteria were: 1) no intestinal and digestive tract diseases; 2) no antibiotics or probiotics in the past 2 months.

[0123] (2) Extraction of RNA from stool samples: RNA from 36 stool samples was extracted using a stool RNA extraction kit (AllPrep DNA / RNA FFPE Kit).

[0124] (3) Reverse transcription of the extracted RNA.

[0125] The HiScript III RT SuperMix for qPCR kit was used for mRNA reverse transcription. The specific steps are as follows:

[0126] Genomic DNA removal: Prepare in an RNase-free centrifuge tube as shown in Table 6:

[0127] Table 6 Genome DNA removal system

[0128]

[0129]

[0130] Use a pipette to gently mix, place the tube in a PCR instrument, and set the reaction conditions at 42°C for 2 minutes to remove the DNA in the genome.

[0131] cDNA synthesis: Prepare in an RNase-free centrifuge tube as shown in Table 7:

[0132] Table 7 cDNA synthesis system

[0133]

[0134] Use a pipette to gently pipette to mix, and perform cDNA synthesis reaction according to the procedure in Table 8:

[0135] Table 8 cDNA synthesis program

[0136]

[0137] cDNA can be used for qPCR detection. Storage conditions: -20℃ for half a year; -80℃ for long term. cDNA should be stored in aliquots to avoid repeated freezing and thawing.

[0138] (4) qPCR detection of fecal samples. Perform qPCR reaction according to the following procedure:

[0139] The qPCR amplification system (20 μL) is shown in Table 9.

[0140] Table 9 qPCR amplification system

[0141]

[0142] The qPCR amplification program is shown in Table 10.

[0143] Table 10 qPCR amplification program

[0144]

[0145] After the reaction is completed, the calculation is performed according to 2 -△△CT Calculate and compare.

[0146] The primer sequences are as follows:

[0147] SirTM-F: GTAATAGGTGCTGGAGCGGG (SEQ ID No. 2)

[0148] SirTM-R: CCGGAAAAGGATAAAACCCACC (SEQ ID No. 3)

[0149] (5) SPSS27 software was used to perform clinical ROC curve analysis on the gene.

[0150] Experimental Results

[0151] The SirTM gene is expressed in high-virulence strains but not in low-virulence strains. Fecal samples from 18 colorectal cancer patients and 18 healthy people were collected, RNA was extracted from the fecal samples, and the expression of SirTM was detected at the transcription level using the qPCR method. The results showed that SirTM was significantly more expressed in the feces of colorectal cancer patients than in the fecal samples of healthy people. At the same time, a clinical ROC curve analysis was performed on the gene, and the results showed that the area under the ROC curve was 96.9%, indicating that SirTM has a high specificity as a potential biomarker for colorectal cancer.

[0152] The SirTM gene is significantly expressed in the feces of patients with colorectal cancer and can be used as a candidate diagnostic marker for colorectal cancer. It can specifically distinguish between healthy people and colorectal cancer patients. It can be used as an early screening marker for the early diagnosis of colorectal cancer and can non-invasively predict colorectal cancer at an early stage.

[0153] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. The SirTM gene of Micromonas pumila, characterized in that The nucleotide sequence of the SirTM gene is shown in SEQ ID No.

1.

2. A primer pair for amplifying the SirTM gene according to claim 1, characterized in that: The primer pair includes SirTM-F and SirTM-R; the nucleotide sequence of SirTM-F is shown in SEQ ID No.2, and the nucleotide sequence of SirTM-R is shown in SEQ ID No.

3.

3. The use of the SirTM gene according to claim 1 in identifying the toxicity of Micromonas microti, characterized in that: If Micromonas pumila expresses the SirTM gene shown in SEQ ID No. 1, it is a highly virulent strain, and if Micromonas pumila does not express the SirTM gene shown in SEQ ID No. 1, it is a low-virulence strain.

4. The use of the SirTM gene according to claim 1 in preparing a molecular marker for colorectal cancer diagnosis, characterized in that: If the expression level of the SirTM gene in the stool sample of the individual to be diagnosed is significantly higher than that of a healthy individual, the individual to be diagnosed has a risk of colorectal cancer.

5. A colorectal cancer risk diagnostic kit, characterized in that: Comprising the primer pair described in claim 2.

6. The colorectal cancer diagnosis kit according to claim 5, characterized in that: It also includes qPCR amplification reaction solution, positive control substance, and negative control substance; the positive control substance is a plasmid containing the SirTM gene, and the negative control substance is DH5α Escherichia coli DNA nucleic acid.

7. Use of the SirTM gene expression inhibitor according to claim 1 in the preparation of a drug for preventing and / or treating colorectal cancer.

Images