Rice endogenous RNA efficient gene editing system based on CRISPR / Cas13b system and application

Abstract

The invention discloses a rice endogenous RNA (Ribonucleic Acid) efficient gene editing system based on a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) / Cas13b (Clustered Regularly Interspaced Short Palindromic Repeats) system and application, the rice endogenous RNA efficient gene editing system comprises a Cas13b protein subjected to sequence optimization, and the nucleotide sequence of the Cas13b protein is shown as SEQ ID NO: 1 or The system can efficiently edit a plurality of rice endogenous mRNA and long-chain non-coding RNA at the same time, has a lower incidental effect, and provides a powerful tool for rice functional genomics research and crop improvement. The CRISPR / Cas13b can target a plurality of genes at the same time, has a lower incidental effect while realizing efficient knockout, avoids the influence caused by an off-target effect to a great extent, and improves the accuracy of CRISPR / Cas13b in rice RNA editing application.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and in particular relates to a rice endogenous RNA efficient gene editing system based on the CRISPR / Cas13b system and its application. Background Art

[0002] The clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) system is an adaptive immune system of prokaryotes that can recognize and resist the invasion of foreign nucleic acids (such as viruses and plasmids). The tools developed based on this system have been widely used in other organisms, including plants, for editing DNA and RNA. The CRISPR / Cas system family is mainly composed of CRISPR sequences and different Cas proteins, which can be divided into different categories and subtypes according to their functions and structures. For example, Cas9, Cas12, Cas13, etc. are all relatively common types of Cas proteins, which differ in the types of nucleic acids they target (DNA or RNA) and the way they cut.

[0003] Unlike the widely used DNA-targeting CRISPR / Cas9, Cas13 is a Cas protein with RNA-guided RNA interference activity from the class II and type VI CRISPR systems. CRISPR / Cas13 is a system with RNA-guided RNA interference activity, including multiple subtypes, but it is still challenging to establish an efficient, stable, and low-collateral gene editing system in rice. Summary of the invention

[0004] The purpose of the present invention is to provide a rice endogenous gene efficient editing system based on CRISPR / Cas13b, which can simultaneously and efficiently edit multiple rice endogenous mRNAs and long non-coding RNAs, and has low collateral effects, so as to overcome the problems existing in the prior art and provide a powerful tool for rice functional genomics research and crop improvement.

[0005] As one aspect of the present invention, the present invention provides a rice endogenous RNA efficient gene editing system based on the CRISPR / Cas13b system, which includes a sequence-optimized Cas13b protein, and the nucleotide sequence of the Cas13b protein is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0006] As a preferred embodiment of the rice endogenous RNA efficient gene editing system based on the CRISPR / Cas13b system described in the present invention: it also includes a direct repeat sequence, and the direct repeat sequence is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0007] As a preferred embodiment of the rice endogenous RNA efficient gene editing system based on the CRISPR / Cas13b system of the present invention, it comprises: (1) Construction of Cas13b expression vector; (2) constructing a multi-target sgRNA expression cassette containing the direct repeat sequence; (3) Construction of multi-target sgRNA vectors; (4) Connect the multi-target sgRNA expression cassette sequence in the multi-target sgRNA vector to the Cas13b expression vector.

[0008] As a preferred solution of the rice endogenous RNA efficient gene editing system based on the CRISPR / Cas13b system described in the present invention: in step (1), the pYLCRISPR / Cas9Pubi-H vector is used as the backbone, and the Cas9 sequence therein is replaced with the Cas13b protein sequence to obtain the pCAMBIA-Cas13b expression vector.

[0009] As a preferred embodiment of the rice endogenous RNA efficient gene editing system based on the CRISPR / Cas13b system described in the present invention: in step (2), the direct repeat sequence is connected to the pYLsgRNA-OsU3 vector, the pYLsgRNA-OsU6a vector and the pYLsgRNA-OsU6c vector, and each sgRNA fragment is connected to the pYLsgRNA-OsU3 vector, the pYLsgRNA-OsU6a vector or the pYLsgRNA-OsU6c vector, respectively, and a multi-target sgRNA expression cassette containing the direct repeat sequence is obtained by PCR amplification.

[0010] As a preferred embodiment of the rice endogenous RNA efficient gene editing system based on the CRISPR / Cas13b system described in the present invention: in step (3), the sgRNA expression cassette is digested with BsaI and connected to the pYLCRISPR / Cas9PUbi-H vector digested with BsaI to obtain a multi-target sgRNA vector.

[0011] As a preferred embodiment of the rice endogenous RNA efficient gene editing system based on the CRISPR / Cas13b system described in the present invention: in step (3), a multi-target sgRNA expression cassette sequence with SgsI restriction sites on both sides is amplified from the multi-target sgRNA vector, digested with SgsI enzyme, and ligated to the pCAMBIA-Cas13b expression vector with T4 DNA ligase.

[0012] The present invention also provides the application of the rice endogenous RNA efficient gene editing system based on the CRISPR / Cas13b system in rice gene editing.

[0013] Preferably, the method comprises constructing transgenic rice by using Agrobacterium-mediated transformation.

[0014] The present invention also provides a Cas13b protein: the nucleotide sequence of the Cas13b protein is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0015] The beneficial effects of the present invention are as follows: a rice endogenous gene efficient editing system based on CRISPR / Cas13b is provided, which can simultaneously and efficiently edit multiple rice endogenous mRNAs and long non-coding RNAs, and has low collateral effects, providing a powerful tool for rice functional genomics research and crop improvement. The present invention can target multiple genes at the same time, achieve efficient knockout while having low collateral effects, avoid the impact caused by off-target effects to a large extent, and improve the accuracy of CRISPR / Cas13b in rice RNA editing applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the technical solution of the embodiment of the present invention, the following briefly introduces the drawings required for describing the embodiment, wherein: Figure 1 Codon adaptation indexes (CAI) of PspCas13b and PguCas13b before and after codon optimization.

[0017] Figure 2 This is the PspCas13b / Anti-OsPHRs vector map.

[0018] Figure 3 This is the PguCas13b / Anti-OsPHRs vector map.

[0019] Figure 4 This is the PspCas13b / Anti-OsIPS1 vector map.

[0020] Figure 5 The optimized PspCas13b and PguCas13b can simultaneously knock down the expression of OsPHRs at multiple targets.

[0021] Figure 6 PspCas13b and PguCas13b can knock down the expression of endogenous OsIPS1.

[0022] Figure 7PspCas13b and PguCas13b have low collateral effects.

[0023] Figure 8 PspCas13b / Anti-OsIPS1 and PguCas13b / Anti-OsIPS1 do not affect the rice growth phenotype. DETAILED DESCRIPTION

[0024] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with specific embodiments.

[0025] Embodiment 1: System composition: This system mainly consists of two parts: Cas13b protein and sgRNA. We selected two orthologs of Cas13b from Prevotella sp.P5-125 (PspCas13b) and Prophyromonas gulae (PguCas13b) as target Cas13b proteins. These two Cas13bs have high RNA interference activity in eukaryotic cells.

[0026] Codon Optimization: In order to improve the expression efficiency of PspCas13b and PguCas13b in plants, we optimized their codons to significantly improve their codon adaptation index values, thereby increasing their heterologous expression efficiency in rice ( Figure 1 ). The optimized PspCas13b sequence is shown in SEQ ID NO: 1; the optimized PguCas13b sequence is shown in SEQ ID NO: 2.

[0027] Vector construction: Construction of pCAMBIA-Cas13b expression vector: The present invention uses Liu Yaoguang's pYLCRISPR / Cas9Pubi-H (Addgene, Plasmid #66187) multi-target vector as the backbone, and replaces the original Cas9 sequence with the optimized PspCas13b or PguCas13b coding sequence by enzyme cutting to construct vectors for simultaneously expressing Cas13b proteins in plants: pCAMBIA-PspCas13b and pCAMBIA-PguCas13b.

[0028] Specifically, using the codon-optimized Cas13b sequence (SEQ ID NO: 1) as a template, primers SpeI-PspCas13b-F: GTTTGGTGTTACTTCTGCAGACTAGTATGAACATCCCTGCTCTCGTTG, SpeI-PguCas13b-F: GTTTGGTGTTACTTCTGCAGACTAGTATGACTGAGCAGTCTGAAAGACC and NES-PKI-Mlu1-R: TTTGAACGATCGGGAGGATCACGCGTCTATCCTCCAGTCTTGTTAATATCAAGTCCAGC were used to amplify the corresponding sequences. At the same time, pYLCRISPR / Cas9Pubi-H was used as a template, and primers Cas9-linearized primer-F: GATCCTCCCGATCGTTCAAACATTTG and primer Cas9-linearized primer-R: CTGCAGAAGTAACACCAAACAACAG were used to amplify pCAMBIA-P ubi Backbone. Cas13b sequence and pCAMBIA-P ubi The backbone was connected by seamless cloning to obtain pCAMBIA-P ubi - PspCas13b and pCAMBIA-P ubi - PguCas13b.

[0029] Design sgRNA sequence: The design of sgRNA was completed by the online website targetDesign. The sgRNA sequence length was 30 bases, and the 5'DD and 5'ND of the spacer flanking sites were designed according to the preferences of PspCas13b and PguCas13b. The sgRNA sequences are shown in SEQ ID NO: 5~12.

[0030] Construction of sgRNA intermediate expression vector: The intermediate vectors of sgRNA of PspCas13b and PguCas13b were constructed by artificially synthesizing direct repeat sequences (DR) and directly annealing them into double-stranded DNA fragments. Three vectors, pYLsgRNA-OsU3 (addgene #66192), pYLsgRNA-OsU6a (addgene #66195) and pYLsgRNA-OsU6c (addgene #66197), were constructed by PCR amplification, and the DR sequences of Cas13b of Psp and Pgu were connected into these three vectors respectively by seamless fusion to obtain the intermediate vectors of pYLsgRNA-OsU3-PspCas13b, pYLsgRNA-OsU6a-PspCas13b, pYLsgRNA-OsU6c-PspCas13b, pYLsgRNA-OsU3-PguCas13b, pYLsgRNA-OsU6a-PguCas13b and pYLsgRNA-OsU6c-PguCas13b containing the DR sequence of Cas13b.

[0031] The amplification primer sequences of the above three vectors pYLsgRNA-OsU3, pYLsgRNA-OsU6a and pYLsgRNA-OsU6c are as follows: sgRNA-vector-F:CAAGAGCTTGGAGTGGATGGAAT sgRNA-vector REV:CGAGACCCACGCTGGAT Constructing sgRNA expression cassettes containing multiple target sites: First, the sgRNA sequence of the target gene was synthesized and annealed to form a double-stranded DNA fragment, which was ligated to pYLsgRNA-OsU3-PspCas13b (the target gene sgRNA sequence is SEQ ID NO: 5~6 or SEQ ID NO: 11~12), pYLsgRNA-OsU6a-PspCas13b (the target gene sgRNA sequence is SEQ ID NO: 7~8, pYLsgRNA-OsU6c-PspCas13b (the target gene sgRNA sequence is SEQ ID NO: 9~10), pYLsgRNA-OsU3-PguCas13b (the target gene sgRNA sequence is SEQ ID NO: 5~6 or SEQ ID NO: 11~12), pYLsgRNA-OsU6a-PguCas13b (the target gene sgRNA sequence is SEQ ID NO: 9~10), pYLsgRNA-OsU3-PguCas13b (the target gene sgRNA sequence is SEQ ID NO: 5~6 or SEQ ID NO: 11~12), pYLsgRNA-OsU6a-PguCas13b (the target gene sgRNA sequence is SEQ ID NO: 9~10) after BsaI digestion by seamless fusion method. NO: 7~8, pYLsgRNA-OsU6c-PguCas13b (target gene sgRNA sequence is SEQ ID NO: 9~10) intermediate vector. Then, the U3-sgRNA, U6a-sgRNA and U6c-sgRNA sequences were amplified by the first round of PCR (system: 2μL ligation product, 0.3 μL UF and gR-R primers, 5 μL buffer, 1μL 2mmol / L dNTPs, and 0.2 μL KOD FX high-fidelity enzyme. PCR reaction system: 98 ºC 2 minutes, 98ºC 10 seconds; 60ºC 15 seconds; 72ºC 20 seconds, 72 ºC 5 minutes), and then these three sequences were added to the same reaction system (0.5ul PCR product, 15 μL 2 buffer, 3 μL primer mixture, 0.5 μL KOD FX high-fidelity enzyme, water to 30ul system. PCR reaction system is 98ºC 2 minutes, 98ºC 10 seconds; 60ºC 15 seconds; 72ºC 20 seconds, 72ºC 5 minutes) for the second round of PCR to connect them in series into sgRNA expression cassette.

[0032] The sequences of the primers for the first round of PCR amplification are as follows: F:CTCCGTTTTACCTGTGGAATCG gR-R:CGGAGGAAAATTCCATCCAC The second round PCR primer sequences are as follows: Uctcg-B1':TTCAGAggtctcTctcgACTAGTGGAATCGGGCAGCAAAGG gRctga-B2: AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC Uctga-B2':TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG gRaaga-B3: AGCGTGggtctcGtcttGGTCCATCCACTCCAAGCTC Uaaga-B3':TTCAGAggtctcTaagaCACTGGAATCGGCAGCAAAGG gRgact-B4: AGCGTGggtctcGagtcGGTCCATCCACTCCAAGCTC Ugact-B4':TTCAGAggtctcTgactCACTGGAATCGGCAGCAAAGG gRggac-B5: AGCGTGggtctcGgtccGGTCCATCCACTCCAAGCTC Uggac-B5':TTCAGAggtctcTggacCACTGGAATCGGCAGCAAAGG gRtctg-B6: ​​AGCGTGggtctcGcagaGGTCCATCCACTCCAAGCTC Utctg-B6':TTCAGAggtctcTtctgCACTGGAATCGGCAGCAAAGG gRcggt-BL: AGCGTGggtctcGaccgACGCGTCCATCCACTCCAAGCTC Construction of pCAMBIA-Cas13b / multi-target sgRNA expression cassette vector: First, multiple sgRNA expression cassettes were connected to the pYLCRISPR / Cas9PUbi-H vector according to the following system: 15ng sgRNA expression cassette, 1ul 10 x rCutsmart buffer, 0.5ul BsaI enzyme and pYLCRISPR / Cas9Pubi-H vector digested with BsaI, and sterile water was added to 13ul, and incubated at 37 degrees for 10 minutes. Subsequently, 1.5ul 10xT4 DNA ligation reaction buffer and 0.5ul T4 DNA ligase were added, and pYLCRISPR / Cas9PUbi-H / multi-target sgRNA vector was obtained after incubation under specific conditions.

[0033] Finally, multiple anti-target sgRNA expression cassette sequences with SgsI restriction sites on both sides were amplified from the pYLCRISPR / Cas9PUbi-H / multi-target sgRNA vector by PCR, digested with SgsI enzyme, and finally ligated into the pCAMIBIA-Cas13b vector by T4 DNA ligase to obtain the pCAMBIA-Cas13b / multiple anti-target sgRNAs vector (see Figure 2-4 ).

[0034] Construction of rice transgenic materials and verification of knockout effects: Construction of rice transgenic materials: The invention adopts the method of Agrobacterium-mediated transformation to construct transgenic rice.

[0035] The construction of transgenic rice is mainly divided into the following steps: callus induction, subculture, Agrobacterium activation co-culture, selection culture and differentiation. The general process is as follows: Take mature seeds and shell them manually or mechanically, select plump, smooth and sterile seeds, and put them into a 50 ml sterilized centrifuge tube for disinfection (70% alcohol disinfection for 2 min, 30 ml 30% sodium hypochlorite solution for 30 min, sterile water washing 4-5 times and soaking for 30 min). Spread the disinfected seeds on sterilized filter paper, dry them, and culture them at 28℃ for 3 weeks.

[0036] Pick out the light yellow callus tissue with good growth, dense and spherical shape, place it in the subculture medium, and culture it at 28℃ for 7-10 days.

[0037] Place the Agrobacterium suspension at 28°C and 250 rpm for 12-24 hours to make a suspension and activate Agrobacterium. Pick about 100 pale yellow calli with good growth and uniform size, put them into the Agrobacterium suspension, and incubate them on a horizontal shaker for 10 minutes. Place the callus on sterilized filter paper to drain for 30-40 minutes, then transfer it to a co-culture medium covered with a layer of filter paper and culture it in the dark at 28°C for 2.5-3 days.

[0038] The co-cultured callus was removed and washed with sterile water for 5-6 times, and the callus was removed and placed on sterile filter paper to drain for 1.5 hours, and then transferred to the first round of selection medium, about 30 per dish, and cultured at 28℃ for 14 days. The calli after the first round of selection were transferred to the second round of selection medium, about 12 per dish, and cultured at 28℃ for 14 days.

[0039] Transfer the calli after the first round of selection to the differentiation medium and wait for about 35 days in a constant temperature culture room at 28°C for the calli to differentiate into seedlings. Take out the seedlings from the differentiation tank, harden them in the greenhouse for about 3 days, culture them in rice nutrient solution for 1-2 weeks, and verify the positive seedlings by PCR.

[0040] Verification of CRISPR / Cas13b multi-target knockout effect: Total RNA from rice roots was extracted using TRIzol (ThermoFisher), and 3ug of total RNA was subsequently treated with TURBO DNase (ThermoFisher) to remove genomic DNA. After DNA digestion, the DNase-treated RNA was reverse transcribed using SuperSciptII reverse transcriptase (ThermoFisher), Oligo (dT), and the corresponding specific sgRNA primers to obtain complementary DNA (cDNA) as a template for semi-quantitative PCR and quantitative PCR experiments.

[0041] The effect of target gene knockout was verified by semi-quantitative RT-PCR (Semi-RT-PCR) and quantitative PCR (qRT-PCR). Gene-specific primers were used and OsActin was used as the internal reference gene. The target gene and the internal reference gene were amplified by a specific PCR program. RT-PCR was analyzed by agarose gel electrophoresis of the amplified products. According to the brightness of the electrophoresis bands, the expression levels of the target genes in different samples were compared to a certain extent. qRT-PCR used the ChamQ Universal SYBR qPCR Master Mix (Vazyme) system and compared the expression levels of the target genes in different samples by calculating the difference in the number of cycles after running on the LightCycler 480 (Roche).

[0042] We selected three homologous genes, PHR1, PHR2 and PHR3, as candidate genes to explore the multi-target knockout effect of Cas13b. We designed two targets on each gene, a total of six target sequences, and obtained stable transgenic plants of PspCas13b / Anti-OsPHRs and PguCas13b / Anti-OsPHRs ( Figure 5 ).like Figure 5As shown, by detecting the changes in the expression of PHRs and their downstream target genes through RT-PCR, we found that PspCas13b / Anti-OsPHRs has the ability to simultaneously knock down the expression of multiple PHR homologous genes. At the same time, we also constructed PspCas13b / Anti-OsIPS1 and PguCas13b / Anti-IPS1 transgenic rice targeting Induced by Phosphate Starvation 1 (IPS1), and also found that the expression of IPS1 in transgenic plants was significantly knocked down ( Figure 6 ).

[0043] Assessment of collateral effects: After the Cas13 protein binds to the target RNA and is activated, there is a risk that it may degrade non-target RNA, which will cause non-specific off-target effects. In order to evaluate the off-target effect of the CRISPR / Cas13b system of the present invention, we selected the IPS1 (Induced by Phosphate starvation 1) gene as the target RNA gene for investigation. We performed whole transcriptome sequencing on the transgenic plants of PspCas13b / Anti-OsIPS1 #6 and PguCas13b / Anti-OsIPS1 #4 to detect off-target effects. Figure 7 As shown in Figure 2, only 78 genes were significantly down-regulated in PspCas13b / Anti-OsIPS1 transgenic plants compared with the wild type (log 2 FC < -1; P adj < 0.05), 171 genes were significantly up-regulated (log 2 FC>1;P adj <0.05); in PguCas13b / Anti- OsIPS1 transgenic plants, 48 ​​genes were significantly downregulated and 123 genes were significantly upregulated. Gene function enrichment (GO) analysis showed that only 2.14% of these differentially expressed genes were enriched in specific pathways and had no obvious association with OsIPS1, which means that the nonspecific off-target effect was weak.

[0044] Cas13b does not affect rice growth phenotype: In terms of agronomic traits, wild-type Nipponbare and PspCas13b / Anti-OsIPS1 and PguCas13b / Anti-OsIPS1 transgenic plants were cultivated in hydroponic low-Pi conditions and field Pi-deficient rice fields. No significant differences in growth morphology were found between transgenic plants and wild-type plants during the seedling and flowering stages ( Figure 8). In addition, agronomic traits such as dry weight, effective tiller number, yield per ear and yield per plant were also not significantly different from those of the wild type. Therefore, the CRISPR / Cas13b knockdown system had no significant effect on plant growth and yield traits when targeted editing of high-abundance RNA at different developmental stages, which strongly proved that it has low collateral effects.

[0045] In summary, existing gene editing technologies are prone to off-target effects. A limiting factor of the CRISPR / Cas13 system is that the incidental activity of Cas13 can also cause non-specific RNA cutting. The present invention optimizes the Cas13 sequence by codon optimization to make it better expressed in monocotyledons. At the same time, the establishment of this system can express six sgRNAs at the same time, and effectively edit multiple genes at the same time, and has lower incidental effects. The present invention provides a new RNA editing method that can be used for crop improvement, and due to the interchangeability of the CRISPR / Cas13b system target, it can be more widely used in different crop improvement fields according to the selection of different targeted genes, thereby achieving different functions.

[0046] Optimized PspCas13b sequence: SEQ ID NO:1 Optimized PguCas13b sequence: SEQ ID NO:2 DR sequence (direct repeat sequence) of PspCas13b: SEQ ID NO:3 gggatccagcgtgggtctcggttgtggaaggtccagttttgaggggctattacaacttttttggtaccgacaagagcttggagtgatgg DR sequence of PguCas13b: SEQ ID NO:4 gggatccagcgtgggtctcggttggatctaccctctatttgaagggtacacacaacttttttggtaccgacaagagcttggagtggatgg Target gene target sequence: SEQ ID NO:5 OsPHR1 target1-agattcatgcaattccggggtccatctcat SEQ ID NO:6 OsPHR1 target2-cccttgttcttcaattcgaagctgcaattt SEQ ID NO:7 OsPHR2 target3-cctgggacgaacgcagaggcccaacagac SEQ ID NO:8 OsPHR2 target4-atctacaaagcgctcatgaagttcaggagt SEQ ID NO:9 OsPHR3 target5-atctacgaaacgctcgtggagctccggtgt SEQ ID NO:10 OsPHR3 target6-gacctccatttgcatccgaagagcttctg SEQ ID NO:11 OsIPS1 target1-gggcttaagaggggggagaagaggaagctc SEQ ID NO:12 OsIPS1 target2-ccaagatcaaactcaagattcatccggct Explanation of terms and terms involved in the present invention: CRISPR / Cas13b: The CRISPR / Cas13b system belongs to the CRISPR-Cas system family and is an adaptive immune system found in prokaryotes. It is an RNA-guided gene editing technology that can edit the genome efficiently and accurately. The CRISPR / Cas13b system consists of two parts: one is the guide RNA (gRNA), which is a small RNA molecule that has the ability to specifically recognize the target RNA sequence; the other is the Cas13b protein, which is a ribonuclease that can form a complex with the gRNA to bind to the target RNA sequence, cut the target RNA, edit the specific RNA, and ultimately interfere with the normal function of the RNA. The CRISPR / Cas13b system has the advantages of accurate recognition and high interference, and has been widely used in multiple species.

[0047] Target gene: Target gene refers to the target gene acted upon by specific molecules (such as nucleases, transcription factors, drugs, etc.) during gene editing, gene regulation or drug development. In gene editing technology (such as CRISPR-Cas system), by designing a guide RNA (gRNA) complementary to the specific sequence of the target gene, the Cas protein is guided to locate to the specific position of the target gene, thereby cutting, modifying or regulating the target gene, so as to study the function of the gene or change the genetic traits of the organism.

[0048] Off-target: In the gene editing process, off-target refers to the editing effect of gene editing tools (such as CRISPR-Cas system) at unintended genomic sites. Normally, the designed guide RNA (gRNA) should specifically guide the Cas protein to bind to the target gene site, but due to the complexity of the genome and the possible partial similarity between the gRNA and the genome sequence, the gRNA sometimes mismatches with non-target DNA sequences, causing the Cas protein to cut or perform other editing operations at these unintended sites. Off-target effects may cause a series of potential problems. For example, in gene therapy applications, off-target may lead to the destruction of normal gene function, thereby causing new health problems or disease risks; in basic research, off-target will interfere with the accurate judgment of the target gene function, cause deviations in experimental results, and affect the reliability of research conclusions.

[0049] Collateral effects: In CRISPR / Cas system-related research and some other biological contexts, "collateral effects" refer to some unexpected, additional effects or results that occur simultaneously when the target is operated. Taking the CRISPR / Cas13 system as an example, its main function is to specifically target and cut the target RNA to regulate the expression of specific genes. However, when the Cas13 protein binds to the target RNA and is activated, it may exhibit a non-specific RNA cutting activity in the cell, that is, in addition to the target RNA, it will also degrade some other RNA molecules that were not originally intended to be cut, thereby affecting the normal physiological functions of these RNAs. This unexpected cutting of non-target RNA and the series of subsequent effects it brings are called collateral effects.

[0050] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. A rice endogenous RNA efficient gene editing system based on the CRISPR / Cas13b system, characterized by: It includes a sequence-optimized Cas13b protein, the nucleotide sequence of which is shown in SEQ ID NO: 1 or SEQ ID NO:

2.

2. The rice endogenous RNA efficient gene editing system based on the CRISPR / Cas13b system according to claim 1, characterized in that: Also included are direct repeat sequences, which are shown in SEQ ID NO: 3 or SEQ ID NO:

4.

3. The rice endogenous RNA efficient gene editing system based on the CRISPR / Cas13b system according to claim 1 or 2, characterized in that: include, (1) Construction of Cas13b expression vector; (2) constructing a multi-target sgRNA expression cassette containing the direct repeat sequence; (3) Construction of multi-target sgRNA vectors; (4) Connect the multi-target sgRNA expression cassette sequence in the multi-target sgRNA vector to the Cas13b expression vector.

4. The rice endogenous RNA efficient gene editing system based on the CRISPR / Cas13b system according to claim 3, characterized in that: In step (1), the pYLCRISPR / Cas9Pubi-H vector is used as the backbone, and the Cas9 sequence therein is replaced with the Cas13b protein sequence to obtain the pCAMBIA-Cas13b expression vector.

5. The rice endogenous RNA efficient gene editing system based on the CRISPR / Cas13b system according to claim 4, characterized in that: In step (2), the direct repeat sequence is ligated into the pYLsgRNA-OsU3 vector, the pYLsgRNA-OsU6a vector and the pYLsgRNA-OsU6c vector, and each sgRNA fragment is ligated into the pYLsgRNA-OsU3 vector, the pYLsgRNA-OsU6a vector or the pYLsgRNA-OsU6c vector, respectively, and a multi-target sgRNA expression cassette containing the direct repeat sequence is obtained by PCR amplification.

6. The rice endogenous RNA efficient gene editing system based on the CRISPR / Cas13b system according to claim 5, characterized in that: In step (3), the sgRNA expression cassette is digested with BsaI and ligated to the pYLCRISPR / Cas9PUbi-H vector digested with BsaI to obtain a multi-target sgRNA vector.

7. The rice endogenous RNA efficient gene editing system based on the CRISPR / Cas13b system according to claim 6, characterized in that: In step (3), a multi-target sgRNA expression cassette sequence with SgsI restriction sites on both sides is amplified from the multi-target sgRNA vector, digested with SgsI enzyme, and ligated into the pCAMBIA-Cas13b expression vector using T4 DNA ligase.

8. Application of the rice endogenous RNA efficient gene editing system based on the CRISPR / Cas13b system according to claim 1 in rice gene editing.

9. The use according to claim 8, characterized in that: The invention comprises constructing transgenic rice by using Agrobacterium-mediated transformation method.

10. A Cas13b protein, characterized in that: The nucleotide sequence of the Cas13b protein is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

Images